Supplemental Data. ALDH1 Is a Marker of Normal and Malignant. Human Mammary Stem Cells. and a Predictor of Poor Clinical Outcome

Size: px
Start display at page:

Download "Supplemental Data. ALDH1 Is a Marker of Normal and Malignant. Human Mammary Stem Cells. and a Predictor of Poor Clinical Outcome"

Transcription

1 Cell Stem Cell, Volume 1 Supplemental Data ALDH1 Is a Marker of Normal and Malignant Human Mammary Stem Cells and a Predictor of Poor Clinical Outcome Christophe Ginestier, Min Hee Hur, Emmanuelle Charafe-Jauffret, Florence Monville, Julie Dutcher, Marty Brown, Jocelyne Jacquemier, Patrice Viens, Celina Kleer, Suling Liu, Anne Schott, Dan Hayes, Daniel Birnbaum, Max S. Wicha, and Gabriela Dontu

2

3 Figure S1. Overlap between the normal mammary epithelial cell population with ALDH activity detected by the ALDEFLUOR assay and the cell population expressing ALDH1 protein or expressing cytokeratin 18 protein, as detected by immunostaining. ALDEFLUOR-negative and ALDEFLUOR-positive cells from normal breast epithelium were separated by FACS using the ALDEFLUOR assay. Cells were then fixed in RNA later, immunostained with ALDH1 antibody and analyzed by flow cytometry (A-C), or cytospun on poly-lysined slides, fixed in methanol-acetone (1:1) and immunostained with ALDH1 or CK18 antibodies (D-G). ALDEFLUOR-negative cells did not have ALDH1 protein at levels detectable by immunostaining (M1=.88%) (A), whereas ALDEFLUOR-positive cells contained the entire cell population detected by the ALDH1 antibody (B). Overlay showing a direct comparison between ALDH1 immunostaining of ALDEFLUOR-negative and ALDEFLUOR-positive cells (C). Immunostaining with ALDH1 antibody on cytospun sorted cells confirmed the FACS analysis showing that ALDEFLUOR-negative cells are negative for ALDH1 staining whereas ALDEFLUOR-positive cells comprised 15% of ALDH1-positive cells (D-E). Immunostaning with CK18 antibody on cytospun sorted cells confirmed the results of the double immunofluorescent staining in situ, showing that only ALDEFLUOR-negative cells contained CK18-positive cells (F-G)

4

5 Figure S2. ALDH1 staining and duct morphology in a sequence of four consecutive sections of normal breast epithelium. A-D. Four consecutive sections of normal breast epithelium were stained with H&E (A) and immunostained for ALDH1 (red cytoplasmic staining) (B-C). The sequence of serial sections shows the formation of three side branches from the initial duct. The ALDH1-positive cells are located at the separation points, where side branches emerge. D. A schematic representation of the branching structure showing the position of the four consecutive sections (blue arrows).

6 UM1 UM2 UM3 Supplementary Figure 3 With DEAB Without DEAB With DEAB Without DEAB With DEAB Without DEAB 1K R1 R2 1K R1 R2 1K R1 R2 1K R1 1K R2 R1 R2 1K R1 R Side Scatter 6 4 Side Scatter 6 4 Side Scatter 6 4 Side Scatter 6 4 Side Scatter 6 4 Side Scatter BAAA BAAA BAAA BAAA BAAA BAAA Region Events %Gated R R Region Events %Gated R R Region Events %Gated R R2 9.9 Region Events %Gated R R Region Events %Gated R R Region Events %Gated R R Tum or size ( cm ) Days after injection 5, cells ALDEFLUOR + 5, cells ALDEFLUOR + 5 cells ALDEFLUOR + 5, cells ALDEFLUOR - 5, cells ALDEFLUOR - 5 cells ALDEFLUOR - 5, unsorted cells 5 unsorted cells Tumor size ( cm ) Days after injection 5, cells ALDEFLUOR + 5, cells ALDEFLUOR + 5 cells ALDEFLUOR + 5, cells ALDEFLUOR - 5, cells ALDEFLUOR - 5 cells ALDEFLUOR - 5, unsorted cells 5 unsorted cells Tumor size (cm) Days after injection 5, cells ALDEFLUOR + 5, cells ALDEFLUOR + 5 cells ALDEFLUOR + 5, cells ALDEFLUOR - 5, cells ALDEFLUOR - 5 cells ALDEFLUOR - 5, unsorted cells 5 unsorted cells

7 Figure S3. The ALDEFLUOR positive cell population has properties of cancer stem cells. Representative flow cytometry analysis of ALDH activity in cells derived from human breast tumors, orthotopically xenotransplanted in NOD/SCID mice (UM1, left panel; UM2, central panel; UM3 right panel). Cells incubated with ALDEFLUOR substrate (BAAA) and the ALDH specific inhibitor, DEAB, were used to establish the baseline fluorescence of these cells (R1) and to define the ALDEFLUOR-positive region (R2). Incubation of cells with ALDEFLUOR substrate in the absence of DEAB induced a shift in BAAA fluorescence defining the ALDEFLUOR-positive population. All the ALDEFLUOR analyses of human breast tumor cells were first gated on PI negative cells (viable cells) that represented 73.6 ± 1.8% of the total population. Tumor progression curves were plotted for the numbers of cells injected in NOD/SCID mice (5, cells; 5, cells; 5 cells) and for each cell population (ALDEFLUOR-positive, ALDEFLUOR-negative, Unseparated).

