Recent Advancements in Analytical Methods of Drug Detection
|
|
|
- Gyles Barrett
- 6 years ago
- Views:
Transcription
1 Recent Advancements in Analytical Methods of Drug Detection Mario Thevis Gene and Cell Doping Symposium Beijing, June 5/6, 2013
2
3
4 Challenges at the time accepted by anti-doping authorities and sports drug testing laboratories - use of state-of-the-art instrumentation - steep learning curve concerning analytical methodologies Methylamphetamine Hitachi RMU 6E 12s/scan LOD: 4 µg/ml Amphetamine Beckett et al. J. Pharm. Pharmacol. 1967; 19: 273
5 Main tools have always been chromatography / mass spectrometry - Monopoly of gas chromatography mass spectrometry until early 2000 *Limitation: only volatile substances can be measured / extensive derivatization required *Advantage: robustness, reproducibility, steroid profiling, IRMS
6 Main tools have always been chromatography / mass spectrometry - Availability of new generation liquid chromatography mass spectrometry instruments *Peptides, proteins, carbohydrates as well as nucleotides can be measured *commonly no / little derivatization and sample preparation required - Substantial improvements in resolution and mass accuracy
7 Abundance (%) Zentrum für Präventive Dopingforschung / Institut für Biochemie Main tools have always been chromatography / mass spectrometry Human Insulin Humalog Lispro Time (ms) Thevis et al. Forensic Sci Int. 2011
8 Complementary methods - Immunological methods (e.g. hcg, LH, hgh) - 1- and 2-D electrophoretic/immunological methods (e.g. EPO, proteases) Reichel Drug Test. Analysis 2009
9 Combined methods - Immunopurification for MS-based methodologies (e.g. insulins, GHRH, LHRH, CRH) - SPE for LC-MS/MS-based methodologies (e.g. GHRPs, TB-500, AOD-9604, LHRH) - Bottom-up targeted proteomics approaches (e.g. IGF-1, hematide) - Bottom-up targeted `RNomics approaches (e.g. sirna)
10 Currently: detection assays composed by methodology GC-MS LC-MS(/MS) Complementary
11
12 Modern mass spectrometry-based detection assay Major advantages: - Combined targeted AND non-targeted analyses - Retrospective data mining - Comprehensive coverage of most prohibited substances - Structure-based identification of related compounds - Determination of elemental composition Instrumentation and methodologies principally available in all accredited doping control laboratories!
13 Modern mass spectrometry-based detection assay Recent advances - Example Kurreck J. Angew. Chem. Int. Ed. 2009, 48: 1378
14 Small Interfering RNA (sirna) From: RNAi Therapeutics: How Likely, How Soon? Robinson R PLoS Biology Vol. 2, No. 1, e28 doi: /journal.pbio
15 Small Interfering RNA (sirna) Zentrum für Präventive Dopingforschung / Institut für Biochemie
16 WADA-supported project Model sirna designed from the myostatin mrna of Rattus norvegicus ATGATTCAAAAACCGCAAATGTATGTTTATATTTACCTGTTTGTGCTGATTGCTGCTGGCCCAG TGGATCTAAATGAGGACAGTGAGAGAGAGGCGAATGTGGAAAAAGAGGGGCTGTGTAATGCG Sense TGTGCGTGGAGACAAAACACAAGGTACTCCAGAATAGAAGCCATAAAAATTCAAATCCTCAGT AAACTCCGCCTGGAAACAGCGCCTAACATCAGCAAAGATGCTATAAGACAACTTCTGCCCAGA GCGCCTCCACTCCGGGAACTGATCGATCAGTACGACGTCCAGAGGGATGACAGCAGTGACG 5 -ACCGCAAAUGUAUGUUUAUdtdt-3 3`-dtdtUGGCGUUUACAUACAAAUA-5 GCTCTTTGGAAGATGACGATTATCACGCTACCACGGAAACAATCATTACCATGCCTACCGAGT