disaccharides = two mono-s linked together e.g. lactose = glucose + galactose sucrose = glucose + fructose
|
|
- Margery Mariah Hampton
- 6 years ago
- Views:
Transcription
1
2 involved in the degradation of molecules found in animal cells membrane limited varies in shape and size contains acid hydrolases (phosphatase, nucleases, proteases, etc.), enzymes that work only at acid ph levels acid ph level maintained through H+ pumps if contents spill into the cytosol no degradation takes place (ph in [ ]) it degrades membranes and organelles that have outlived their usefulness it plays role in the degradation of extracellular macromolecules (endocytosis: exterior -> cell) Tay-Sachs disease: inherited, recessive neurodegenerative disease, leads to death by age 5 defective lysosome is missing an enzyme (b-n-hexosaminidase-a) needed to degrade continuously accumulating constituent of plasma membrane of mamalian cells (particularly nerve cells)
3
4 general formula: [ CH(OH) ] n disaccharides = two mono-s linked together e.g. lactose = glucose + galactose sucrose = glucose + fructose O C n H 2n+1 - C - H aldehyde or O C n H 2n+1 - C - C m H 2m+1 ketone and two or more hydroxyl groups
5 biomembranes separate a cell from its surroundings lipids are the structural elements of biomembranes fatty acids are the principal components of lipids general formulas for acids: O C n H 2n+1 - C - OH saturated O C n H 2n-1 - C - OH unsat. / single double bond O C n H 2n-3 - C - OH unsat. / 2 double-1 triple
6 O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O CH2 - O - P - O- O- CH2 - O - P - O- O- O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O CH2 - O - P - O- O- O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH CH2 - O - P - O- O- O CH2 - O - P - O- O- O ffaattyy aaccyyll - C - O - CH2 O ffaattyy aaccyyll - C - O - CH O CH2 - O - P - O- O-
7
8 H O NH 2 - C a - C - OH R POLAR: uncharged (=S, T, Q, N), + charged (=K, R, H), - charged (= D, E) HYDROPHOBIC: I, L, M, V, F, A, Y, W OTHER: C (=SH allows for disulphide bond) G (=small) P (=rigid)
9 H O H O NH 2 - C a - C - OH + HNH - C a - C - OH ---> R R H O H O N-terminus NH 2 - C a - C - NH - C a - C - OH + H 2 O C-terminus R R peptide bond
10 Figure from: Molecular Cell Biology 2nd edition Darnell/LodishBaltimore pp47
11 Proteins that catalyze chemical reaction Mediators of dynamic events. Enzymes increase the rates of reactions. Naming convention: XXX - ase is the name of the enzyme acting on molecule XXX Examples: XXX = protein -> protease XXX = rna -> ribonuclease XXX = dna -> deoxyribonuclease
12 produced after invasion by infectious agent(s) the recognition site of an antibody can bind tightly to very specific sites (generally on surface proteins or carbohydrates of the infectious agent) experimentally, animals will produce antibodies for any foreign injected polymer they act as signals for the elimination of infectious agents they have exquisite specificity composed of 2 heavy and 2 light chains; the N-termini of heavy/light chains are highly variable also useful in isolating proteins from a mixture
13 Figure from: Copyright: by Alberts, Bray, Johnson, Lewis, Raff, Roberts, Walter. Published by Garland Publishing, a member of the Taylor & Francis Group.
14 replication reverse transcription DNA RNA protein transcription translation replication
15 template strand 3' 5' 5' 3'
16 3' template strand EXON EXON EXON EXON 5' 5' 3' INTRON INTRON INTRON Gene Length #introns introns as % length Insulin 1.4 Kb 2 67 Serum albumin 18 Kb Cystic Fibrosis 250 Kb Dystrophin 2.3 Mb >100 99
17 Figure from: Artist: Darryl Leja
18
19 3' 5' 5' 3' gene clusters same gene / different genes gene discontinuity introns / exons
20 3' 5' 5' 3' 3' 5' 5' 3' 5' 3' 5' 3' 3' 5' 5' 3'
21 Gene
22 -25 Gene TF IID TF IIB TF IID TF IIB TF IID E F TF IIB TF IID TF IIA TF IIA TF IIA TF IIA
23 5' GENE 3' start end "!