8

9 Figure S4. Overlap between the cell populations identified by the ALDEFLUOR assay and the CD44+/CD24 - /lin - phenotype in human breast tumors. ALDEFLUOR-negative and -positive cells from three human breast tumor xenotransplants (MC1, UM1, UM2) were separated by FACS using the ALDEFLUOR assay. In all experiments cells were first gated on PI negative cells (viable cells) that represented 73.6 ± 1.8% of the total population. Cells were then fixed in RNA later, immunostained with a CD24-PE antibody, a CD44 APC antibody, and antibodies for lineage markers, labeled Pe-Cy5. In all the flow cytometry analyses cells were first gated on lin - markers, that represented 12.3 ± 1.1% of the total population. These cell populations were gated out in the flow charts shown on the left side of the figure. The diagrams in the right side show the representation of the cell fractions defined by the ALDEFLUOR and the CD44 + /CD24-/lin - combined phenotype in the total tumor cell population (PI negative).

10 A B D Gated on dead cells stained with 7AAD PI Alde - Alde + Alde - Alde + 14% 11% 16% 1% C Supplementary Figure 5

11 Figure S5. Example of FACS analysis procedure used for the ALDEFLUOR assay in the normal and malignant human breast epithelium. A. All samples (normal breast reductions and tumors) were first gated according to the side and the forward scatter to select epithelial cells and to eliminate contaminating non-epithelial cells, clusters, and debris (gate R). The cell fraction gated on R represented 65.4 ±4.2% of the total cell population. B. Subsequently, all tumor samples were gated according to PI staining and H2Kd staining. Only the cells negative for PI staining (viable cells) and negative for H2Kd staining (human cells) were selected for the ALDEFLUOR analysis (gate R1). The PI-negative/H2Kd-negative population represented 73.6 ±1.8% of the cell population gated on R. For the normal epithelium samples, only PI staining was performed for viability, since there were no contaminating cells of mouse origin. The PI-negative population represented 93.4 ±2.4% of the cell population gated on R. C. All samples (normal epithelium and tumors) were analyzed using the ALDEFLUOR assay on the cell population gated on R and R1. D. The percentage of non-viable cells detected using PI staining was similar to that detected using 7AAD. Two aliquots from normal mammary epithelial cells treated with BAAA according to the ALDEFLUOR assay were stained in the last step with 7AAD and PI respectively, to identify potential differences in the ability of the two stains to detect non-viable cells. The two viability assays appeared to identify the same cells.

12 Compensation and gate setup Analysis Control unstained ALDEFLUOR-negative Control APC only ALDEFLUOR-positive CD44-APC CD24-PE Control PE only CD44-APC CD24-PE Supplementary Figure 6

13 Figure S6. Analysis of the cell populations defined by the ALDEFLUOR and CD44CD24lin- phenotypes in the UM2 tumor. The ALDEFLUOR-positive population in UM2 showed a considerably higher fluorescence compared to the other tumors (Figure S3). This required compensation and different gate setup for the analysis of the markers CD44CD24lin, as shown in the flow chart on the left side of the figure.

14 Table S1. Tumorigenicity in the humanized fat pad of NOD/scid mice. MC1 UM1 UM2 UM3 Tumors/injections Cells injected/fat pad 5x x1 4 5x1 3 5 ALDEFLUOR-negative 2/4 --- /2 /4 ALDEFLUOR-positive 4/ /1 4/4 Unseparated 4/ /1 3/3 ALDEFLUOR-negative /4 --- /1 /3 ALDEFLUOR-positive 3/ /1 3/3 Unseparated 3/ /1 2/3 ALDEFLUOR-negative 1/3 /1 /1 /3 ALDEFLUOR-positive 3/3 1/1 1/1 3/3 Unseparated 3/3 1/1 1/1 3/3 ALDEFLUOR-negative 1/ /4 ALDEFLUOR-positive 3/ /1 4/4 Unseparated 3/ /1 3/3

