Cornell Probability Summer School 2006

Size: px
Start display at page:

Download "Cornell Probability Summer School 2006"

Transcription

1 Colon Cancer Cornell Probability Summer School 2006 Simon Tavaré Lecture 5 Stem Cells Potten and Loeffler (1990): A small population of relatively undifferentiated, proliferative cells that maintain their population size when they divide, while at the same time producing progeny that enter a dividing transit population within which further rounds of division occur together with differentiation events which resulted ultimately in the production of functional cell types required of the tissue Embryonic stem cells (ES) enormous division potential can produce all differentiated cell types needed by organism Adult stem cells restricted range of differentiated products (?) Colon crypts Stem cells are undifferentiated cells residing in a specific location (niche) in a tissue can produce a variety of somatic cell types needed for tissue renewal produce intermediate (Transit Amplifying) cells that can divide rapidly and differentiate into various types of tissue cell must be maintained, as only they can effect continuous renewal Colon lined with 15 million crypts Problem: no way to identify stem cells

2 Colon crypts How do stem cells maintain their numbers? Model A (Deterministic) Small number of stem cells in niche each generates a single stem cell and a single TA cell on division (asymmetric division) each stem cell is immortal How do stem cells maintain their numbers? Model A (Deterministic) Small number of stem cells in niche each generates a single stem cell and a single TA cell on division each stem cell is immortal How do we distinguish between the two? We need a marker that changes rapidly during cell division Mutations in DNA? Model B (Stochastic) Many stem cells in a niche each stem cell produces 0,1 or 2 stem cells (and 2, 1 or 0 TA cells) on division How do we distinguish between the two? We need a marker that changes rapidly during cell division Mutations in DNA? We use CpG methylation patterns... epigenetic changes that survive mitotic division Methylation CpG islands In human genome, CpG dinucleotides are relatively rare CpG pairs undergo a process called methylation that modifies the C nucleotide A methylated C can (with relatively high probability) mutate to a T Promoter regions are CpG rich These regions are not methylated, and thus mutate less often

3 Fragile X Syndrome Methylation... Causes repression of gene expression CpG islands often located around promoters of housekeeping genes these are not usually methylated Inactive genes often methylated Methylation patterns Methylation patterns vary with time Can be detected by bisulfite sequencing Bisulfite treatment changes unmethylated C into U, but leaves methylated C alone. Sequencing identifies methylated sites as C, unmethylated as T. Data We studied methylation patterns in three genes not expressed in colon crypt cells MYOD1(5),CSX(8) BGN(9) X-chromosome locus, 130 bp island 7 male patients 7 9normalcryptsperperson 8 24 molecules studied per crypt Experimental Method Methylation in a Single Individual

4 A stochastic model Start with N stem cells in crypt Assume constant number N of stem cells after every replication Each cell that is not a stem cell is a TA cell TA cells initiate independent branching processes that grow for a fixed number of replications and then die out The branching mechanism reflects the fact that a crypt contains about 2000 cells A Cannings model Start with N stem cells in crypt X 1,...,X N iid with IP(X i =1)=p, IP(X i =0)=IP(X i =2) Assume a constant number of stem cells after every replication The joint distribution of the numbers ν 1,...,ν N of stem cells copied from stem cells 1,..., N is given by L(ν 1,...,ν N )=L(X 1,...,X N ΣX i = N) Describing methylation patterns After g generations crypt contains a number of cells from which we sample a few for bisulfite treatment, PCR amplification, cloning and sequencing Superimpose effect of changes in methylation during mitotic division Aim: infer something about the number of stem cells, given the observed methylation patterns A number of summary statistics: percent methylation number of unique tags ( alleles ) pairwise difference statistics number of segregating sites Which Model? Reminder: ABC Table 2. Observed and expected variance of unique tags per crypt Stem cell model Observed variance 2 immortal, p cell niche, p 0.95 Variance under model, average (CI) 256-cell niche, p 0.89 CSX A ( ) 0.83 ( ) 1.1 ( ) B ( ) 0.84 ( ) 1.0 ( ) C ( ) 1.0 ( ) 1.3 ( ) D ( ) 0.86 ( ) 1.1 ( ) E ( ) 0.83 ( ) 1.1 ( ) F ( ) 0.94 ( ) 1.2 ( ) G ( ) 0.83 ( ) 0.98 ( ) H ( ) 0.81 ( ) 1.0 ( ) I ( ) 0.99 ( ) 1.2 ( ) BGN D (0 0.33) 0.63 ( ) 0.79 ( ) F (0 0.21) 0.80 ( ) 1.0 ( ) H (0 0.14) 0.75 ( ) 0.90 ( ) I (0 0.24) 0.68 ( ) 0.84 ( ) M (0 0.21) 0.67 ( ) 0.90 ( ) Can simulate (forwards) from this model easily, so... Simulate θ from prior π Simulate data D sim from model with parameter θ Accept θ if d(d sim, D) is small Start over The art is in choosing summary statistics

