disaccharides = two mono-s linked together e.g. lactose = glucose + galactose sucrose = glucose + fructose

Size: px
Start display at page:

Download "disaccharides = two mono-s linked together e.g. lactose = glucose + galactose sucrose = glucose + fructose"

Transcription

1

2 involved in the degradation of molecules found in animal cells membrane limited varies in shape and size contains acid hydrolases (phosphatase, nucleases, proteases, etc.), enzymes that work only at acid ph levels acid ph level maintained through H+ pumps if contents spill into the cytosol no degradation takes place (ph in [ ]) it degrades membranes and organelles that have outlived their usefulness it plays role in the degradation of extracellular macromolecules (endocytosis: exterior -> cell) Tay-Sachs disease: inherited, recessive neurodegenerative disease, leads to death by age 5 defective lysosome is missing an enzyme (b-n-hexosaminidase-a) needed to degrade continuously accumulating constituent of plasma membrane of mamalian cells (particularly nerve cells)

3

4 general formula: [ CH(OH) ] n disaccharides = two mono-s linked together e.g. lactose = glucose + galactose sucrose = glucose + fructose O C n H 2n+1 - C - H aldehyde or O C n H 2n+1 - C - C m H 2m+1 ketone and two or more hydroxyl groups

5 biomembranes separate a cell from its surroundings lipids are the structural elements of biomembranes fatty acids are the principal components of lipids general formulas for acids: O C n H 2n+1 - C - OH saturated O C n H 2n-1 - C - OH unsat. / single double bond O C n H 2n-3 - C - OH unsat. / 2 double-1 triple

6 O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O CH2 - O - P - O- O- CH2 - O - P - O- O- O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O CH2 - O - P - O- O- O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH CH2 - O - P - O- O- O CH2 - O - P - O- O- O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O CH2 - O - P - O- O-

7

8 H O NH 2 - C a - C - OH R POLAR: uncharged (=S, T, Q, N), + charged (=K, R, H), - charged (= D, E) HYDROPHOBIC: I, L, M, V, F, A, Y, W OTHER: C (=SH allows for disulphide bond) G (=small) P (=rigid)

9 H O H O NH 2 - C a - C - OH + HNH - C a - C - OH ---> R R H O H O N-terminus NH 2 - C a - C - NH - C a - C - OH + H 2 O C-terminus R R peptide bond

10 Figure from: Molecular Cell Biology 2nd edition Darnell/LodishBaltimore pp47

11 Proteins that catalyze chemical reaction Mediators of dynamic events. Enzymes increase the rates of reactions. Naming convention: XXX - ase is the name of the enzyme acting on molecule XXX Examples: XXX = protein -> protease XXX = rna -> ribonuclease XXX = dna -> deoxyribonuclease

12 produced after invasion by infectious agent(s) the recognition site of an antibody can bind tightly to very specific sites (generally on surface proteins or carbohydrates of the infectious agent) experimentally, animals will produce antibodies for any foreign injected polymer they act as signals for the elimination of infectious agents they have exquisite specificity composed of 2 heavy and 2 light chains; the N-termini of heavy/light chains are highly variable also useful in isolating proteins from a mixture

13 Figure from: Copyright: by Alberts, Bray, Johnson, Lewis, Raff, Roberts, Walter. Published by Garland Publishing, a member of the Taylor & Francis Group.

14 replication reverse transcription DNA RNA protein transcription translation replication

15 template strand 3' 5' 5' 3'

16 3' template strand EXON EXON EXON EXON 5' 5' 3' INTRON INTRON INTRON Gene Length #introns introns as % length Insulin 1.4 Kb 2 67 Serum albumin 18 Kb Cystic Fibrosis 250 Kb Dystrophin 2.3 Mb >100 99

17 Figure from: Artist: Darryl Leja

18

19 3' 5' 5' 3' gene clusters same gene / different genes gene discontinuity introns / exons

20 3' 5' 5' 3' 3' 5' 5' 3' 5' 3' 5' 3' 3' 5' 5' 3'

21 Gene

22 -25 Gene TF IID TF IIB TF IID TF IIB TF IID E F TF IIB TF IID TF IIA TF IIA TF IIA TF IIA

23 5' GENE 3' start end "!