15 Characteristics Table S2. Correlation between ALDH1 protein expression and histoclinical characteristics U.M. set I.P.C. set ALDH1 ALDH1 ALDH1 ALDH1 Negative Positive Negative Positive No. of (%) No. of (%) p-value No. of (%) No. of (%) p-value patients patients patients patients All cases 122 (81) 24 (19) 243 (7) 12 (3) Age (years) 5 33 (27) 6 (25) NS 79 (35) 25 (25) NS >5 89 (73) 18 (75) 164 (65) 77 (75) Pathological tumor size PT1 61 (6) 1 (45) NS 13 (42) 37 (37) NS PT2 33 (33) 7 (32) 18 (45) 46 (47) PT3 7 (7) 5 (23) 3 (13) 16 (16) SBR grade I 25 (22) 2 (9) <.5 8 (33) 24 (24) <.1 II 55 (49) 7 (3) 12 (49) 38 (38) III 33 (29) 14 (61) 43 (18) 39 (38) Lymph node metastasis Negative 53 (56) 9 (41) NS 134 (56) 43 (44) NS Positive 42 (44) 13 (59) 17 (44) 55 (56) Estrogen receptor Negative 38 (34) 14 (61) <.5 41 (17) 39 (39) <.1 Positive 75 (66) 1 (39) 198 (83) 61 (61) Progesterone receptor Negative 5 (44) 15 (62) <.5 61 (26) 51 (52) <.1 Positive 64 (56) 9 (38) 17 (74) 47 (48) Ki-67 Negative (<2) (91) 77 (82) <.5 Positive ( 2) (9) 17 (18) ERBB2 Negative (/1+) 94 (83) 15 (62) <.5 28 (94) 76 (79) <.1 Positive (2+/3+) 19 (17) 9 (38) 14 (6) 2 (21) Cytokeratin 18 (CK18) Negative (5) 9 (9) NS Positive (95) 85 (91) Cytokeratin 5/6 (CK5/6) Negative (72) 46 (58) <.5 Positive (28) 33 (42) Cytokeratin 14 (CK14) Negative (96) 68 (86) <.1 Positive (4) 11 (14)

16 Supplemental Experimental Procedures Normal breast tissue dissociation Normal breast tissue from reduction mammoplasties was dissociated mechanically and enzymatically, as previously described (Stingl et al., 1998). Tissue was minced and dissociated in Ham s F12/Dulbecco s modified Eagle s medium (F12:DMEM; 1:1; StemCell technologies, Durham, NC, USA) supplemented with 1 mm Hepes, 2% bovine serum albumin (BSA; Fraction V; GIBCO TM INVITROGEN), 5 mg/ml insulin,.5 mg/ml hydrocortisone, 1 ng/ml cholera toxin, 3 U/ml collagenase and 1 U/ml hyaluronidase (all from Sigma, St Louis, MO, USA) at 37 C for 16h. The epithelialcell-rich pellet (95-99% purity) was collected by centrifuging the cell suspension at 8 g for 4 min followed by one wash with F12/DMEM. The supernatant from the first centrifugation contained the mammary stromal cells (fibroblasts and endothelial cells). Epithelial organoids were further digested for 5 min in.5% trypsin (Gibco)-.25% EDTA (Sigma) solution to generate a single-cell suspension. An equal volume of F12/DME/H supplemented with 5% FBS was added to stop the digestion. The cell suspension was filtered twice through a 4-mm nylon mesh (BioDesign Inc., New York, N.Y., USA). Following centrifugation at 8 g, the pellet was resuspended in F12/DMEM with a reduced calcium concentration (.6 mm, StemCell technologies) supplemented with 5 U/ml dispase (Collaborative Biomedical Products, Bedford, Md., USA). To remove red blood cells the pellets were treated with ammonium chloride solution. Flow cytometry analysis CD44/CD24/Lin staining was performed as previously described (Al-Hajj., 23). Briefly, cells were stained with primary antibodies anti-cd44 labeled APC (dilution 1:1, BD Biosciences), anti-cd24 labeled PE (dilution 1:1, BD Biosciences), and lineage markers anti-cd31, CD64, CD14b (BD Biosciences), CD2, CD3, CD1, CD16, CD18 (all labeled with PE-

17 Cy5, Jackson Labs). Fresh cells were stained with 1µg/ml PI (Sigma) for 5 min. for viability. Examples of flow charts and more details on gate setup are shown in Figures S5 and S6. Mammosphere culture Mammosphere culture was performed as previously described (Dontu et al., 23). Single cells were plated in ultra-low attachment plates (Corning, Acton, MA, USA) or plates coated with 1% agarose in PBS, at a density of 2, viable cells/ml in primary culture and 5 cells/ml in subsequent passages. For mammosphere culture, cells were grown in a serum-free mammary epithelial basal medium (MEBM) (Cambrex Bio Science Walkersville, Inc, Walkerville, MD, USA) supplemented with B27 (INVITROGEN, Carlsbad, CA, USA), 2 ng/ml EGF (BD Biosciences, San Jose, CA, USA), antibiotic-antimycotic (1 unit/ml penicillin G sodium, 1 ug/ml streptomycin sulfate and.25 µg/ml amphotericin B), 2 ug/ml Gentamycin, 1 ng/ml Hydrocortisone, 5 µg/ml Insulin and 1 µm beta-mercaptoethanol (GIBCO TM INVITROGEN) in a humidified incubator (1% CO 2 : 95% air, 37 C for 7-1 days, as previously described (Dontu et al., 23).

3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2

3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2 3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2 1 Cardiff School of Biosciences, European Cancer Stem Cell Research Institute, Cardiff University, Cardiff, UK; 2 Department of

More information

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful

More information

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1. LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Supplemental Information. Materials and methods.