5 ABC Approach Back to crypts... Priors: N U(1, 100),P U(0.9, 1.0),µ U(10 5, ) Priors: N U(1, 100),P U(0.9, 1.0),µ U(10 5, ) Summary statistics: number of unique tags, percent methylation, mean distance, number of segregating sites Back to crypts... Back to crypts... Priors: N U(1, 100),P U(0.9, 1.0),µ U(10 5, ) Summary statistics: number of unique tags, percent methylation, mean distance, number of segregating sites What is close? Small relative error: d = s i,sim s i,obs s i,obs +1 Priors: N U(1, 100),P U(0.9, 1.0),µ U(10 5, ) Summary statistics: number of unique tags, percent methylation, mean distance, number of segregating sites What is close? Small relative error d = s i,sim s i,obs s i,obs +1 Small run 755 points Posterior for N Posterior for P

6 Pierre Nicolas, INRA A Continuous-time Model Say a stem cell dies if it is replaced by two TA cells Life span of a stem cell is Exponential, mean 1/γ When cell dies, another stem cell having two stem cell offspring is copied to replace it The genealogy of stem cells looks like a coalescent Crypt contains N equal-sized subpopulations, each the progeny of a single stem cell A pair of stem cells coalesces at rate 2γ N 1 Modelling Methylation Patterns All islands unmethylated at birth of individual Independent sites model µ =(µ m,µ u ) methylation rates Context-dependent model methylation/demethylation events occur at rate that depends on number of methylated sites ɛ sequencing error rate per site per molecule Genealogy of TA cells Descendants of a Stem Cell TA cells have small, fixed number of divisions (g) Time scale of process expressed in arbitrary units g=5 Rate η of methylation process relative to time scale of TA part stem cell stage 1 stage 2 stage 3 stage 4 cells from a same stem cell progeny stage 5 dead cells removed from the crypt Take η µ Genealogy modeled as a coalescent with expansion Star-like Genealogy of Sample Parameterization and Priors N uniform g=5 λ = γ N 1 λ 1 uniform ν = µ/λ each component is log-normal(0,σ) σ exponential, mean 1 η = αν α exponential, mean 1 g uniform ɛ U(0,1)

7 MCMC algorithm Find posterior of θ =(N,λ,g,σ,ν,α,ɛ) given methylation patterns X And then a miracle occurs! MCMC Non-stationary coalescent Augmented state space: (θ, Λ,Y ) Λ is collection of genealogies of methylation patterns Y denotes methylation patterns in nodes of Λ Updating N is hard embed model in one where N is allowed to vary by ±1 between crypts Simulated Dataset I Moves around Λ via Wilson/Balding (avoids peeling) the values in Y are used to propose changes Many different types of updates are combined in this approach Run for 5,000,000 iterations, and record (θ, Λ,Y ) every 100 steps after first 500,000 No apparent convergence problems PCR: 10 days per run density N= N Simulated Dataset II Predictive assessment of model fitness density N=24 Five within-crypt statistics: number of distinct patterns number of polymorphic sites average distance between patterns number of unmethylated patterns number of singletons N Compare distribution of inter-crypt average and standard deviation with actual values

