Pooled Genome-Scale CRISPR-Cas9 Knock-out Screens in Human Cells

Size: px
Start display at page:

Download "Pooled Genome-Scale CRISPR-Cas9 Knock-out Screens in Human Cells"

Transcription

1 Pooled Genome-Scale CRISPR-Cas9 Knock-out Screens in Human Cells This is a research protocol that describes a protocol to perform pooled genome scale grna depletion screens in human cells using CRISPR libraries 1. Introduction 2. Biosafety Practices 3. Procedures 4. References 1 Introduction: CRISPR-Cas9 technology has provided an efficient approach for gene inactivation. Through a synthetic single grna (sgrna), Cas9 nuclease can be programmed to induce loss of function mutations at the target site. We have developed a unique all-in-one CRISPR-Cas9 grna lentiviral library (TKOv3) that covers all ~18,000 human genes to enable genome-scale loss of function screens in mammalian cells. Cas9 and sgrna are simultaneously delivered on a single vector allowing application to any cell type. Library description: The CRISPR TKO v3 pooled library consists of specific sgrna for gene knock out in the human genome. The library targets 18,049 protein coding genes with 71,090 grna sequences (4 targeting grna sequences per gene). 2 Biosafety practices: The entire assay procedure will be performed in a Class IIa biosafety cabinet and 37 C, 5% CO 2 incubator. Aseptic techniques must be practiced to ensure sterility. Before the start of experiments all working surfaces will be wiped with 70% ethanol. Hood sash must be at proper position to maintain laminar air flow, avoid clutter and do not block air vents with bulky items. Laboratory staff must wear protective clothing at all times, including lab coat, gloves and closed-toed shoes. Liquid waste will be collected in a separate container and neutralization with 20% bleach for a minimum of 30 minutes. After decontamination is complete, the liquid will be poured into the sink in the tissue culture room. Any liquid spills will be absorbed with paper towels and the area decontaminated with a 10% bleach solution. Following the completion of the experiment, all working surfaces will be wiped with 70% ethanol. 1

2 Lentiviral precautions: When working with active lentiviral (production, MOI determination and primary infection steps), double gloves must be worn and no waste can exit the hood until treated with bleach. No vacuum pumps can be used, liquid waste must be manually removed and bleached for 30 minutes before discarding. 3 Procedures: 3.1 Toronto KnockOut version (TKO v3) CRISPR Library Amplification 1. Dilute the TKO library to 50 ng/µl in TE. 2. Electroporate the library a. Set up 4 electroporations as follow: b. Add 2 µl of 50 ng/µl TKO library to 25 µl of Lucigen Endura electrocopetent cells (cat no ); c. Electroporate according to the manufacturer s suggested conditions and protocol; d. Add 975 µl of Recovery Medium (or SOC medium); e. Transfer cells to a culture tube with an additional 1 ml of Recovery Medium; f. Place tubes in a shaking incubator at 250 rpm for 1 hour at 37 C. 3. Titer the library The dilution plate is used to estimate transformation efficiency to ensure that full library representation is preserved. a. Pool all 8 ml of recovered cells. Mix well. b. Transfer 10 µl of cells to 990 µl of Recovery Medium, mix well, and plate 20 µl onto a pre-warmed 10-cm LB + carbenicillin agar plate (this is a 40,000-fold dilution of the full transformation) 4. Plate the library a. Spread recovered cells on a total of cm LB + carbenicillin agar plates. b. Spread 400 µl of recovered cells on each of the pre-warmed plate. 5. Incubate the plates for hours at 30 C. 6. Calculate transformation efficiency a. Count the number of colonies on the dilution plate. b. Multiply this number of colonies by 40,000 for the total number of colonies plated. c. Proceed if the total number of colonies is at least 1.4 x This efficiency is equivalent to 200X colonies per guide-rna construct in the TKO v3 library. 7. Harvest colonies a. Transfer 7 ml of LB + carbenicillin medium on one 15-cm plate. b. Scrape the colonies off with a cell spreader. 2

3 c. Transfer the scraped cells into a sterile bottle using a 10-mL pipet. d. Rinse the scraped plate with an additional 5 ml of LB + carbenicillin medium and transfer to the bottle. e. Pool all scraped cells from 20 plates to the bottle. f. Transfer cells to pre-weighed centrifuge bottles. g. Centrifuge and discard media. h. Weigh the wet cell pellet. 8. Purify the library plasmid pool a. Purify plasmid DNA using a maxi- or mega-scale plasmid purification kit. b. Perform multiple maxi or mega preps according to column capacity. Typically, a maxi column can process 1 g of wet cell pellet, and a mega column can process 2.5 g of wet cell pellet. 3.2 Large scale lentivirus production of TKOv3 in 15-cm TC plates *Biosafety precautions: Double gloves should be worn and all virus waste requires incubation in 20% bleach for 30 minutes before disposal Materials needed: 293T packaging cells (recommended: passage number < 15) Transfection quality plasmids: CRISPR library, pspax2 (packaging plasmid), pmd2.g (envelope plasmid) X-tremeGENE 9 DNA Transfection reagent (Roche, ) OPTI-MEM serum-free media (Invitrogen, # ) Cell seeding media - Low-antibiotic growth media (DMEM + 10% FBS + 0.1x Pen/Strep): o 500 ml DMEM (Dulbecco's Modification of Eagle's Medium) o 50 ml ifbs (heat-inactivated Fetal Bovine Serum; e.g. HyClone #SH ) o 0.5 ml 100x Pen/Strep Viral harvest media- Serum-Free, High-BSA 293T growth media (DMEM + 1.1g/100mL BSA + 1x Pen/Strep) o 500 ml DMEM (Dulbecco's Modification of Eagle's Medium) o 32 ml 20g/100mL BSA stock o 5 ml 100x Pen/Strep Instructions: 1. Seed 293T packaging cells in low-antibiotic growth media. 8E6 9E6 cells/15 cm plate in 20 ml media. For 1L virus production prepare ~60 plates 2. Incubate cells for 24 hours (37 C, 5% CO2), or until the following afternoon. The cells 3