Supplemental Information. Materials and methods. Supplemental Information Materials and methods. Cell culture. hmscs were isolated from bone marrow of 3 male donors, undergoing orthopedic surgery (mean age 69.7). Cells were cultured in high glucose DMEM

More information

All quality control test results are reported on a lot specific Certificate of Analysis which is available at or upon request.

All quality control test results are reported on a lot specific Certificate of Analysis which is available at   or upon request. PRIME-XV Neural Basal Medium PRIME-XV Neural Basal Medium is a chemically-defined basal medium optimized for the culture and maintenance of neuronal cells when supplemented with PRIME-XV IS21 Supplement

More information

Application Protocol: CD45 CK Immunostaining for patient blood

Application Protocol: CD45 CK Immunostaining for patient blood REPRODUCTION AND USE This document is protected by copyright and it cannot be used or shared without permission from Vortex Biosciences, Inc. Such permission is given on condition that Vortex Biosciences

More information

Engraftment of human induced pluripotent stem cell-derived hepatocytes in. immunocompetent mice via 3D co-aggregation and encapsulation

Engraftment of human induced pluripotent stem cell-derived hepatocytes in. immunocompetent mice via 3D co-aggregation and encapsulation Engraftment of human induced pluripotent stem cell-derived hepatocytes in immunocompetent mice via 3D co-aggregation and encapsulation Wei Song 1, Yen-Chun Lu 1, Angela S. Frankel 2, Duo An 1, Robert E.

More information

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,

More information

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW

More information

Table of Contents. 2.1 NeuroCult NCFC Assay Kit (Rat) Components Additional Required Reagents Required Equipment...

Table of Contents. 2.1 NeuroCult NCFC Assay Kit (Rat) Components Additional Required Reagents Required Equipment... i Table of Contents 1.0 Overview of the NeuroCult NCFC Assay 2.0 Materials 2.1 NeuroCult NCFC Assay Kit (Rat) Components... 4 2.2 Additional Required Reagents... 4 2.3 Required Equipment... 4 3.0 Preparation

More information

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture Catalog Number 354671 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 Supporting Information Cell culture. C2C12 cells (ATCC CRL 1772) were cultured in 75 cm 2

More information

Preparation of Mouse Bone Marrow Stromal Cells

Preparation of Mouse Bone Marrow Stromal Cells Preparation of Mouse Bone Marrow Stromal Cells A single-step stem cell purification method using adhesion to cell culture plastic was employed as described in the Reference. Briefly, neonatal and adult

More information

Supplementary Figure 1 A green: cytokeratin 8

Supplementary Figure 1 A green: cytokeratin 8 Supplementary Figure 1 A green: cytokeratin 8 green: α-sma red: α-sma blue: DAPI blue: DAPI Panc-1 Panc-1 Panc-1+hPSC Panc-1+hPSC monoculture coculture B Suppl. Figure 1: A, Immunofluorescence staining

More information

BD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information

BD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information Technical Data Sheet Streptavidin Particles Plus - DM Product Information Material Number: Size: Storage Buffer: 557812 5 ml Aqueous buffered solution containing BSA and 0.09% sodium azide. Description

More information

Large-Scale Analysis of Breast Cancer-Related. Conformational Changes in Proteins using SILAC-SPROX. *Corresponding author

Large-Scale Analysis of Breast Cancer-Related. Conformational Changes in Proteins using SILAC-SPROX. *Corresponding author SUPPORTING INFORMATION for: Large-Scale Analysis of Breast Cancer-Related Conformational Changes in Proteins using SILAC-SPROX Fang Liu, 1 He Meng, 1 and Michael C. Fitzgerald 1, * 1 Department of Chemistry,

More information

Mice genotyping for FAK flox, deletion (Δ), and KD alleles as well as GFP, Cre and

Mice genotyping for FAK flox, deletion (Δ), and KD alleles as well as GFP, Cre and Supplementary Methods Mice genotyping Mice genotyping for FAK flox, deletion (Δ), and KD alleles as well as GFP, Cre and PyMT alleles were performed using the following primers: FAK Flox/WT: 5 - GCTGATGTCCCAAGCTATTCC

More information

Identification of Single Chain Antibodies to Breast Cancer Stem Cells Using Phage Display

Identification of Single Chain Antibodies to Breast Cancer Stem Cells Using Phage Display Identification of Single Chain Antibodies to Breast Cancer Stem Cells Using Phage Display Deniz Gur Dept. of Surgery, Vermont Comprehensive Cancer Center, University of Vermont, College of Medicine, Burlington,

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Quick-Spin the tetramer tubes before opening, due to the change in altitude and the low volume.