8 # distinct patterns, polymorphic sites Intercrypt average Intercrypt sd Independent methylation process ave dist, # unmethylated, # singletons Dependent methylation process # distinct patterns, polymorphic sites ave dist, # unmethylated, # singletons Intercrypt average Intercrypt sd

9 Patient X Robustness # distinct patterns, polymorphic sites ave dist, # unmethylated, # singletons Intercrypt average Intercrypt sd Posteriors: shape of genealogy Posteriors Density N Density Density g

10 Posteriors: polymorphism, given genealogy Current work µ 2.0 Nb of methylated sites Density Density Generating much bigger data sets more CpG islands, different lengths experimental issues e.g. PCR errors Getting data from other tissue types have endometrium, small intestine, hair doing blood, brain, heart Develop better markers? Model spatial structure in crypts Inference about crypts: ABC approach References Nicolas P, Shibata D & Tavaré S. Posterior inference on the stem cell population of the human colon crypt through analysis of methylation patterns. In preparation. Shibata D & Tavaré S. Counting divisions in a human somatic cell tree: how, what and why. Cell Cycle, 5, , Kim JY, Tavaré S & Shibata D. Counting human somatic cell replications: Methylation mirrors human endometrial stem cell divisions. Proc Natl Acad Sci USA, 102, , Kim JY, Siegmund KD, Tavaré S&ShibataD. Age-related human small intestine methylation: evidence for stem cell niches. BMC Medicine. 3:10, Calabrese P, Mecklin JP, Järvinen HJ, Aaltonen LA, Tavaré S & Shibata D. Numbers of mutations to different types of colorectal cancer. BMC Cancer, 5:126, Calabrese P, Tavaré S & Shibata D. Pre-tumor progression: clonal evolution of human stem cell populations. Am. J. Pathol., 164, , 2004.

On polyclonality of intestinal tumors

On polyclonality of intestinal tumors Michael A. University of Wisconsin Chaos and Complex Systems April 2006 Thanks Linda Clipson W.F. Dove Rich Halberg Stephen Stanhope Ruth Sullivan Andrew Thliveris Outline Bio Three statistical questions

More information

CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016

CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 Background A typical human cell consists of ~6 billion base pairs of DNA and ~600 million bases of mrna. It is time-consuming and expensive to

More information

Characterization of Allele-Specific Copy Number in Tumor Genomes

Characterization of Allele-Specific Copy Number in Tumor Genomes Characterization of Allele-Specific Copy Number in Tumor Genomes Hao Chen 2 Haipeng Xing 1 Nancy R. Zhang 2 1 Department of Statistics Stonybrook University of New York 2 Department of Statistics Stanford

More information

GATCGTGCACGATCTCGGCAATTCGGGATGCCGGCTCGTCACCGGTCGCT

GATCGTGCACGATCTCGGCAATTCGGGATGCCGGCTCGTCACCGGTCGCT Problem. (pts) A. (5pts) Your colleague professor Eugene Mathew Lateed generated a genome-wide DNA methylation map for normal colon cells using MRE-seq and MeDIP-seq. In an intergenic region, he found

More information

12/8/09 Comp 590/Comp Fall

12/8/09 Comp 590/Comp Fall 12/8/09 Comp 590/Comp 790-90 Fall 2009 1 One of the first, and simplest models of population genealogies was introduced by Wright (1931) and Fisher (1930). Model emphasizes transmission of genes from one