4 should be 70% -80% confluent at moment of transfection. 3. Transfect packaging cells: a. Prepare a mixture of the 3 transfection plasmids (~ 1:1:1 Molar Ratio) in optimem. Amount needed per 15cm plate: 4.8 μg pspax2 3.2 μg pmd2.g 8 μg TKOv3 library b. Prepare 1x OptiMem and X-tremeGENE dilutions for each plate (i.e for 60 plates, you will need 60 tubes with 1x X-tremeGENE dilutions). Add X-tremeGENE directly into Optimem and gently flick the tube (do not mix by pipetting or vortexing). Incubate maximum 5 minutes at room temperature. Amount X-tremeGENE needed per 15-cm plate: 48 µl X-tremeGENE diluted in 800µL OptiMEM c. Following 5 minutes incubation, add appropriate amount of plasmid for a 3:1 ratio of Transfection Reagent:DNA Complex. Drop DNA to X-tremeGENE mixture and mix by gently flicking the tube. d. Incubate the transfection mix for 30 minutes. e. Carefully transfer the transfection mix to the packaging cells by adding drop-wise in circular, zigzag motion. 4. Incubate cells for 18 hours (37 C, 5% CO 2 ). 5. Change media to remove the transfection reagent and replace with high-bsa growth media for viral harvests (18-20mL/15cm plate). 6. Incubate cells for 24 hours (37 C, 5% CO 2 ). 7. Next day, harvest media containing lentivirus at ~40 hours post-transfection. Transfer media to a polypropylene storage tube. 8. Spin the media containing virus at 1000 rpm for 3 minutes to pellet any packaging cells that were collected during harvesting. Aliquot supernatant into sterile polypropylene storage tube. 9. Virus may be stored at 4 C for short periods (hours to days), but should be frozen at -80 C for long-term storage. To reduce the number of freeze/thaw cycles, aliquot largescale virus preps to smaller storage tubes prior to long-term storage. 4

5 3.3 Cell Line Characterization Select desired cell line. Ensure cell line is mycoplasma free before starting screen. Ensure that cells adhere reasonably well to tissue culture vessels. Ensure that all media requirements (+/- serum, growth factors, etc.) are met. Determine optimal cell plating density. Typically, the cell culture for pooled screens is done in 15cm plates. Measure and RECORD the approximate doubling time of your cells. Determine puromycin sensitivity of cell line by doing a kill curve. This can be done in 12 well plates, and can be measured either by cell counting or by trypan blue staining. Dilution range should span 0 μg/ml to 5 μg/ml in 0.5 μg/ml increments. Concentration of puromycin to be used in screen should be μg/ml higher than that required to kill 100% of uninfected cells in 48hrs. Check cells for sensitivity to either polybrene (up to 8 μg/ml) or protamine sulphate (up to 5μg/mL) by doing a dose response curve in the same method as used for measuring puromycin sensitivity. 3.4 Lentivirus MOI determination **The multiplicity of infection (MOI) must be determined under the same cell culture conditions used during the primary screen. This includes using the same tissue culture vessels, media constituents and volume, cell plating density, and pooled virus preps (without prior thaws) that will be used in the screen. Measurements made in different formats (e.g. 6-well plates) cannot be reliably scaled to the screening format. Day 1 Thaw a fresh aliquot of TKOv3 pooled lentivirus (keep on ice). Harvest cells for test infection, and measure number of cells/ml. (HAP1 requires 3E6-5E6 cells/plate). Design dilution series of virus for MOI determination between 0 to 2 ml. Prepare 15-cm plates using the same condition as would be used during the primary screen. To each 15-cm plate aliquot cells, media and polybrene (final conc. 8 ug/ml) and then add your designated volume of virus. Add the same volume of virus to two vessels for each dilution point. Mix plates thoroughly by tilting for 2 min. If your incubator is not level, you can let plates sit level in hood for up to 1 hr. Transfer plates to incubator. Ensure that they sit level. 5

6 Day 2 Day 4 24hrs after addition of virus, cells should be infected and tightly adhered to plate. Remove media using pipettes (dispose of media and pipettes in 20% bleach solution). Gently wash plate with warm PBS to remove any extraneous virus (dispose of PBS and pipettes in 20% bleach solution). Add fresh media (20 ml for 15-cm plate) containing puromycin at the required concentration (1 μg/ml for HAP1) to vessels of one virus dilution series and fresh media without puromycin to the other virus dilution series. Return plates to incubator. After 48 hrs, all uninfected cells should be dead. You must use a dose of puromycin that will kill all uninfected cells within 48hrs. Remove media. Gently wash plates with warm PBS to dislodge remaining dead cells. Trypsinize and collect cells from each plate into 15mL screw-cap tubes. Make sure that any clumps of cells were dispersed by repeated gentle pipetting. Count cells from all plates and graph results for the two series (+/- puromycin). Determine virus volume that gives 30-40% survival with puromycin selection vs. without puromycin. This is the volume of pooled virus that gives MOI of with the tissue culture conditions that you used. **All pipettes and media waste should be disposed in 20% bleach 3.5 Pooled grna depletion screens 1.1. Primary screen infection and cell passaging 1.2. Genomic DNA extraction Step CRISPR Library Barcode PCR 1.4. TKO Analysis Primary Screen Infection and Cell Passaging Expand cells to approximately 80-90E6 cells for Day 1. Day 1 (infection) The total number of cells plated for infection should be such that with infection at MOI 0.3, puromycin selection and the growth rate of the cells, you will be able to harvest ~ 120E6 cells on T0. 6

7 Infections are done in 15-cm TC plates. For 200-fold TKOv3 library coverage at an MOI 0.3 in HAP1 cells, 50E6 cells are required for infection at 3-5E6 HAP1 cells/ plate. Extra plates are prepared to accommodate MOI fluctuations and control plates are also required. The following plates are needed: o Screening plates: Virus + puromycin o Control 1- No virus + puromyocin (0% survival control) o Control 2- Virus + No puromycin (100% survival control) Harvest cells and pool into a sterile vessel. Seed required cell number to each plate. Add virus + polybrene 8 µg/ml to plates. Mix thoroughly by titling the plates for 2 minutes. Alternatively, batch infections can be done by adding virus and polybrene to cells in suspension, mixing well, then plating. Option: Leave plates in hood for 1h, ensure they are level. Place plates in the incubator, ensure they are level. Day 2 Puromycin Selection 24 hours after addition of virus, cells should be infected and tightly adhered to plate. Remove media using pipette (dispose of media and pipettes in 20% bleach solution). Gently wash plate with warm PBS to remove any extraneous virus (dispose of PBS and pipettes in 20% bleach solution). Add fresh media containing puromycin at the required concentration to the cells. Day 4 T0 48 hours after puromycin addition, all uninfected cells should be dead (control 1) Remove media, gently wash plate with warm PBS to dislodge remaining dead cells. It is important to remove all dead cells since their genomic DNA can contaminate the T0 prep. Wash twice with PBS if necessary. Trypsinize and collect cells from all plates into one sterile container. Make sure that all cell clumps are dispersed by gentle repeated pipetting when harvesting cells from plates/flasks. Count cells and calculate number of cells/ml. Collect 3 replicates of 20E6 cells by centrifugation: Spin at 1200 rpm for 5 minutes. Wash with PBS. Label tubes and freeze the cell pellets dry at -80 C. These are your time zero (T0) samples. 7