Quick-Spin the tetramer tubes before opening, due to the change in altitude and the low volume. Quick-Spin the tetramer tubes before opening, due to the change in altitude and the low volume. Staining ex vivo samples with IA g7 Ins10-23 RE#3 Tetramers, from Kappler/Marrack Laboratory Howard Hughes

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Isolation and 3-dimensional Culture of Primary Murine Intestinal Epithelial Cells Agnieszka Pastuła * and Michael Quante

Isolation and 3-dimensional Culture of Primary Murine Intestinal Epithelial Cells Agnieszka Pastuła * and Michael Quante Isolation and 3-dimensional Culture of Primary Murine Intestinal Epithelial Cells Agnieszka Pastuła * and Michael Quante II. Medizinische Klinik, Klinikum rechts der Isar, Technische Universität München,

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents Supplementary Material (ESI) for Lab on a Chip RPMI medium, FBS, HEPES buffer solution, sodium pyruvate, penicillin, and streptomycin were obtained from Biological

More information

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000 1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection

More information

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Mammosphere formation assay. Mammosphere culture was performed as previously described (13, Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts

More information

HUMAN IPSC CULTURE PROTOCOLS

HUMAN IPSC CULTURE PROTOCOLS HUMAN IPSC CULTURE PROTOCOLS FOR TRAINING COURSE IXCELLS BIOTECHNOLOGIES USA, LLC 10340 CAMINO SANTA FE, SUITE C, SAN DIEGO, CA 92121 TABLE OF CONTENTS CHAPTER 1 BEFORE STARTING 2-7 SECTION 1.1 COATING

More information

All quality control test results are reported on a lot specific Certificate of Analysis which is available at or upon request.

All quality control test results are reported on a lot specific Certificate of Analysis which is available at   or upon request. PRIME-XV NPC Expansion XSFM PRIME-XV NPC Expansion XSFM is a xeno-and serum-free medium optimized for the cultivation and expansion of neural progenitor cells (NPC) that are able to maintain their ability

More information

Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar *

Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar * Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar * Department of Comparative Medicine, University of Washington, Seattle, USA *For correspondence: csyam@u.washington.edu; hajjar@uw.edu

More information

Regulatory B Cell Isolation Kit mouse

Regulatory B Cell Isolation Kit mouse For further information refer to our website www.miltenyibiotec.com For technical questions, please contact your local subsidiary or distributor. Technical Support Team, Germany: E-mail: macstec@miltenyibiotec.de

More information

Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads

Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads S S Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads (Miltenyi Biotech) and T cells were positively selected by magnetically activated cell sorting (MACS). 50x10 6 or greater

More information

Chemical mixtures isolated from house dust disrupt thyroid receptor β (TRβ) signaling

Chemical mixtures isolated from house dust disrupt thyroid receptor β (TRβ) signaling SUPPORTING INFORMATION Chemical mixtures isolated from house dust disrupt thyroid receptor β (TRβ) signaling Erin M. Kollitz, Christopher D. Kassotis, Kate Hoffman, P. Lee Ferguson, Julie Ann Sosa, Heather

More information

InVERT moulding for scalable control of tissue microarchitecture

InVERT moulding for scalable control of tissue microarchitecture InVERT moulding for scalable control of tissue microarchitecture Stevens KR, Ungrin MD, Schwartz RE, Ng SY, Carvalho B, Christine KS, Chaturvedi R, Li CY, Zandstra PW, Chen CS, Bhatia SN Supplementary

More information

T ECHNICAL MANUAL. Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium

T ECHNICAL MANUAL. Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium T ECHNICAL MANUAL Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium i Table of Contents 1.0 Materials... 1 1.1 MesenCult -XF Medium and Required Products... 1 1.2 Additional Required

More information

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes

More information

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic

More information

Welcome to the CORES Flow Cytometry Sorter Facility

Welcome to the CORES Flow Cytometry Sorter Facility Welcome to the CORES Flow Cytometry Sorter Facility The FACSAria I and FACSARIA III are twin laser high speed sorters capable of analyzing cells based on 7-8 distinct fluorescent properties (besides FSC

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis EasySep Mouse PE Kit II Catalog #17666 Catalog #17696 For processing 1 x 10^9 cells For processing 5 x 10^9 cells Description Isolate highly purified

More information

TECHNICAL REPORT. Experimental Campaign on the in-vitro platelet-endothelial cells interactions

TECHNICAL REPORT. Experimental Campaign on the in-vitro platelet-endothelial cells interactions TECHNICAL REPORT Experimental Campaign on the in-vitro platelet-endothelial cells interactions Marco Malvestiti, Paolo Gresele Department of Internal Medicine, University of Perugia, Perugia, Italy marco.malvestiti@gmail.com,

More information

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort

More information

Modeling Cardiomyocyte Differentiation:

Modeling Cardiomyocyte Differentiation: icell Cardiac Progenitor Cells Prototype Application Protocol Wnt- and Activin/TGFβ-inhibitor Induction with Flow Cytometry Analysis Introduction The ability of cardiac progenitor cells to proliferate

More information

PCCS Growth Media, Cell Tagging, Cell Separation Final Assignment. Igneris Rosado-Erazo. Panama College of Cell Science

PCCS Growth Media, Cell Tagging, Cell Separation Final Assignment. Igneris Rosado-Erazo. Panama College of Cell Science Running Head: Growth Media, Cell Tagging, Cell Separation PCCS Growth Media, Cell Tagging, Cell Separation Final Assignment Igneris Rosado-Erazo Panama College of Cell Science In partial fulfillment of