24 #"! & 9 / = >= C B A %A - % $ * 1 : & - ( ( ). -, + * &'() ) ( -; < -; < -;? % % %? % B A %

25 50s 60s 5s 23s 5s 5.8s 28s 34 polypeptides 49 polypeptides 30s 21 polypeptides 16s 33 polypeptides 18s 40s Prokaryotes Eukaryotes

26 DNA mrna RNA polymerase Protein

27 mrna RNA polymerase Protein DNA

28

29 # *) & / 2 $! % ".-,+ ( ' %

30 #!! " 7 / 1 - / - 9 > : # #! #! #! #!! #! #! Σ # +* ) %#&'( ##$ #!!, <;,70 7:1 0, / , :..4 > = 90 : 9. 7= , A 1 / 4 :8 / 9: / HG F- 9AE 1 / 4 CD8:.4-0 / 4 BA,4

31 Σall i

32

33 %

34 -3 0 E 4 : 8 = > 1 B,? 9 3? 9 H, 9 : - / H5, 9 H 9 / 8, > 9 3 / / / E 1, 3 / 9 1 4, 9 8 > 4 : /. -0 / 4 BA,4 9 / G A 02? : /. 04? A:? / 2 0A 9 / 04 B01 -> 3: 8 / 4: : 9 9.4? B A: 1,-0 :4A 9A :4 8 9A 4, : 34 8 / 4A := 9B 8 9A 4, : > :. 0 / A: / 4A := 9B 8 9A 4 >. 8 / : / 4 2 = 9B 8 3 A / 4. 9A A 9. 4? -,40 G C 8 G > - 9A 90 / 2 0 -,A / G 4 - / / 4 0A :1-0? / 2. > 4, / 40

35

36 Ω A B Reality Algorithm - positives: A - true positives: A - negatives: Ω A sensitivity: B A B / A - false positives: B \ A - false negatives: A \ A specificity: A B B B / B

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

3-Carbon. Okazaki fragments

3-Carbon. Okazaki fragments DNA Replication DNA strands separate and the nucleotides in the cells come in and join the nitrogenous bases Enzyme Helicase unzips the DNA ready for replication Enzyme Primase adds an RNA Primer which

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

A primer on the structure and function of genes

A primer on the structure and function of genes A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology

Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

Section C: The Control of Gene Expression

Section C: The Control of Gene Expression Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION

More information

Four levels of protein Structure

Four levels of protein Structure Proteins (polypeptides) Four levels of protein Structure Primary Structure (1 structure): Secondary Structure (2 structure): Tertiary Structure (3 structure): Quaternary Structure (4 structure): Proteins

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

Transcription: Synthesis of RNA

Transcription: Synthesis of RNA Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for

More information

Transcription and Translation

Transcription and Translation Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

Gene Expression: From Genes to Proteins

Gene Expression: From Genes to Proteins The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

th is is re vi sio n. com

th is is re vi sio n. com Section (a) Cells and organelles th is is re vi sio n. com 1. Make a diagram to show the structure of a liver cell as seen using an electron microscope. On your diagram, label the following: nucleus nuclear

More information

1/24/2012. Cell. Plasma Membrane

1/24/2012. Cell. Plasma Membrane Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division Cell Basic unit of structure and function in body

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Replication, Transcription, and Translation

Replication, Transcription, and Translation Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

UNIT 3B. Yesterday s Picture DNA RNA. protein

UNIT 3B. Yesterday s Picture DNA RNA. protein Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles,

More information

UNIT 3B. Yesterday s Picture DNA RNA. protein

UNIT 3B. Yesterday s Picture DNA RNA. protein Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles,

More information

Unit IIB Exam (v. 1.0)