8 From the pool, plate cells into three replicate groups. Do NOT use puromycin in this or in subsequent plating steps. Each replicate should contain in total 15E6 cells across the required number of vessels (use exactly same number of cells for each replicate plate, and exactly same number of total cells between each replicate- example Replicate A seed 3 plates at 5E6/plate for total 15E6 cells, repeat for Replicate B and C). **15E6 cells gives ~200-fold representation for each grna in the 72k pool. If desired, you may use higher representation, 200-fold should be considered a minimum. Day 5 Onward (T1, T2, T18) Most adherent cell lines require splitting every 3-8 days. The pool-infected cells should be passaged at the same density that you normally would split when expanding them. You may notice a transient slowing of cell growth after the infection, with a return to normal growth speed 5-15 days after infection. The length and severity of this effect is cell-line dependent. Each instance that you passage the cells out to the end-point (~3 weeks), do the following things: o Trypsinize and collect cells. Pool cells from all the vessels in each separate replicate group with each other (ie. all the cells from replicate A are re-mixed together from separate plates, all the cells from replicate B are re-mixed together from separate plates, etc.). This serves to minimize stochastic growth effects in random sub-populations in individual vessels within a replicate group. o Re-plate 15E6 cells for each replicate group exactly as done at T0. o Freeze down 20E6 cells per pellet for each replicate group. Each pellet gets a time (T) number and a replicate designation. This number corresponds to the number of days post T0 that it was collected (eg. T3_A, T6_B, T_C, etc). If you chose to pellet more cells, make sure that ALL pellets collected in the screen have the same number of cells. * note: pelleting more cells (ie. 20E6) than the 15E6 cells representation of 200-fold buffers for material loss during downstream genomic DNA processing procedures Genomic DNA (gdna) Extraction and DNA precipitation gdna extraction is performed using the QIAamp Blood Maxi kit (cat no ) and RNase A (cat no ) essentially as described in the kit manual. Follow the instructions below, using the indicated volumes and refer to the kit manual for extra details if required. 8

9 This protocol is optimized for cell pellets containing 20-50E6 cells (we generally use for 20E6 cells). ***It is very important to use a swinging-bucket rotor in a centrifuge that is capable of attaining the required g-force. Failure to do so will result in low yield and dirty genomic DNA*** Prepare 70 C water bath with rack for your tubes. Ensure that buffers are prepared and ready to use. Thaw cell pellets in 37 C water bath for 5-10 min. Label samples and pre-label tubes and columns to be used in extraction. Pre-warm buffer AE to 65 C. Use plugged pipette tips for all steps contamination of the gdna is to be avoided! 1. Prepare Qiagen protease solution in water as instructed on the bottle. 2. Add 4.5 ml of sterile PBS to each cell pellet. Resuspend cells with P1000 pipette. Seal tubes tightly and vortex thoroughly to disperse cells. Pipette to disrupt cell clumps if needed. 3. Add 105 µl of RNase A (100 mg/ml) to resuspended cells. 4. Mix briefly by swirling. Incubate at room temperature for 5 min. 5. Add 500 µl of Qiagen protease solution to each sample. Mix briefly by swirling. 6. Add 6 ml of Buffer AL. Mix by inversion for 2 min. 7. Incubate tube at 70 C for 15 min. 8. Cool tube at room temperature for 30 min. 9. Add 5 ml of 100% ethanol. Mix by inversion for 2 min. 10. Place the pre-labeled QIAamp maxi column in a 50 ml centrifuge tube. 11. Transfer lysate onto the column using a 10 ml pipet. 12. Centrifuge tube at 1,850 x g for 3 min at room temperature. 13. Transfer column into a new 50 ml centrifuge tube. 14. Transfer the flow-through onto the column for a second binding. 15. Centrifuge tube at 1,850 x g for 3 min at room temperature. 16. Transfer column into a new 50 ml centrifuge tube. 17. Add 5 ml of Buffer AW1 to the column. 18. Centrifuge tube at 4,500 x g for 2 min at room temperature. 19. Add 5 ml of Buffer AW2 to the column. 20. Centrifuge tube at 4,500 x g for 15 min at room temperature. 21. If any buffer remains on the inside edge of the column, or the filter appears to be wet, uncap the columns and dry in a warm incubator for ~15 minutes. 22. Place the QIAamp maxi column into a new 50 ml centrifuge tube. 23. Transfer 1,000 µl of Buffer AE (pre-warmed 65 C) directly onto the membrane and cap the tube. 9

10 24. Incubate the tube at room temperature for 10 min. 25. Centrifuge tube at 4,500 x g for 15 min. 26. Transfer an additional 1,000 µl of Buffer AE (pre-warmed to 65 C) directly onto the membrane and cap the tube. 27. Incubate the tube at room temperature for 10 min. 28. Centrifuge tube at 4,500 x g for 15 min. 29. Transfer the 450 µl eluted DNA into each of the four 1.5 ml microfuge tubes. 30. Proceed to genomic DNA precipitation or store at -20 C until needed. Genomic DNA Precipitation 1. Transfer 400 µl genomic DNA into each of the 1.5 ml microfuge tube (total of 5 tubes). 2. Add 18 µl of 5 M NaCl (final concentration of 0.2 M) and 900 µl of 100% ethanol. Do NOT use sodium acetate as residual acetate interferes with downstream PCR. 3. Invert tube 10 times or until thoroughly mixed. 4. Centrifuge at 13,000 rpm for 15 minutes at 4 C. 5. Aspirate supernatant, careful to avoid the DNA pellet. 6. Wash DNA pellet with 500 µl of 70% ethanol. 7. Invert tube gently 5 times. 8. Centrifuge at 13,000 rpm for 15 minutes at 4 C. 9. Aspirate supernatant, careful to avoid the DNA pellet. 10. Air dry DNA pellet for ~10 minutes 11. Add 75 µl of TE to each of the four tubes of DNA pellet (total of 300 µl). 12. Heat samples at 50 C for ~1 hour (or until completely dissolved). Gently vortex at 20 minute intervals to fully solubilize the DNA. Make sure that DNA is fully solubilized with no lumps or clumps. 13. Transfer DNA into low-binding microfuge tubes for storage. Vortex to mix DNA thoroughly. 14. Quantitate and measure purity of genomic DNA on both NanoDrop and Qubit TKO v3 CRISPR Sequencing Library Preparation Perform 2 PCR to (1) enrich guide-rna regions in the genome and (2) amplify guide-rna with Illumina TruSeq adapters with i5 and i7 indices. Always perform one PCR without any genomic DNA template in order to ensure there is no contaminating template (for both PCR) The resulting libraries can be sequenced on Illumina HiSeq 2500 or NextSeq