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Background Human CD137 (4-1BB; TNFRS9) is an inducible co-stimulatory molecule that activates T cells. CD137:CD137L-mediated

More information

STEMdiff Mesenchymal Progenitor Kit

STEMdiff Mesenchymal Progenitor Kit Defined culture kit for derivation and expansion of mesenchymal progenitor cells Catalog #05240 1 Kit Product Description STEMdiff Mesenchymal Progenitor Kit is a defined culture kit consisting of animal

More information

Antibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing

Antibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),

More information

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure Title Subtitle NANoREG Work package/task: Owner and co-owner(s) HTS Comet Assay with and without FPG - 20 wells Comet assay with and without FPG using Trevigen 20-well slides

More information

Flow Cytometry Immune Activation SOP

Flow Cytometry Immune Activation SOP Flow Cytometry Immune Activation SOP Purpose This SOP standardizes the procedure for measuring immune activation of T cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow

More information

Data Sheet ICOS/NFAT Reporter-Jurkat Recombinant Cell Line Catalog #: 79668

Data Sheet ICOS/NFAT Reporter-Jurkat Recombinant Cell Line Catalog #: 79668 Data Sheet ICOS/NFAT Reporter-Jurkat Recombinant Cell Line Catalog #: 79668 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements

More information

Metzger Lab Protocol Book EF May 2003

Metzger Lab Protocol Book EF May 2003 I. Preparation for cell isolation: A. Make sure the following items are autoclaved: 1. Glassware* (1) 100 ml beaker (3) wide mouthed 1 liter bottles (1) 100 mm glass petri dish (1) 60 mm sigma coated petri

More information

PRACTICAL CELL SORTING. The following is a discussion of best practices for investigators planning experiments that involved flow sorting of cells:

PRACTICAL CELL SORTING. The following is a discussion of best practices for investigators planning experiments that involved flow sorting of cells: PRACTICAL CELL SORTING The following is a discussion of best practices for investigators planning experiments that involved flow sorting of cells: 1. Cell preparation 2. Pre-sort cell viability 3. Post-sort

More information

Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014

Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014 Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014 Cell Line Information The JM8.N4 subline is derived from the JM8 parental line and are considered to be feeder independent. These cells are

More information

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency

More information

RPCI 001 v.003 In vitro Intracellular Cytokine Staining With and Without Stimulation

RPCI 001 v.003 In vitro Intracellular Cytokine Staining With and Without Stimulation Immune Tolerance Network RPCI 001 v.003 Author: Paul Wallace and Earl Timm, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry 1.0 Title

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

Flow Cytometry SOP: Monocytes from Frozen Cells

Flow Cytometry SOP: Monocytes from Frozen Cells Flow Cytometry SOP: Monocytes from Frozen Cells Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow tubes

More information

Life Sciences Reporting Summary

Life Sciences Reporting Summary Life Sciences Reporting Summary Corresponding Author: Johanna A. Joyce Date: Jun 13, 2017 Nature Research wishes to improve the reproducibility of the work we publish. This form is published with all life

More information

International Journal of Pharma and Bio Sciences

International Journal of Pharma and Bio Sciences Research Article Cell Biology International Journal of Pharma and Bio Sciences ISSN 0975-6299 EFFECT OF ANTIBIOTICS ON MESENCHYMAL STROMAL CELLS UNDER XENO-FREE CULTURE CONDITIONS FOR CLINICAL USE JAIANAND

More information

Nature Medicine: doi: /nm.2084

Nature Medicine: doi: /nm.2084 Supplementary Table 1. Description of tumor lesions by number, location, and type. Tumor # AAH (%) Adenoma (%) ADCA (%) Alveolar (%) Bronchiolar (%) 8 Wks K-ras/NE +/+ 1.47 +/- 0.38 67.7 +/- 5.1 32.3 +/-

More information

Submitting Cells for Cell Sorting University of Colorado Cancer Center Flow Cytometry Shared Resource (FCSR)

Submitting Cells for Cell Sorting University of Colorado Cancer Center Flow Cytometry Shared Resource (FCSR) Submitting Cells for Cell Sorting University of Colorado Cancer Center Flow Cytometry Shared Resource (FCSR) cc.flowcyto@ucdenver.edu 303.724.3145 Scheduling: For appointments see online calendar @ www.ucccflow.calendarhost.com

More information

Isolation of ILC2 from Mouse Liver Tamar Mchedlidze and Stefan Wirtz *

Isolation of ILC2 from Mouse Liver Tamar Mchedlidze and Stefan Wirtz * Isolation of ILC2 from Mouse Liver Tamar Mchedlidze and Stefan Wirtz * Medical Department 1, FAU Erlangen-Nuremberg, Erlangen, Germany *For correspondence: stefan.wirtz@uk-erlangen.de [Abstract] Group