CTGACTTTCTAATGCAAGCGGATGGAAAGCCCAAATGTTGCTTTTTTAAATTTAGCTCTAAAAT ACAGTACAACAAAGTGGTAAAGGCCCAGCTGTGGATATATCTGAGAGCCGTCAAGACTCCTAC AACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACCGG AATCCGATCTCTGAAACTTGACATGAGCCCAGGCACTGGTATTTGGCAGAGTATTGATGTGAA Antisense GACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTT GGATGAGAATGGGCATGATCTTGCTGTAACCTTCCCAGGACCAGGAGAAGATGGGCTGAATC CCTTTTTAGAAGTCAAAGTAACAGACACACCCAAGAGGTCCCGGAGAGACTTTGGGCTTGACT GTGATGAACACTCCACGGAATCGCGGTGCTGTCGCTACCCCCTCACGGTCGATTTCGAAGCC TTTGGATGGGACTGGATTATTGCACCCAAAAGATATAAGGCTAATTACTGCTCTGGAGAGTGT GAATTTGTGTTCTTACAAAAATATCCGCATACTCATCTTGTGCACCAAGCAAACCCCAGAGGCT CGGCAGGCCCTTGCTGCACGCCAACAAAAATGTCTCCCATTAATATGCTATATTTTAATGGCAA AGAACAAATAATATATGGGAAAATTCCAGCCATGGTAGTAGACCGGTGTGGGTGCTCGTGA From NCBI Reference Sequence: NM_
17 Selection of RNA nucleotide modifications Kurreck J. Angew. Chem. Int. Ed. 2009, 48: 1378
18 In vivo experiments Rats (Rattus norvegicus, WISTAR) treated with 1 mg/kg of sirna (0.33mg/rat) Three rats per sirna, control group treated with water Treatment by a single i.v. administration Sample collection of urine and plasma after 4, 9, 24, 33 and 48 hours Free access to food and water
19 -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 add ethanol mirna purification spin columns from Invitrogen (Karlsruhe, Germany) load sample column 2 wash Hydrolysis with 0.1 M NaOH elute with water LC-HRMS *Kohler M, Thomas A, Walpurgis K, Schänzer W, Thevis M. Anal Bioanal Chem. 2010;398:
20 Hydrolysed rat urine sample (treated with sirna 1 (4h)) RT: 2.05 m/z= Gmps RT: 3.47 NL: 2.21E5 S P O O RT: 1.52 m/z= m/z= RT: 2.31 Umps RT: 3.47 NL: 1.33E5 NL: 6.34E Amps m/z m/z= A 2`-OMe U 2`-OMe A RT: 4.68 NL: 6.89E5 m/z= A 2 -F C 2 -F A RT: 4.68 NL: 7.57E4 m/z= GG RT: 4.71 NL: 4.05E Time (min)
21 Hydrolysed rat urine sample (control group (4h)) m/z= NL: 0 Gmps m/z= NL: 5.71E3 Umps m/z= NL: 0 Amps m/z= NL: 0 A 2`-OMe U 2`-OMe A m/z= NL: 0 A 2 -F C 2 -F A m/z= NL: 0 GG
22 RT: SM: 9G RT: 2.92 RT: 2.46 RT: 5.76 RT: 5.71 RT: Time (min) RT: 9.62 NL: 1.61E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 8.48E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 1.09E5 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 4.99E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww Zentrum für Präventive Dopingforschung / Institut für Biochemie -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 mirna purification add ethanol spin columns from Invitrogen (Karlsruhe, Germany) load sample column 2 wash Hydrolysis with 0.1 M NaOH LC-HRMS elute with water LC-HRMS Relative Abundance
23 Relative Abundance Relative Abundance Zentrum für Präventive Dopingforschung / Institut für Biochemie LC-HRMS analysis of intact sirna from rat urine (treated with sirna 1 (4h)) m/z= F: RT: 5.44 AC M CGC M AApAUp NL: 1.46E5 m/z= F: RT: 5.45 AC M CGC M AApAUpGUAUGpUpUpUp NL: 7.25E4 m/z= F: RT: 5.46 A*U*AAA *F C *F AUA~CAUUUGCGGU NL: 4.28E5 m/z= F: RT: 5.46 AC M CGC M AApAUpGUAUGpUpUp NL: 3.75E Time (min) z=4 AC M CGC M AApAUpGUAUGpUpUp AC M CGC M AApAUp A*U*AAA *F C *F AUA~CAUUUGCGGU z= z= z= z= z= z= z=3 z=3 z= z=3 z= m/z m/z