Unit IIB Exam (v. 1.0) Unit IIB Exam (v. 1.0) 1. The lac operon. (PT1-5) a. Is found only in eukaryotic cells b. Codes for the sequence of amino acids in lactase c. Regulates the transcription of mrna d. Regulates transcription

More information

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able

More information

There are 100 possible points on this exam. THIS EXAM IS CLOSED BOOK. 1. (6 points) Distinguish between the innate and adaptive immune responses:

There are 100 possible points on this exam. THIS EXAM IS CLOSED BOOK. 1. (6 points) Distinguish between the innate and adaptive immune responses: BENG 100b: Frontiers in Biomedical Engineering Midterm Examination 28 February 2006 There are 100 possible points on this exam. THIS EXAM IS CLOSED BOOK. SHORT ANSWER (Total=70 points) Read the questions

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

Gene Expression and Regulation - 1

Gene Expression and Regulation - 1 Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Chapter 5 Guided Reading Chapter 5: The Structure and Function of Large Biological Molecules Section 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things

More information

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark) Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.

More information

Gene Expression. Lesson 6

Gene Expression. Lesson 6 Gene Expression Lesson 6 Regulation of gene expression Gene regulation turning on or off specific genes depending on the requirements of an organism Housekeeping genes are always switched on (vital life

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

Figure A summary of spontaneous alterations likely to require DNA repair.

Figure A summary of spontaneous alterations likely to require DNA repair. DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Ch. 10 From DNA to Protein. AP Biology

Ch. 10 From DNA to Protein. AP Biology Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

BIOL1020 Study Guide Sample

BIOL1020 Study Guide Sample BIOL1020 Study Guide Sample This study guide covers generally all of the content from weeks 1 to 13 primarily based on the textbook with moderate input from lecture slides. These study notes aim to balance

More information

A DNA molecule consists of two strands of mononucleotides. Each of these strands

A DNA molecule consists of two strands of mononucleotides. Each of these strands 1 Read through the following passage on the structure of DNA, then write on the dotted lines the most appropriate word or words to complete the passage. (8) A DNA molecule consists of two strands of mononucleotides.

More information

DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2

DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

The gene. Fig. 1. The general structure of gene

The gene. Fig. 1. The general structure of gene The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

2 nd Term Final. Revision Sheet. Students Name: Grade: 12-A/B. Subject: Chemistry. Teacher Signature. Page 1 of 10

2 nd Term Final. Revision Sheet. Students Name: Grade: 12-A/B. Subject: Chemistry. Teacher Signature. Page 1 of 10 2 nd Term Final Revision Sheet Students Name: Grade: 12-A/B Subject: Chemistry Teacher Signature Page 1 of 10 Chapter-23, Lesson-1 I. MULTIPLE CHOICE 1. How does the number of hydrogen atoms in a carbohydrate

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

Chapter 3.5. Protein Synthesis

Chapter 3.5. Protein Synthesis Chapter 3.5 Protein Synthesis Summary of Protein Synthesis How chemical Information is transfer during protein synthesis DNA mrna protein transcription the step from DNA to mrna occurs in the nucleus where

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Q. No. 1. How can RNA be distinguished from DNA?

Q. No. 1. How can RNA be distinguished from DNA? Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,

More information

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A

More information

John s Student Union Study Guide for Final Exam

John s Student Union Study Guide for Final Exam John s Student Union Study Guide for Final Exam 1. What organelle do Prokaryotes and Eukaryotes have in common? Ribosomes 2. Covalent vs Ionic bonds: Covalent: sharing electrons (Polar & Nonpolar) Ionic:

More information

5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA?

5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA? Name This exam is schedule for 75 minutes and I anticipate it to take the full time allotted. You are free to leave if you finish. The exam is split into two sections. Part 1 is multiple choice select

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

Molecular Basis of Inheritance

Molecular Basis of Inheritance Molecular Basis of Inheritance Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Answer Nitrogenous bases present in the

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav

DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to: 1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what

More information

Nucleic Acid Structure:

Nucleic Acid Structure: Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine

More information

12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:

12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall: 12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information