More information

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements

More information

Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546

Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546 Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546 Description This cell line expresses a surface human GITR (glucocorticoid-induced TNFR family related gene; TNFRSF18;

More information

Mice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2

Mice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2 Antibodies Chicken IgY polyclonal α-gfp antibodies were purchased from Abcam (Cambridge, MA) and were detected using α-chicken IgY-FITC or α-chicken-hrp (also purchased from Abcam). The CD31-PE, CD11b-PE,

More information

Materials and Reagents

Materials and Reagents Isolation of CD34 + Cells from Human Fetal Liver and Cord Blood Institute of Molecular and Cell Biology, 138673, Singapore Qingfeng Chen 1* and Jianzhu Chen 2* 1 Humanized Mouse Unit, Institute of Molecular

More information

Supplementary Table I: List of primers used for qpcr

Supplementary Table I: List of primers used for qpcr Supplementary Table I: List of primers used for qpcr Primer ABCG2 F ABCG2 R β Actin F β Actin R ALDH1A1 F ALDH1A1 R ALDH1A1 promoter F ALDH1A1 promoter R CD24 F CD24 R CD44 F CD44 R CXCR1 F CXCR1 R CXCR4

More information

PROTOCOL. Generating Cardiomyocytes from Human Pluripotent Stem Cells using Stemgent MesoFate Differentiation Medium. Overview. Required Materials

PROTOCOL. Generating Cardiomyocytes from Human Pluripotent Stem Cells using Stemgent MesoFate Differentiation Medium. Overview. Required Materials Page 1 Overview Analysis of mouse and human embryonic stem cell differentiation cultures indicate the existence of a cardiovascular progenitor representing one of the earliest stages in mesoderm specification

More information

Fitness Measurements of Evolved Escherichia coli Migla Miskinyte and Isabel Gordo *

Fitness Measurements of Evolved Escherichia coli Migla Miskinyte and Isabel Gordo * Fitness Measurements of Evolved Escherichia coli Migla Miskinyte and Isabel Gordo * Evolutionary Biology Group, Instituto Gulbenkian de Ciência, Oeiras, Portugal *For correspondence: igordo@igc.gulbenkian.pt

More information

Transfection of Human Naive CD4 + T Cells with PHA Activation and Neon Electroporation Amy Palin 1* and David B. Lewis 2*

Transfection of Human Naive CD4 + T Cells with PHA Activation and Neon Electroporation Amy Palin 1* and David B. Lewis 2* Transfection of Human Naive CD4 + T Cells with PHA Activation and Neon Electroporation Amy Palin 1* and David B. Lewis 2* 1 Department of Pediatrics and Program in Immunology, Stanford University Medical

More information

Phagocytosis Assay Kit (IgG PE)

Phagocytosis Assay Kit (IgG PE) Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Supporting Information

Supporting Information Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu

More information

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

More information

Human Skeletal Muscle Myoblast Care Manual: Maintenance and Differentiation from Myoblasts to Myocytes

Human Skeletal Muscle Myoblast Care Manual: Maintenance and Differentiation from Myoblasts to Myocytes Human Skeletal Muscle Myoblast Care Manual: Maintenance and Differentiation from Myoblasts to Myocytes STORAGE CONDITIONS Media: Short Term 4 C 6 months -20 C F or research use only. Not approved for human

More information

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies

More information

MagniSort Mouse B cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse B cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse B cell Enrichment Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse B cell Enrichment

More information

Supplementary File 3: DNA and RNA isolation

Supplementary File 3: DNA and RNA isolation Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G

More information

Human Adult Mammary Fibroblast Care Manual

Human Adult Mammary Fibroblast Care Manual Human Adult Mammary Fibroblast Care Manual INSTRUCTIONAL MANUAL ZBM0062.05 SHIPPING CONDITIONS Human Adult Mammary Fibroblast Cells Orders are delivered via Federal Express courier. All US and Canada orders

More information

Protocols for Hematopoietic Differentiation of Murine ES Cells (in 6 or 24 well plates) Media Preparation

Protocols for Hematopoietic Differentiation of Murine ES Cells (in 6 or 24 well plates) Media Preparation Protocols for Hematopoietic Differentiation of Murine ES Cells (in 6 or 24 well plates) Media Preparation A) Embryonic Stem Cell Medium (ES) Dulbecco s modified Eagle s Medium (DMEM) with high glucose

More information

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5 Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent

More information

Protocol to detect N-Glycolylneuraminic acid (Neu5Gc) using Flow Cytometry Analysis.