11 - For HiSeq 2500, standard Single-Read (SR) 50-cycle chemistry with dual-index. - For NextSeq 500, standard Single-Read (SR) 75-cycle chemistry with dual-index. - Dark Cycle: 21; Read 1: 26; Index Read 1: 8; Index Read 2: 8 PCR 1 Assuming a diploid genome is ~6.5 µg and one guide-rna per genome, 50 µg of genomic DNA yields ~100-fold coverage of the TKO v3 library. Quantify genomic DNA concentration using Qubit dsdna BR Assay (cat no. Q32853). Add 2.5 µg of genomic DNA per 50 µl reaction. Set up identical 50 µl reactions to achieve the desired coverage. 1. Set up PCR 1 as follow 1x 2x NEBNext Ultra II Q5 Master Mix 25 µl 10 µm v2.1-f1 2.5 µl 10 µm v2.1-r1 2.5 µl Genomic DNA 2.5 µg Water up to 50 µl Total 50 µl 2. Amplify reactions in a thermocycler using the following program Step Temperature Time 1 98 C 30 sec 2 98 C 10 sec 3 66 C 30 sec 4 72 C 15 sec 5 72 C 2 min 6 10 C Hold 25 cycles (step 2 4) 3. Run 2 µl of PCR 1 product on a 1% agarose gel. Visualize the PCR product on a gel imager. PCR 1 yields a product of 600 bp. 4. Pool all individual 50 µl reactions for each genomic DNA sample, mix by vortex. PCR 2 11

12 Use unique i5 and i7 index primer combinations for each individual sample to allow pooling of sequencing libraries. Set up one 50 µl reaction for each sample. Use 5 µl of the pooled PCR 1 product as template. 5. Set up PCR 2 as follow 1x 2x NEBNext Ultra II Q5 Master Mix 25 µl 10 µm i5 primer 2.5 µl 10 µm i7 primer 2.5 µl PCR 1 product 5 µl Water 15 µl Total 50 µl 6. Amplify reaction in a thermocycler using the following program Step Temperature Time 1 98 C 30 sec 2 98 C 10 sec 3 55 C 30 sec 4 65 C 15 sec 5 65 C 5 min 6 10 C Hold 10 cycles (step 2 4) 7. Run 50 µl of PCR 2 product on a 2% agarose gel. PCR 2 yields a product of 200 bp. 8. Visualize the PCR product on a Dark Reader (blue light transilluminator). Excise the 200 bp band and purify DNA from agarose gel slice using a gel extraction kit. 9. Quantitate and measure purity of sequencing library on both NanoDrop and Qubit. 12

13 PCR Primers PCR 1 primers are regular desalted oligos. PCR 2 primers can be ordered from IDT as desalted Ultramer DNA oligos. PCR 1 Primer Sequences v2.1-f1 GAGGGCCTATTTCCCATGATTC v2.1-r1 GTTGCGAAAAAGAACGTTCACGG PCR 2 Primer Sequences i5 forward primers D501 -F AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTC CGATCTTTGTGGAAAGGACGAAACACCG D502-F AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTC CGATCTTTGTGGAAAGGACGAAACACCG D503-F AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTC CGATCTTTGTGGAAAGGACGAAACACCG D504-F AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTC CGATCTTTGTGGAAAGGACGAAACACCG D505-F AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGCTCTTC CGATCTTTGTGGAAAGGACGAAACACCG D506-F AATGATACGGCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTC CGATCTTTGTGGAAAGGACGAAACACCG PCR 2 Primer Sequences i7 reverse primers D701-R CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CTACTTGCTATTTCTAGCTCTAAAAC D702-R CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CTACTTGCTATTTCTAGCTCTAAAAC 13

14 D704-R CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CTACTTGCTATTTCTAGCTCTAAAAC D705-R CAAGCAGAAGACGGCATACGAGATTTCTGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CTACTTGCTATTTCTAGCTCTAAAAC D706-R CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CTACTTGCTATTTCTAGCTCTAAAAC D707-R CAAGCAGAAGACGGCATACGAGATAGCTTCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT CTACTTGCTATTTCTAGCTCTAAAAC Red sequence denotes i5 or i7 index Orange sequence denotes spacer Blue sequence denotes annealing sequence i7 Index i7 Index for i5 Index i5 Index for i7 Sequence i5 Sequence Name Sample Sheet Name Sample Sheet D701 CGAGTAAT ATTACTCG D501 TATAGCCT TATAGCCT D702 TCTCCGGA TCCGGAGA D502 ATAGAGGC ATAGAGGC D704 GGAATCTC GAGATTCC D503 CCTATCCT CCTATCCT D705 TTCTGAAT ATTCAGAA D504 GGCTCTGA GGCTCTGA D706 ACGAATTC GAATTCGT D505 AGGCGAAG AGGCGAAG D707 AGCTTCAG CTGAAGCT D506 TAATCTTA TAATCTTA 14

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: Lentivirus production of shrna, CRISPR, or ORF-pLX clones in 10 cm dishes or 6- well plates Current Revision Date: 6/3/2015 RNAi Platform,, trc_info@broadinstitute.org

More information

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: Lentivirus production of shrna or ORF-pLX clones Current Revision Date: 10/20/2012 RNAi Platform,, trc_info@broadinstitute.org Brief Description: This protocol

More information

Protocol: Isolation of genomic DNA with NucleoSpin Blood XL Maxi kit

Protocol: Isolation of genomic DNA with NucleoSpin Blood XL Maxi kit Last modified: November 2018; minor formatting Last reviewed: November 2018 Protocol: Isolation of genomic DNA with NucleoSpin Blood XL Maxi kit Purpose: this protocol is used to isolate gdna from frozen

More information

Cells and Tissue DNA Isolation Kit (Magnetic Bead System) 50 Preps Product # 59100

Cells and Tissue DNA Isolation Kit (Magnetic Bead System) 50 Preps Product # 59100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cells and Tissue DNA Isolation Kit (Magnetic Bead System) 50 Preps

More information

AAV Purification Maxi Slurry Kit Product # 63250

AAV Purification Maxi Slurry Kit Product # 63250 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com AAV Purification Maxi Slurry Kit Product # 63250 Product Insert

More information

Presto Mini Plasmid Kit

Presto Mini Plasmid Kit Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured

More information

Cells and Tissue DNA Isolation 96-Well Kit (Magnetic Bead System) Product # 62500

Cells and Tissue DNA Isolation 96-Well Kit (Magnetic Bead System) Product # 62500 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cells and Tissue DNA Isolation 96-Well Kit (Magnetic Bead System)

More information

Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free)

Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) PM002, PME02 (2 Preparation Sample Kit) PM010, PME10 (10 Preparation Kit) PM025, PME25 (25 Preparation Kit) Instruction Manual Ver.