More information

APPLICATION NOTE

APPLICATION NOTE APPLICATION NOTE www.swiftbiosci.com NGS Library Preparation Produces Balanced, Comprehensive Methylome Coverage from Low Input Quantities ABSTRACT Next-generation sequencing (NGS) of bisulfite-converted

More information

I See Dead People: Gene Mapping Via Ancestral Inference

I See Dead People: Gene Mapping Via Ancestral Inference I See Dead People: Gene Mapping Via Ancestral Inference Paul Marjoram, 1 Lada Markovtsova 2 and Simon Tavaré 1,2,3 1 Department of Preventive Medicine, University of Southern California, 1540 Alcazar Street,

More information

Identifying CpG islands using hidden Markov models

Identifying CpG islands using hidden Markov models Identifying CpG islands using hidden Markov models Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Fall 2016 M. Macauley (Clemson)

More information

Identifying CpG islands using hidden Markov models

Identifying CpG islands using hidden Markov models Identifying CpG islands using hidden Markov models Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2017 M. Macauley (Clemson)

More information

Statistical Methods for Quantitative Trait Loci (QTL) Mapping

Statistical Methods for Quantitative Trait Loci (QTL) Mapping Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson

More information

Lecture 9. Eukaryotic gene regulation: DNA METHYLATION

Lecture 9. Eukaryotic gene regulation: DNA METHYLATION Lecture 9 Eukaryotic gene regulation: DNA METHYLATION Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation sequences Transcriptional

More information

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1 Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the

More information

Undergraduate research and graduate school so far

Undergraduate research and graduate school so far Undergraduate research and graduate school so far Jason Xu, Department of Statistics ACMS Seminar Jan 14, 2016 Why undergraduate research? First of all, it s fun Classroom assignments can feel boring and

More information

Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM

Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM Robert England and Monica Pettersson Pyrosequencing from Biotage 1 improves virtually every aspect of CpG methylation analysis:

More information

Genetic Basis of Development & Biotechnologies

Genetic Basis of Development & Biotechnologies Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive

More information

Introduction to Quantitative Genomics / Genetics

Introduction to Quantitative Genomics / Genetics Introduction to Quantitative Genomics / Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics September 10, 2008 Jason G. Mezey Outline History and Intuition. Statistical Framework. Current

More information

Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions

Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Why do we need statistics to study genetics and evolution?

Why do we need statistics to study genetics and evolution? Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.

More information

Population Genetics II. Bio

Population Genetics II. Bio Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT

More information

HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY

HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université

More information

Recombination, and haplotype structure

Recombination, and haplotype structure 2 The starting point We have a genome s worth of data on genetic variation Recombination, and haplotype structure Simon Myers, Gil McVean Department of Statistics, Oxford We wish to understand why the

More information

DNA METHYLATION RESEARCH TOOLS

DNA METHYLATION RESEARCH TOOLS SeqCap Epi Enrichment System Revolutionize your epigenomic research DNA METHYLATION RESEARCH TOOLS Methylated DNA The SeqCap Epi System is a set of target enrichment tools for DNA methylation assessment

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics!1 Housekeeping HW1 will be posted on course website tonight 1st lab will be on Wednesday TA office hours have

More information

Model based inference of mutation rates and selection strengths in humans and influenza. Daniel Wegmann University of Fribourg

Model based inference of mutation rates and selection strengths in humans and influenza. Daniel Wegmann University of Fribourg Model based inference of mutation rates and selection strengths in humans and influenza Daniel Wegmann University of Fribourg Influenza rapidly evolved resistance against novel drugs Weinstock & Zuccotti

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Pyrosequencing for quantitative analysis of methylation at multiple CpG sites

Pyrosequencing for quantitative analysis of methylation at multiple CpG sites Application Note for Nature Methods Pyrosequencing for quantitative analysis of methylation at multiple CpG sites Robert England and Monica Pettersson Pyrosequencing from Biotage 1 improves virtually every