Protocol to detect N-Glycolylneuraminic acid (Neu5Gc) using Flow Cytometry Analysis. Page 1 of 5 Protocol to detect N-Glycolylneuraminic acid (Neu5Gc) using Flow Cytometry Analysis. The Gc-Free Basic Pack may be used for immuno-staining cells prior to analysis by Flow Cytometry. This Basic

More information

STEMdiff Hematopoietic Kit

STEMdiff Hematopoietic Kit For differentiation of human ES or ips cells into hematopoietic progenitor cells Catalog #05310 1 Kit Product Description Kit includes a defined, serum-free basal medium and supplements for the feeder-free

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis EasySep Mouse CD90. Kit II Catalog #89 For processing x 0^9 cells Description Isolate highly purified CD90.+ (Thy.+) cells from mouse splenocytes or other

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. (A) Reference guide for the phospho-protein array. (B) Representative fluorescent arrays for whole cell lysates from MDA-MB-231 cells cultured at ph 7.4

More information

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

Immunofluorescence of organoids embedded in Basement Membrane Matrix

Immunofluorescence of organoids embedded in Basement Membrane Matrix Immunofluorescence of organoids embedded in Basement Membrane Matrix Sol Degese 1, Gabe Benton 1 1 Organoid Resource Lab (ORL), Trevigen, Inc., 8405 Helgerman Court, Gaithersburg, MD 20877 Introduction

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

Epithelial Cells cells lining the trachea Epithelium layer of epithelial cells in the tissue Many epithelial cell types exist on apical surface

Epithelial Cells cells lining the trachea Epithelium layer of epithelial cells in the tissue Many epithelial cell types exist on apical surface Matthew Pilewski Epithelial Cells cells lining the trachea Epithelium layer of epithelial cells in the tissue Many epithelial cell types exist on apical surface Epithelium form tight junctions that keep

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

VDL602.2 RAPID ASSAY FOR DETERMINING ADENOVIRAL VECTOR TITER

VDL602.2 RAPID ASSAY FOR DETERMINING ADENOVIRAL VECTOR TITER 1. Purpose 1.1. The purpose of this protocol is to determine the number of infectious adenoviral particles. 1.2. The starting material is purified adenoviral vectors. 1.3. This protocol is based upon the

More information

ETS-Embryo Medium. In Vitro Culture Media. Version 1.0

ETS-Embryo Medium. In Vitro Culture Media. Version 1.0 ETS-Embryo Medium In Vitro Culture Media Version 1.0 3D Culture Media Product Catalogue No Storage ETS-Embryo Medium, 25 ml (5 x 5 ml) M13-25 -20 C ETS-Embryo Medium, 100 ml M13-100 -20 C Additional Reagents

More information

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure Title Standard Operation Procedure (SOP) and background documentation for real-time label-free impedance-based nanotoxicity assessment Subtitle NANoREG Work package/task: Owner

More information

Terrific Validation, Tech Support and Prompt Delivery. User Guide for Selleck Human ipsc Enhancer Kit Cat. No. K2010. Guidelines for Use

Terrific Validation, Tech Support and Prompt Delivery. User Guide for Selleck Human ipsc Enhancer Kit Cat. No. K2010. Guidelines for Use Terrific Validation, Tech Support and Prompt Delivery User Guide for Selleck Human ipsc Enhancer Kit Cat. No. K2010 Guidelines for Use For Research Use Only. Not for use in diagnostic or therapeutic procedures.

More information

Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry

Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Kristie M. Grebe and Terry A. Potter* (Published 10 September

More information

Centre for Innovative Cancer Research, Ottawa Hospital Research Institute, Ottawa, Canada;

Centre for Innovative Cancer Research, Ottawa Hospital Research Institute, Ottawa, Canada; Ex vivo Natural Killer Cell Cytotoxicity Assay Lee-Hwa Tai 1, Christiano Tanese de Souza 1, Andrew P. Makrigiannis 2 and Rebecca Ann C. Auer 3* 1 Centre for Innovative Cancer Research, Ottawa Hospital

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

Sample Preparation Demonstrated Protocol

Sample Preparation Demonstrated Protocol 10x Genomics Sample Preparation Demonstrated Protocol Removal of Dead Cells from Single Cell Suspensions for Single Cell RNA Sequencing NOTICES Notices Manual Part Number CG000093 Legal Notices Rev B 2017

More information

Mouse/Rat Neural Stem Cell Functional Identification Kit

Mouse/Rat Neural Stem Cell Functional Identification Kit Mouse/Rat Neural Stem Cell Functional Identification Kit Catalog Number SC013 Reagents for the identification of mouse/rat Neural Stem Cells (NSCs) by in vitro functional differentiation. This package

More information

Human ipsc-derived Renal Proximal Tubular Cells. Protocol version 1.0

Human ipsc-derived Renal Proximal Tubular Cells. Protocol version 1.0 Human ipsc-derived Renal Proximal Tubular Cells Protocol version 1.0 Protocol version 1.0 Table of Contents Product Information 2 Preparation of Reagents 3 Culture of Human ipsc-derived Renal Proximal

More information

Application Note. Introduction. Kerry Thompson, Jeff Partridge, Paula Flaherty, Susan Qian, and Deepa Saxena

Application Note. Introduction. Kerry Thompson, Jeff Partridge, Paula Flaherty, Susan Qian, and Deepa Saxena Page 1 BD PureCoat ECM Mimetic Cultureware Fibronectin Peptide: Novel Synthetic, Animalfree Surface for Culture of Human Bone Marrow-derived Mesenchymal Stem Cells Kerry Thompson, Jeff Partridge, Paula

More information