More information

Complete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time

Complete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time Molecular Cloning Laboratories Manual Version 1.2 Product name: MCNext UT DNA Sample Prep Kit Cat #: MCUDS-4, MCUDS-24, MCUDS-96 Description: This protocol explains how to prepare up to 96 pooled indexed

More information

I-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only.

I-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only. Instruction Manual Ver. 05.11.17 For Research Use Only I-Blue Midi Plasmid Kit & I-Blue Midi Plasmid Kit (Endotoxin Free) IB47180, IB47190 (2 Preparation Sample Kit) IB47181, IB47191 (25 Preparation Kit)

More information

FavorPrep Blood / Cultured Cell Genomic DNA Extraction Maxi Kit. User Manual

FavorPrep Blood / Cultured Cell Genomic DNA Extraction Maxi Kit. User Manual TM FavorPrep Blood / Cultured Cell Genomic DNA Extraction Maxi Kit User Manual Cat. No.: FABGK 003 (10 Preps) FABGK 003-1 (24 Preps) For Research Use Only v.1005 Introduction TM FavorPrep Genomic DNA Extraction

More information

Kit Components Product # (50 samples) Wash Solution A Elution Buffer B

Kit Components Product # (50 samples) Wash Solution A Elution Buffer B 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cells and Tissue DNA Isolation Kit Product # 53100 Product Insert

More information

For simultaneous purification of genomic DNA and total RNA from the same animal cells or tissues

For simultaneous purification of genomic DNA and total RNA from the same animal cells or tissues 1. TIANamp DNA/RNA Isolation Kit For simultaneous purification of genomic DNA and total RNA from the same animal cells or tissues www.tiangen.com/en RP090603 TIANamp DNA/RNA Isolation Kit Kit Contents

More information

Application Protocol: Isolation of Genomic DNA from fresh and fixed rare cells

Application Protocol: Isolation of Genomic DNA from fresh and fixed rare cells REPRODUCTION AND USE This document is protected by copyright and it cannot be used or shared without permission from Vortex Biosciences, Inc. Such permission is given on condition that Vortex Biosciences

More information

Presto 96 Well gdna Bacteria Kit

Presto 96 Well gdna Bacteria Kit Presto 96 Well gdna Bacteria Kit 96GBB02 (2 x 96 well plates/kit) 96GBB04 (4 x 96 well plates/kit) 96GBB10 (10 x 96 well plates/kit) Instruction Manual Ver. 05.04.17 For Research Use Only Advantages Sample:

More information

Updated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number.

Updated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number. 96-well High-multiplexing Tagmentation and Amplification Robyn Tanny August 2015 This protocol uses the following purchased reagents: Company Kit Catalog Number Illumina Nextera DNA Sample Preparation

More information

Amplicon Library Preparation Method Manual. GS FLX Titanium Series October 2009

Amplicon Library Preparation Method Manual. GS FLX Titanium Series October 2009 GS FLX Titanium Series 1. Workflow 3. Procedure The procedure to prepare Amplicon libraries is shown in Figure 1. It consists of a PCR amplification, performed using special Fusion Primers for the Genome

More information

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Cat. # 9760 For Research Use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Shipping and Storage... 4 IV. Preparation

More information

RNAprep Pure Kit (For Cell/Bacteria)

RNAprep Pure Kit (For Cell/Bacteria) RNAprep Pure Kit (For Cell/Bacteria) For purification of total RNA from cultured animal cells and bacteria www.tiangen.com/en DP140916 RNAprep Pure Kit (For Cell/Bacteria) Kit Contents (Spin Column) Cat.

More information

INDEX INDEX 0 KIT COMPONENTS 1 STORAGE AND STABILITY 1 INTRODUCTION 1 IMPORTANT NOTES 2 EUROGOLD TOTAL RNA ISOLATION PROTOCOL 2 DNA CONTAMINATION 5

INDEX INDEX 0 KIT COMPONENTS 1 STORAGE AND STABILITY 1 INTRODUCTION 1 IMPORTANT NOTES 2 EUROGOLD TOTAL RNA ISOLATION PROTOCOL 2 DNA CONTAMINATION 5 INDEX INDEX 0 KIT COMPONENTS 1 STORAGE AND STABILITY 1 INTRODUCTION 1 IMPORTANT NOTES 2 EUROGOLD TOTAL RNA ISOLATION PROTOCOL 2 DNA CONTAMINATION 5 QUANTITATION AND STORAGE OF RNA 5 RNA QUALITY 5 TROUBLESHOOTING

More information

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

UltraClean Midi Plasmid Prep Kit

UltraClean Midi Plasmid Prep Kit UltraClean Midi Plasmid Prep Kit Catalog No. Quantity 12700-20 20 Preps Instruction Manual Please recycle Version: 05232014 1 Table of Contents Introduction... 3 Protocol Overview... 3 Flow Chart... 4

More information

E.Z.N.A. HP Viral RNA/DNA Kit. R preps R preps

E.Z.N.A. HP Viral RNA/DNA Kit. R preps R preps E.Z.N.A. HP Viral RNA/DNA Kit R6873-00 5 preps R6873-01 50 preps August 2013 E.Z.N.A. HP Viral RNA/DNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

Reagents Description Storage

Reagents Description Storage MAN-10054-03 In this workflow, samples will undergo lysis using a detergent-containing buffer followed by detergent removal using spin columns. The lysate will be quantified for total protein concentration,

More information

VDL300.3 PRODUCTION OF RETROVIRAL VECTOR BY TRANSIENT TRANSFECTION

VDL300.3 PRODUCTION OF RETROVIRAL VECTOR BY TRANSIENT TRANSFECTION 1. Purpose 1.1. The purpose of this protocol is to produce retrovirus from transfected plasmid DNA. 1.2. This procedure is routinely performed in the Vector Development Laboratory (VDL) following Good

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications

More information

RNAprep pure Kit (For Cell/Bacteria)

RNAprep pure Kit (For Cell/Bacteria) RNAprep pure Kit (For Cell/Bacteria) For purification of total RNA from cultured animal cells and bacteria www.tiangen.com RP090326 RNAprep pure Kit (For Cell/Bacteria) Kit Contents (Spin Column) Cat.

More information

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Myers Lab ChIP-seq Protocol v Modified January 10, 2014 Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

E.Z.N.A. mirna Kit. R preps R preps R preps

E.Z.N.A. mirna Kit. R preps R preps R preps E.Z.N.A. mirna Kit R7034-00 5 preps R7034-01 50 preps R7034-02 200 preps August 2011 E.Z.N.A. Micro RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

USER GUIDE. HiYield TM Total RNA Extraction Kit

USER GUIDE. HiYield TM Total RNA Extraction Kit USER GUIDE HiYield TM Total RNA Extraction Kit Precautions I) Handling Requirements Do not use a kit after its expiration date has passed. Some reagents contain the hazardous compounds guanidine thiocyanate

More information

PreAnalytiX Supplementary Protocol

PreAnalytiX Supplementary Protocol PreAnalytiX Supplementary Protocol Purification of total RNA from microdissected PAXgene Tissue fixed, paraffin-embedded (PFPE) and PAXgene Tissue fixed, cryo-embedded (PFCE) tissues This protocol is for

More information

Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using a spin-column.

Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using a spin-column. INSTRUCTION MANUAL ZymoPURE Plasmid Miniprep Kit Catalog Nos. D4209, D4210, D4211 & D4212 (Patent Pending) Highlights Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using

More information

QIAfilter Plasmid Midi Kit (Cat #: 12243)

QIAfilter Plasmid Midi Kit (Cat #: 12243) QIAfilter Plasmid Midi Kit (Cat #: 12243) Things to do before starting Add the provided RNase A solution to Buffer P1 before use. Use one vial of RNase A (centrifuge briefly before use) per bottle of Buffer

More information

E.Z.N.A. Tissue RNA Kit. R preps R preps

E.Z.N.A. Tissue RNA Kit. R preps R preps E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization

More information

Mag-Bind PX Blood RNA 96 Kit. M x 96 preps M x 96 preps

Mag-Bind PX Blood RNA 96 Kit. M x 96 preps M x 96 preps Mag-Bind PX Blood RNA 96 Kit M7763-00 1 x 96 preps M7763-01 4 x 96 preps June 2018 Mag-Bind PX Blood RNA 96 Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

E.Z.N.A. FFPE RNA Kit. R preps R preps R preps

E.Z.N.A. FFPE RNA Kit. R preps R preps R preps E.Z.N.A. FFPE RNA Kit R6954-00 5 preps R6954-01 50 preps R6954-02 200 preps January 2015 E.Z.N.A. FFPE RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

Protocol for amplification of measles sequencing window (N-450)

Protocol for amplification of measles sequencing window (N-450) Annex 7.1 Protocol for amplification of measles sequencing window (N-450) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop their own

More information

Protocol for DNA extraction from FFPE Samples

Protocol for DNA extraction from FFPE Samples 25, ave Georges Lemaître - B-6041 Gosselies (Belgique) Tel : +32 (0)71 37 85 27 - Fax : +32 (0)71 34 78 79 Protocol for DNA extraction from FFPE Samples Step 1. Paraffin Removal 1 Equilibrate a heat block

More information

Purification of viral RNA and DNA from 1000 µl of plasma, serum, and cell-free body fluids using the QIAamp MinElute Virus Vacuum Kit

Purification of viral RNA and DNA from 1000 µl of plasma, serum, and cell-free body fluids using the QIAamp MinElute Virus Vacuum Kit User-Developed Protocol: Purification of viral RNA and DNA from 1000 µl of plasma, serum, and cell-free body fluids using the QIAamp MinElute Virus Vacuum Kit This procedure has been adapted by customers

More information

UltraClean Mega Soil DNA Kit Catalog number: Preps (For up to 10 grams of soil)

UltraClean Mega Soil DNA Kit Catalog number: Preps (For up to 10 grams of soil) UltraClean Mega Soil DNA Kit Catalog number: 12900-10 10 Preps (For up to 10 grams of soil) Instruction Manual Introduction Use this kit for isolating DNA from 5-10 g soil samples. The basic procedure

More information

Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100

Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100 Product

More information

Illumina Sequencing Sample Preparation for use with CRISPRi/a-v2 Libraries

Illumina Sequencing Sample Preparation for use with CRISPRi/a-v2 Libraries Illumina Sequencing Sample Preparation for use with CRISPRi/a-v2 Libraries Overview This protocol describes the four steps required for generating sequencing samples from cells harvested from screens conducted

More information

Specifications. Kit Specifications. Alcohol Precipitation: Up to 100 ml Column Purification: Up to 5 ml Column Binding Capacity 25 µg

Specifications. Kit Specifications. Alcohol Precipitation: Up to 100 ml Column Purification: Up to 5 ml Column Binding Capacity 25 µg 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com BAC DNA MiniPrep Kit Product # 18050 Product Insert The BAC DNA

More information

Fast, easy, reliable, ultra-pure transfection grade plasmid DNA Maxiprep using a microcentrifuge spin-column.

Fast, easy, reliable, ultra-pure transfection grade plasmid DNA Maxiprep using a microcentrifuge spin-column. INSTRUCTION MANUAL ZymoPURE II Plasmid Maxiprep Kit Catalog Nos. D4202 & D4203 (Patent Pending) Highlights Fast, easy, reliable, ultra-pure transfection grade plasmid DNA Maxiprep using a microcentrifuge

More information

Fast, easy, reliable, ultra-pure transfection grade plasmid DNA Maxiprep using a microcentrifuge spin-column.

Fast, easy, reliable, ultra-pure transfection grade plasmid DNA Maxiprep using a microcentrifuge spin-column. INSTRUCTION MANUAL ZymoPURE II Plasmid Maxiprep Kit Catalog Nos. D4202 & D4203 (Patent Pending) Highlights Fast, easy, reliable, ultra-pure transfection grade plasmid DNA Maxiprep using a microcentrifuge

More information

Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400

Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400

More information

(Spin Column) For purification of DNA and RNA from formalin-fixed, paraffin-embedded. tissue sections. Instruction for Use. For Research Use Only

(Spin Column) For purification of DNA and RNA from formalin-fixed, paraffin-embedded. tissue sections. Instruction for Use. For Research Use Only AmoyDx FFPE DNA/RNA Kit (Spin Column) For purification of DNA and RNA from formalin-fixed, paraffin-embedded tissue sections Instruction for Use For Research Use Only Instruction Version: B1.0 Revision

More information

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D MATERIALS Media Sodium Pyruvate (Mediatech; Cat# MT25-000-CI) Leukemia Inhibitory Factor

More information

EZ-10 SPIN COLUMN HANDBOOK

EZ-10 SPIN COLUMN HANDBOOK EZ-0 SPIN COLUMN HANDBOOK EZ-0 Spin Column Plasmid DNA Mini Kit EZ-0 Spin Column PCR Products Purification Kit EZ-0 Spin Column DNA Gel Extraction Kit Version 20.0 Rev 3/23/205 ISO900 Certified 20 Konrad

More information

7.13 Experimental Microbial Genetics

7.13 Experimental Microbial Genetics MIT OpenCourseWare http://ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 7.13 Fall 2008 Page

More information

Protocols for cell lines using CRISPR/CAS

Protocols for cell lines using CRISPR/CAS Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable

More information

VDL102.3 Production of Adenovirus in 293 Cells

VDL102.3 Production of Adenovirus in 293 Cells 1. Purpose CENTER FOR CELL & GENE THERAPY 1.1. The purpose of this protocol is to produce adenoviral vectors from transfected plasmid DNA. 1.2. This procedure is routinely performed in the Vector Development

More information

Plasmid Maxiprep Plus Purification Kit

Plasmid Maxiprep Plus Purification Kit Plasmid Maxiprep Plus Purification Kit Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only 1 Description: The Plasmid Maxiprep Plus Purification Kit provides simple,

More information

FosmidMAX DNA Purification Kit

FosmidMAX DNA Purification Kit Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A

More information

EasyPrep TM Plasmid Maxiprep Manual

EasyPrep TM Plasmid Maxiprep Manual EasyPrep TM Plasmid Maxiprep Manual Catalog#: PD05-01, PD05-02 PD05-11, PD05-12 Bioland Scientific LLC 14925 Paramount Blvd., Suite C Paramount, CA 90723 USA Tel: (877) 603-8882 Fax: (562) 733-6008 Email:

More information

RNP Transfection in WTCs

RNP Transfection in WTCs Version 1.0 2016 Allen Institute for Cell Science RNP Transfection in WTCs Required reagent list: Complete mtesr1 culture media, referred to in this protocol as simply mtesr1 : 400 ml basal media with

More information

Plasmid Maxiprep Plus Purification Kit. Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only

Plasmid Maxiprep Plus Purification Kit. Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only Plasmid Maxiprep Plus Purification Kit Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only 1 Description: The Plasmid Maxiprep Plus Purification Kit provides simple,

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit QIAGEN Supplementary Protocol: Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit This protocol requires the RNeasy Mini Kit. IMPORTANT: Please consult the Safety Information and

More information

Plant DNA Isolation Kit (Magnetic Bead System) 50 Preps Product # 58200

Plant DNA Isolation Kit (Magnetic Bead System) 50 Preps Product # 58200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plant DNA Isolation Kit (Magnetic Bead System) 50 Preps Product

More information

Blood DNA Extraction Kit

Blood DNA Extraction Kit H A N D B O O K Blood DNA Extraction Kit NP-BD-050 050 Preps www.genetixbiotech.com Contents Page No COMPONENTS Kit Contents Reagents, Consumables and Equipment not provided with the kit SAFETY INSTRUCTIONS

More information

Average Yields* Yeast DNA Yeast RNA Time to Complete 10 Purifications * Yield will vary depending on the type of sample processed

Average Yields* Yeast DNA Yeast RNA Time to Complete 10 Purifications * Yield will vary depending on the type of sample processed 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Fungi/Yeast RNA/DNA Purification Kit Product # 35800 Product Insert

More information

Mag-Bind Ultra-Pure Plasmid DNA 96 Kit. M x 96 preps M x 96 preps

Mag-Bind Ultra-Pure Plasmid DNA 96 Kit. M x 96 preps M x 96 preps M1258-00 1 x 96 preps M1258-01 4 x 96 preps December 2015 Table of Contents Introduction...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4 Plasmid Protocol with Lysate Clearance via Centrifugation...5

More information

Lysis Buffer A Wash Solution A Elution Buffer B Mini Filter Spin Columns 50 Collection Tubes 50 Elution tubes (1.7 ml) 100 Product Insert 1

Lysis Buffer A Wash Solution A Elution Buffer B Mini Filter Spin Columns 50 Collection Tubes 50 Elution tubes (1.7 ml) 100 Product Insert 1 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Urine DNA Isolation Kit (Slurry Format) Product # 48800 Product

More information

E.Z.N.A. Yeast RNA Kit. R preps R preps

E.Z.N.A. Yeast RNA Kit. R preps R preps R6870-00 5 preps R6870-01 50 preps September 2017 Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Before Beginning...4 Preparing Reagents...5 Yeast RNA Protocol...6

More information

DNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue

DNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue INDEX KIT COMPONENTS 3 STORAGE AND STABILITY 3 BINDING CAPACITY 3 INTRODUCTION 3 IMPORTANT NOTES 4 EUROGOLD TISSUE DNA MINI KIT PROTOCOLS 5 A. DNA isolation from tissue 5 B. DNA isolation from eukaryotic

More information

Hurricane Miniprep Kit PROTOCOL

Hurricane Miniprep Kit PROTOCOL Hurricane Miniprep Kit PROTOCOL Description: The Hurricane Miniprep Kit is designed for purification of up to 25 ug of high purity plasmid DNA from a starting volume of 2-5 ml of bacterial culture. The

More information

GENERAL INFORMATION...

GENERAL INFORMATION... BIOO LIFE SCIENCE PRODUCTS NEXTflex-96 TM DNA Barcodes (Illumina Compatible) Catalog #: 514106 BIOO Scientific Corp. 2012 V12.11 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents,

More information

The fastest, easiest, most reliable method for purification of up to 1.2 mg of ultra-pure endotoxin-free plasmid DNA.

The fastest, easiest, most reliable method for purification of up to 1.2 mg of ultra-pure endotoxin-free plasmid DNA. INSTRUCTION MANUAL ZymoPURE - Express Plasmid Midiprep Kit Catalog No. D4213 (Patent Pending) Highlights Innovative ZymoPURE - Express pellet-free procedure bypasses the standard cell-pelleting and resuspension

More information

Total RNA Purification Kit. Cat. #.: TR01 / TR Size : 50 / 150 Reactions Store at RT For research use only

Total RNA Purification Kit. Cat. #.: TR01 / TR Size : 50 / 150 Reactions Store at RT For research use only Total RNA Purification Kit Cat. #.: TR01 / TR01-150 Size : 50 / 150 Reactions Store at RT For research use only 1 Description: The Total RNA Purification Kit provides a rapid, simple and effective approach

More information

TIANamp Blood DNA Midi Kit

TIANamp Blood DNA Midi Kit TIANamp Blood DNA Midi Kit For purification of high-purity genomic DNA from 0.5-3 ml blood samples www.tiangen.com/en DP120517 TIANamp Blood DNA Midi Kit Kit Contents (Spin Column) Cat. no. DP332-01 Contents

More information

Blood DNA Isolation 96-Well Kit (Magnetic Bead System) Product # 62600

Blood DNA Isolation 96-Well Kit (Magnetic Bead System) Product # 62600 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Blood DNA Isolation 96-Well Kit (Magnetic Bead System) Product

More information

Isolation of total nucleic acids from animal and human cells using the EZ1 RNA Cell Mini Kit

Isolation of total nucleic acids from animal and human cells using the EZ1 RNA Cell Mini Kit QIAGEN Supplementary Protocol: Isolation of total nucleic acids from animal and human cells using the EZ1 RNA Cell Mini Kit This protocol is designed for the isolation of total nucleic acids (NA) from