More information

Summary. Introduction

Summary. Introduction doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size

More information

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases). Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are

More information

Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse

Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse Karin Fleischhanderl; Martina Fondi Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse 108 - Biotechnologie Abstract --- Keywords: Alternative

More information

Nature Genetics: doi: /ng.3254

Nature Genetics: doi: /ng.3254 Supplementary Figure 1 Comparing the inferred histories of the stairway plot and the PSMC method using simulated samples based on five models. (a) PSMC sim-1 model. (b) PSMC sim-2 model. (c) PSMC sim-3

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

Computational Models for Cell Reprogramming

Computational Models for Cell Reprogramming Computational Models for Cell Reprogramming Computational Models for Cell Reprogramming 1 Pluripotent Cells EuroStemCell web page Computational Models for Cell Reprogramming 2 Early Embryonic Development

More information

Personal and population genomics of human regulatory variation

Personal and population genomics of human regulatory variation Personal and population genomics of human regulatory variation Benjamin Vernot,, and Joshua M. Akey Department of Genome Sciences, University of Washington, Seattle, Washington 98195, USA Ting WANG 1 Brief

More information

c) Assuming he does not run another endurance race, will the steady-state populations be affected one year later? If so, explain how.

c) Assuming he does not run another endurance race, will the steady-state populations be affected one year later? If so, explain how. LS1a Fall 06 Problem Set #8 (100 points total) all questions including the (*extra*) one should be turned in 1. (18 points) Erythrocytes, mature red blood cells, are essential for transporting oxygen to

More information

Population Genetics (Learning Objectives)

Population Genetics (Learning Objectives) Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain

More information

SLiM: Simulating Evolution with Selection and Linkage

SLiM: Simulating Evolution with Selection and Linkage Genetics: Early Online, published on May 24, 2013 as 10.1534/genetics.113.152181 SLiM: Simulating Evolution with Selection and Linkage Philipp W. Messer Department of Biology, Stanford University, Stanford,

More information

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics 1 Housekeeping HW1 due on Wednesday TA office hours today at 5:20 - FXB G11 What have we studied Background Structure

More information

RecQ Helicases and GI Cancers. Mark Derleth, R3 Supervisor: Bill Grady

RecQ Helicases and GI Cancers. Mark Derleth, R3 Supervisor: Bill Grady RecQ Helicases and GI Cancers Mark Derleth, R3 Supervisor: Bill Grady Learn to perform and interpret several lab assays including PCR, MSP, and Bisulfite sequencing Personal Goal Research Goal To examine

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed

More information

Overview of Human Genetics

Overview of Human Genetics Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring

More information

Supplementary Tables. Primers and probes. Target Primer / probe sequences Chemistry Human HBB F: AACTGTGTTCACTAGCAACCTCAAA

Supplementary Tables. Primers and probes. Target Primer / probe sequences Chemistry Human HBB F: AACTGTGTTCACTAGCAACCTCAAA Supplementary Tables Primers and probes Target Primer / probe sequences Chemistry H F: AACTGTGTTCACTAGCAACCTCAAA promoter R: ACAGGGCAGTAACGGCAGACT H Downstream Actb alpha (162) alpha (162.) (Pro) (16)

More information

Great Ideas of Biology

Great Ideas of Biology Great Ideas of Biology Lecture 3 Alan Mortimer PhD Molecular Biology The Great Idea Darwinian Evolution Darwin proposed a theory of evolution based on: Species overproduce There occurs variation in the

More information

7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young

7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young 7.03 Final Exam Name: TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young Section time: There are 13 pages including this cover page Please write your name

More information

Exam 3 4/25/07. Total of 7 questions, 100 points.