24 #"! & 9 / = >= C B A %A - % $ * 1 : & - ( ( ). -, + * &'() ) ( -; < -; < -;? % % %? % B A %
25 50s 60s 5s 23s 5s 5.8s 28s 34 polypeptides 49 polypeptides 30s 21 polypeptides 16s 33 polypeptides 18s 40s Prokaryotes Eukaryotes
26 DNA mrna RNA polymerase Protein
27 mrna RNA polymerase Protein DNA
28
29 # *) & / 2 $! % ".-,+ ( ' %
30 #!! " 7 / 1 - / - 9 > : # #! #! #! #!! #! #! Σ # +* ) %#&'( ##$ #!!, <;,70 7:1 0, / , :..4 > = 90 : 9. 7= , A 1 / 4 :8 / 9: / HG F- 9AE 1 / 4 CD8:.4-0 / 4 BA,4
31 Σall i
32
33 %
34 -3 0 E 4 : 8 = > 1 B,? 9 3? 9 H, 9 : - / H5, 9 H 9 / 8, > 9 3 / / / E 1, 3 / 9 1 4, 9 8 > 4 : /. -0 / 4 BA,4 9 / G A 02? : /. 04? A:? / 2 0A 9 / 04 B01 -> 3: 8 / 4: : 9 9.4? B A: 1,-0 :4A 9A :4 8 9A 4, : 34 8 / 4A := 9B 8 9A 4, : > :. 0 / A: / 4A := 9B 8 9A 4 >. 8 / : / 4 2 = 9B 8 3 A / 4. 9A A 9. 4? -,40 G C 8 G > - 9A 90 / 2 0 -,A / G 4 - / / 4 0A :1-0? / 2. > 4, / 40
35
36 Ω A B Reality Algorithm - positives: A - true positives: A - negatives: Ω A sensitivity: B A B / A - false positives: B \ A - false negatives: A \ A specificity: A B B B / B
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More information3-Carbon. Okazaki fragments
DNA Replication DNA strands separate and the nucleotides in the cells come in and join the nitrogenous bases Enzyme Helicase unzips the DNA ready for replication Enzyme Primase adds an RNA Primer which
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationA primer on the structure and function of genes
A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationMolecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationFour levels of protein Structure
Proteins (polypeptides) Four levels of protein Structure Primary Structure (1 structure): Secondary Structure (2 structure): Tertiary Structure (3 structure): Quaternary Structure (4 structure): Proteins
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationTranscription: Synthesis of RNA
Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationGene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationth is is re vi sio n. com
Section (a) Cells and organelles th is is re vi sio n. com 1. Make a diagram to show the structure of a liver cell as seen using an electron microscope. On your diagram, label the following: nucleus nuclear
More information1/24/2012. Cell. Plasma Membrane
Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division Cell Basic unit of structure and function in body
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationReplication, Transcription, and Translation
Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationUNIT 3B. Yesterday s Picture DNA RNA. protein
Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles,
More informationUNIT 3B. Yesterday s Picture DNA RNA. protein
Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles,
More informationUnit IIB Exam (v. 1.0)
Unit IIB Exam (v. 1.0) 1. The lac operon. (PT1-5) a. Is found only in eukaryotic cells b. Codes for the sequence of amino acids in lactase c. Regulates the transcription of mrna d. Regulates transcription
More informationThe Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis
The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able
More informationThere are 100 possible points on this exam. THIS EXAM IS CLOSED BOOK. 1. (6 points) Distinguish between the innate and adaptive immune responses:
BENG 100b: Frontiers in Biomedical Engineering Midterm Examination 28 February 2006 There are 100 possible points on this exam. THIS EXAM IS CLOSED BOOK. SHORT ANSWER (Total=70 points) Read the questions
More informationIntroduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
More informationGene Expression and Regulation - 1
Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Chapter 5 Guided Reading Chapter 5: The Structure and Function of Large Biological Molecules Section 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationGene Expression. Lesson 6
Gene Expression Lesson 6 Regulation of gene expression Gene regulation turning on or off specific genes depending on the requirements of an organism Housekeeping genes are always switched on (vital life
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationFigure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationBIOL1020 Study Guide Sample
BIOL1020 Study Guide Sample This study guide covers generally all of the content from weeks 1 to 13 primarily based on the textbook with moderate input from lecture slides. These study notes aim to balance
More informationA DNA molecule consists of two strands of mononucleotides. Each of these strands
1 Read through the following passage on the structure of DNA, then write on the dotted lines the most appropriate word or words to complete the passage. (8) A DNA molecule consists of two strands of mononucleotides.
More informationDNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2
DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationQuick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationThe gene. Fig. 1. The general structure of gene
The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More information2 nd Term Final. Revision Sheet. Students Name: Grade: 12-A/B. Subject: Chemistry. Teacher Signature. Page 1 of 10
2 nd Term Final Revision Sheet Students Name: Grade: 12-A/B Subject: Chemistry Teacher Signature Page 1 of 10 Chapter-23, Lesson-1 I. MULTIPLE CHOICE 1. How does the number of hydrogen atoms in a carbohydrate
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationChapter 3.5. Protein Synthesis
Chapter 3.5 Protein Synthesis Summary of Protein Synthesis How chemical Information is transfer during protein synthesis DNA mrna protein transcription the step from DNA to mrna occurs in the nucleus where
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationQ. No. 1. How can RNA be distinguished from DNA?
Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationJohn s Student Union Study Guide for Final Exam
John s Student Union Study Guide for Final Exam 1. What organelle do Prokaryotes and Eukaryotes have in common? Ribosomes 2. Covalent vs Ionic bonds: Covalent: sharing electrons (Polar & Nonpolar) Ionic:
More information5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA?
Name This exam is schedule for 75 minutes and I anticipate it to take the full time allotted. You are free to leave if you finish. The exam is split into two sections. Part 1 is multiple choice select
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationMolecular Basis of Inheritance
Molecular Basis of Inheritance Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Answer Nitrogenous bases present in the
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationDNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav
DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More information3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:
1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what
More informationNucleic Acid Structure:
Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine
More information12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More information