More information

Supplementary File 3: DNA and RNA isolation

Supplementary File 3: DNA and RNA isolation Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G

More information

Maximum Yield Mini System. Protocol Book YPD100 // YPD300. Ver

Maximum Yield Mini System. Protocol Book YPD100 // YPD300. Ver HiYield Plasmid Kit Mini Maximum Yield Mini System Protocol Book YPD100 // YPD300 Ver. 2017-1 Precautions I) Handling Requirements Do not use a kit after its expiration date has passed. Some reagents

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 5.0 Rev 03/25/205 Table of Contents Introduction 2 Limitations of Use 2 Features 2 Applications 2 Storage 2

More information

E.Z.N.A. Plant RNA Kit. R preps R preps R preps

E.Z.N.A. Plant RNA Kit. R preps R preps R preps E.Z.N.A. Plant RNA Kit R6827-00 5 preps R6827-01 50 preps R6827-02 200 preps September 2014 E.Z.N.A. Plant RNA Kit Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents and Storage...4

More information

Presto Soil DNA Extraction Kit

Presto Soil DNA Extraction Kit Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500

More information

EndoFree Maxi Plasmid Kit

EndoFree Maxi Plasmid Kit EndoFree Maxi Plasmid Kit For purification of ultrapure plasmid DNA with high yields www.tiangen.com/en DP121221 EndoFree Maxi Plasmid Kit Kit Contents Storage (Spin Column) Cat.no. DP117 Contents RNase

More information

PureLink HiPure Plasmid DNA Purification Kits

PureLink HiPure Plasmid DNA Purification Kits USER GUIDE PureLink HiPure Plasmid DNA Purification Kits For mini, midi, and maxi preparation of plasmid DNA Catalog Numbers Revision B.0 Publication Number MAN0000486 K2100-02, K2100-03, K2100-04, K2100-05,

More information

BACMAX DNA Purification Kit

BACMAX DNA Purification Kit Cat. No. BMAX044 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 212 10/2012 1 EPILIT212 Rev. A

More information

AuPreP Plasmid Midi Kit Cat. #: PMD12-143LT (25 preps/kit) PMD12-145LT (50 preps/kit)

AuPreP Plasmid Midi Kit Cat. #: PMD12-143LT (25 preps/kit) PMD12-145LT (50 preps/kit) AuPreP Plasmid Midi Kit Cat. #: PMD12-143LT (25 preps/kit) PMD12-145LT (50 preps/kit) AuPreP Plasmid Midi Kit is designed for rapid isolation of plasmid DNA of superior quality from an average of 25-100

More information

E.Z.N.A. PF Micro RNA Kit. R preps R preps

E.Z.N.A. PF Micro RNA Kit. R preps R preps E.Z.N.A. PF Micro RNA Kit R7036-00 5 preps R7036-01 50 preps June 2013 E.Z.N.A. PF Micro RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

TaKaRa MiniBEST Whole Blood Genomic DNA Extraction Kit

TaKaRa MiniBEST Whole Blood Genomic DNA Extraction Kit Cat. # 9781 For Research Use TaKaRa MiniBEST Whole Blood Genomic DNA Extraction Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 4 IV. Preparation

More information

Mag-Bind Universal Pathogen 96 Kit. M x 96 preps M x 96 preps

Mag-Bind Universal Pathogen 96 Kit. M x 96 preps M x 96 preps M4029-00 1 x 96 preps M4029-01 4 x 96 preps August 2015 Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4 Tissue Protocol...5 Serum/Stool Protocol...9

More information

E.Z.N.A. Stool DNA Kit. D preps D preps D preps

E.Z.N.A. Stool DNA Kit. D preps D preps D preps E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps July 2017 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

E.Z.N.A. Stool DNA Kit. D preps D preps D preps

E.Z.N.A. Stool DNA Kit. D preps D preps D preps E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps April 2013 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

Presto 96 Well DNA Bacteria Advanced Kit

Presto 96 Well DNA Bacteria Advanced Kit Instruction Manual Ver. 07.04.17 For Research Use Only Presto 96 Well DNA Bacteria Advanced Kit 96GBBA02 (2 x 96 well plates/kit) 96GBBA04 (4 x 96 well plates/kit) 96GBBA10 (10 x 96 well plates/kit) Advantages

More information

E.Z.N.A. BAC/PAC Maxi Kit. D preps D preps

E.Z.N.A. BAC/PAC Maxi Kit. D preps D preps E.Z.N.A. BAC/PAC Maxi Kit D2154-00 2 preps D2154-01 5 preps April 2013 E.Z.N.A. BAC/PAC Maxi Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4

More information

Presto Mini gdna Bacteria Kit

Presto Mini gdna Bacteria Kit Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:

More information

Soil DNA Extraction Kit

Soil DNA Extraction Kit Instruction Manual Ver. 09.23.16 For Research Use Only Soil DNA Extraction Kit Advantages IB47800 (4 Preparation Sample Kit) IB47801 (50 Preparation Kit) IB47802 (100 Preparation Kit) Sample: 250-500 mg

More information

Cell3 Xtract. Cell Free DNA Extraction from Plasma. and Other Biological Specimens. Protocol Guide v1.0.1

Cell3 Xtract. Cell Free DNA Extraction from Plasma. and Other Biological Specimens. Protocol Guide v1.0.1 Cell3 Xtract Cell Free DNA Extraction from Plasma and Other Biological Specimens Cell3 Xtract kit - 16 sample kit (C3016SK) Cell3 Xtract kit 48 sample kit (C3048LK) Updates from version 1.0.0 1. Minimum

More information

Human whole blood RNA Purification Kit

Human whole blood RNA Purification Kit Human whole blood RNA Purification Kit Cat. #.: TR03 / TR03-150 Size : 50 / 150 Reactions Store at RT For research use only 2016.01.11 1 Description: The Human Blood RNA Purification Kit provides a rapid,

More information

Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System)

Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) BACKGROUND This protocol describes how to transfect

More information

TIANamp Marine Animals DNA Kit

TIANamp Marine Animals DNA Kit TIANamp Marine Animals DNA Kit For isolation of genomic DNA from marine animal tissues www.tiangen.com/en DP121221 TIANamp Marine Animals DNA Kit (Spin Column) Cat. no. DP324 Kit Contents Contents DP324-02

More information

E.Z.N.A. Gel Extraction Kit

E.Z.N.A. Gel Extraction Kit E.Z.N.A. Gel Extraction Kit D2500-00 5 preps D2500-01 50 preps D2500-02 200 preps D2501-00 5 preps D2501-01 50 preps D2501-02 200 preps Manual Date: November 2018 Revision Number: v3.1 E.Z.N.A. Gel Extraction

More information