Exam 3 4/25/07. Total of 7 questions, 100 points. Exam 3 4/25/07 BISC 4A P. Sengupta Total of 7 questions, 100 points. QUESTION 1. Circle the correct answer. Total of 40 points 4 points each. 1. Which of the following is typically attacked by the antibody-mediated

More information

Stem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan

Stem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan Stem Cells & Neurological Disorders Said Ismail Faculty of Medicine University of Jordan Outline: - Introduction - Types & Potency of Stem Cells - Embryonic Stem Cells - Adult Stem Cells - ipscs -Tissue

More information

Bio 311 Learning Objectives

Bio 311 Learning Objectives Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

Simple haplotype analyses in R

Simple haplotype analyses in R Simple haplotype analyses in R Benjamin French, PhD Department of Biostatistics and Epidemiology University of Pennsylvania bcfrench@upenn.edu user! 2011 University of Warwick 18 August 2011 Goals To integrate

More information

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b) Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

More information

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic

More information

NimbleGen Arrays and LightCycler 480 System: A Complete Workflow for DNA Methylation Biomarker Discovery and Validation.

NimbleGen Arrays and LightCycler 480 System: A Complete Workflow for DNA Methylation Biomarker Discovery and Validation. Cancer Research Application Note No. 9 NimbleGen Arrays and LightCycler 480 System: A Complete Workflow for DNA Methylation Biomarker Discovery and Validation Tomasz Kazimierz Wojdacz, PhD Institute of

More information

Chapter 14: Genes in Action

Chapter 14: Genes in Action Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing

Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing SureSelect Human/Mouse Methyl-Seq Kyeong Jeong PhD February 5, 2013 CAG EMEAI DGG/GSD/GFO Agilent Restricted

More information

b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.

b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus. NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops

More information

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,

More information

Physical Anthropology 1 Milner-Rose

Physical Anthropology 1 Milner-Rose Physical Anthropology 1 Milner-Rose Chapter 3 Genetics: Reproducing Life and Producing Variation Our Origins By Clark Spencer Larsen Natural Selection operates on the levels of the 1. living, behaving

More information

Molecular Evolution. COMP Fall 2010 Luay Nakhleh, Rice University

Molecular Evolution. COMP Fall 2010 Luay Nakhleh, Rice University Molecular Evolution COMP 571 - Fall 2010 Luay Nakhleh, Rice University Outline (1) The neutral theory (2) Measures of divergence and polymorphism (3) DNA sequence divergence and the molecular clock (4)

More information

QTL Mapping, MAS, and Genomic Selection

QTL Mapping, MAS, and Genomic Selection QTL Mapping, MAS, and Genomic Selection Dr. Ben Hayes Department of Primary Industries Victoria, Australia A short-course organized by Animal Breeding & Genetics Department of Animal Science Iowa State

More information

CSE /CSE6602E - Soft Computing Winter Lecture 9. Genetic Algorithms & Evolution Strategies. Guest lecturer: Xiangdong An

CSE /CSE6602E - Soft Computing Winter Lecture 9. Genetic Algorithms & Evolution Strategies. Guest lecturer: Xiangdong An CSE3 3./CSE66E - Soft Computing Winter Lecture 9 Genetic Algorithms & Evolution Strategies Guest lecturer: Xiangdong An xan@cs.yorku.ca Genetic algorithms J. Holland, Adaptation in Natural and Artificial

More information

Supplementary information ATLAS

Supplementary information ATLAS Supplementary information ATLAS Vivian Link, Athanasios Kousathanas, Krishna Veeramah, Christian Sell, Amelie Scheu and Daniel Wegmann Section 1: Complete list of functionalities Sequence data processing

More information

Genomic models in bayz

Genomic models in bayz Genomic models in bayz Luc Janss, Dec 2010 In the new bayz version the genotype data is now restricted to be 2-allelic markers (SNPs), while the modeling option have been made more general. This implements

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

4.1. Genetics as a Tool in Anthropology

4.1. Genetics as a Tool in Anthropology 4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of

More information

Additional Practice Problems for Reading Period

Additional Practice Problems for Reading Period BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Stem cells in Development

Stem cells in Development ANAT 2341 Embryology Lab 10 8 Oct 2009 Therapeutic Use of Stem Cells Practical Hurdles & Ethical Issues Stem cells in Development Blastocyst Cord blood Antonio Lee PhD Neuromuscular & Regenerative Medicine

More information

Additional levels of regulation

Additional levels of regulation Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) P. Matthias, May 26th, 2010 Additional levels of regulation Gene organization/localization Allelic exclusion AIRE: a

More information

Genetics Lecture Notes Lectures 6 9

Genetics Lecture Notes Lectures 6 9 Genetics Lecture Notes 7.03 2005 Lectures 6 9 Lecture 6 Until now our analysis of genes has focused on gene function as determined by phenotype differences brought about by different alleles or by a direct

More information

Stem cells in Development

Stem cells in Development ANAT 2341 Embryology Lab 10 8 Oct 2009 Therapeutic Use of Stem Cells Practical Hurdles & Ethical Issues Stem cells in Development Blastocyst Cord blood Antonio Lee PhD Neuromuscular & Regenerative Medicine

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

What is Epigenetics? Watch the video

What is Epigenetics? Watch the video EPIGENETICS What is Epigenetics? The study of environmental factors on gene expression in DNA. The molecule is called methylation controls when genes are turned on. Methylation turns off genes. Acetylation

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations

More information

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4

More information

Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation

Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation Learning Goals I can explain the concept of cell differentiation and cell specialization. I can explain how the cell structure relates

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

BIOTECHNOLOGY. Unit 8

BIOTECHNOLOGY. Unit 8 BIOTECHNOLOGY Unit 8 PART 1 BASIC/FUNDAMENTAL SCIENCE VS. APPLIED SCIENCE! Basic/Fundamental Science the development and establishment of information to aid our understanding of the world.! Applied Science

More information

MARKOV CHAIN MONTE CARLO SAMPLING OF GENE GENEALOGIES CONDITIONAL ON OBSERVED GENETIC DATA

MARKOV CHAIN MONTE CARLO SAMPLING OF GENE GENEALOGIES CONDITIONAL ON OBSERVED GENETIC DATA MARKOV CHAIN MONTE CARLO SAMPLING OF GENE GENEALOGIES CONDITIONAL ON OBSERVED GENETIC DATA by Kelly M. Burkett M.Sc., Simon Fraser University, 2003 B.Sc., University of Guelph, 2000, THESIS SUBMITTED IN

More information

Algorithms for Genetics: Introduction, and sources of variation

Algorithms for Genetics: Introduction, and sources of variation Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual

More information

Monitoring genetic change in wild populations of fish &wildlife

Monitoring genetic change in wild populations of fish &wildlife Monitoring genetic change in wild populations of fish &wildlife Fred W. Allendorf University of Montana Michael K. Schwartz U.S. Forest Service GeM: Genetic Monitoring First Working Group jointly funded

More information

CSE 427. Markov Models and Hidden Markov Models

CSE 427. Markov Models and Hidden Markov Models CSE 427 Markov Models and Hidden Markov Models http://upload.wikimedia.org/wikipedia/commons/b/ba/calico_cat 2 Dosage Compensation and X-Inactivation 2 copies (mom/dad) of each chromosome 1-23 Mostly,

More information

Admission Exam for the Graduate Course in Bioinformatics. November 17 th, 2017 NAME:

Admission Exam for the Graduate Course in Bioinformatics. November 17 th, 2017 NAME: 1 Admission Exam for the Graduate Course in Bioinformatics November 17 th, 2017 NAME: This exam contains 30 (thirty) questions divided in 3 (three) areas (maths/statistics, computer science, biological

More information

Supplementary Methods

Supplementary Methods Supplemental Information for funtoonorm: An improvement of the funnorm normalization method for methylation data from multiple cell or tissue types. Kathleen Oros Klein et al. Supplementary Methods funtoonorm

More information

Neutrality Test. Neutrality tests allow us to: Challenges in neutrality tests. differences. data. - Identify causes of species-specific phenotype

Neutrality Test. Neutrality tests allow us to: Challenges in neutrality tests. differences. data. - Identify causes of species-specific phenotype Neutrality Test First suggested by Kimura (1968) and King and Jukes (1969) Shift to using neutrality as a null hypothesis in positive selection and selection sweep tests Positive selection is when a new

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

More information

Happy Monday! Have out: 15.1 Notes (due today) Pen or pencil. Upcoming: 15.1 Quiz on block day 15.2 Notes due Friday (2/1)

Happy Monday! Have out: 15.1 Notes (due today) Pen or pencil. Upcoming: 15.1 Quiz on block day 15.2 Notes due Friday (2/1) Happy Monday! Have out: 15.1 Notes (due today) Pen or pencil Upcoming: 15.1 Quiz on block day 15.2 Notes due Friday (2/1) Plan for today Check 15.1 Notes Go over 15.1 Practice problems 15.1: Human Chromosomes

More information

Introduction to human genomics and genome informatics

Introduction to human genomics and genome informatics Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer

More information

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name:

Molecular Genetics FINAL page 1 of 7 Thursday, Dec. 14, 2006 Your name: Molecular Genetics FNAL page 1 of 7 1. (5 points) Here is the sequence of the template strand of a DNA fragment: GAAGTACGACGAGTTCGACCTTCTCGCGAGCGCA Which of the following would be the complementary, nontemplate,

More information

Genetic Technologies.notebook March 05, Genetic Technologies

Genetic Technologies.notebook March 05, Genetic Technologies Genetic Testing Genetic Technologies Tests can be used to diagnose disorders and/or identify those individuals with an increased risk of inheriting a disorder. Prenatal Screening A fetus may be screened

More information

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after

More information

POPULATION GENETICS. Evolution Lectures 4

POPULATION GENETICS. Evolution Lectures 4 POPULATION GENETICS Evolution Lectures 4 POPULATION GENETICS The study of the rules governing the maintenance and transmission of genetic variation in natural populations. Population: A freely interbreeding

More information

DNA METHYLATION NH 2 H 3. Solutions using bisulfite conversion and immunocapture Ideal for NGS, Sanger sequencing, Pyrosequencing, and qpcr

DNA METHYLATION NH 2 H 3. Solutions using bisulfite conversion and immunocapture Ideal for NGS, Sanger sequencing, Pyrosequencing, and qpcr NH 2 DNA METHYLATION H 3 C Solutions using bisulfite conversion and immunocapture Ideal for NGS, Sanger sequencing, Pyrosequencing, and qpcr NH 2 N N H PAGE 3 Understanding DNA Methylation DNA methylation

More information

Inference of the Properties of the Recombination Process from Whole Bacterial Genomes

Inference of the Properties of the Recombination Process from Whole Bacterial Genomes Genetics: Early Online, published on October 30, 2013 as 10.1534/genetics.113.157172 Inference of the Properties of the Recombination Process from Whole Bacterial Genomes M. Azim Ansari and Xavier Didelot

More information

Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15

Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15 Introduction to Population Genetics Spezielle Statistik in der Biomedizin WS 2014/15 What is population genetics? Describes the genetic structure and variation of populations. Causes Maintenance Changes

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Gene Expression. Chapters 11 & 12: Gene Conrtrol and DNA Technology. Cloning. Honors Biology Fig

Gene Expression. Chapters 11 & 12: Gene Conrtrol and DNA Technology. Cloning. Honors Biology Fig Chapters & : Conrtrol and Technology Honors Biology 0 Cloning Produced by asexual reproduction and so it is genetically identical to the parent st large cloned mammal: Dolly the sheep Animals that are

More information