24 RT: SM: 9G RT: 2.92 RT: 2.46 RT: 5.76 RT: 5.71 RT: Time (min) RT: 9.62 NL: 1.61E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 8.48E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 1.09E5 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 4.99E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww Zentrum für Präventive Dopingforschung / Institut für Biochemie -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 add ethanol SDS- PAGE load sample column 2 wash Hydrolysis with 0.1 M NaOH LC-HRMS elute with water LC-HRMS Relative Abundance
25 SDS-Page analysis - Denaturing polyacrylamide TBE-Urea Gels (15%) - 5 µl of sample + 5 µl of sample buffer - Heat for 3 min at 70 C V const, 75 min - Stain with SyBr-Safe - Scan with a Typhoon fluorescence scanner (GE, 488 nm, Filter 520 nm BP 40) Rat #7 Rat #11 4 h 9 h 24 h 33 h 4 h 9 h 24 h 33 h Std.
26 RT: SM: 9G RT: 2.92 RT: 2.46 RT: 5.76 RT: 5.71 RT: Time (min) RT: 9.62 NL: 1.61E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 8.48E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 1.09E5 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww NL: 4.99E4 m/z= F: FTMS - p ESI Full ms [ ] MS ICIS _Gel1212_RNAseA_ RNA1ww Zentrum für Präventive Dopingforschung / Institut für Biochemie -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 add ethanol SDS- PAGE Digest (RNAse T1, A ) LC-HR-MS/MS load sample column 2 Database search wash elute with water Hydrolysis with 0.1 M NaOH LC-HRMS Relative Abundance LC-HRMS
27 Experimental RNomics Digest (RNAse T1, A ) Digestion conditions: -RNA bands were excised -Cut into small pieces -Digested with RNAse (T1 or A) for 1 h at 37 C -Centrifugation -Supernatant into fresh tube LC-HR-MS/MS Database Search MS conditions -Full scan analysis in negative mode (Res FWHM) -Data dependent MS/MS triggering, if charge state (m/z) is < -1 -File converting Not for modified sirna Identification of anti-myostatin RNA
28 Validation results: Sense 1 Antisense 1 Specificity No interfering signals (n = 10) Precision (n=6) 20 % 18 % Recovery (n=6) 18 % 17 % Limit of detection ~25 pmol/ml of urine ~25 pmol/ml of urine Linearity y= x , R=0.992 y = x , R=0.992
29 Conclusion - Modern doping control analytical assays include GC-MS(/MS), LC-MS(/MS), electrophoretic, immunological, and combined approaches - Comprehensive coverage of doping agents given loopholes still present - State-of-the-art equipment allows today detecting the administration of sirna as one of the prohibited gene doping strategies - Continuous improvement of analytical methods and their implementation in routine doping controls essential
The Agilent Total RNA Isolation Kit
Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation
Rapid Extraction of Therapeutic Oligonucleotides from Primary Tissues for LC/ MS Analysis Using Clarity OTX, an Oligonucleotide Extraction Cartridge
Rapid Extraction of Therapeutic Oligonucleotides from Primary Tissues for LC/ MS Analysis Using Clarity OTX, an Oligonucleotide Extraction Cartridge G. Scott*, H. Gaus #, B. Rivera*, and M. McGinley* *Phenomenex,
Proteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
Simultaneous Quantitation of a Monoclonal Antibody and Two Proteins in Human Plasma by High Resolution and Accurate Mass Measurements
Simultaneous Quantitation of a Monoclonal Antibody and Two Proteins in Human Plasma by High Resolution and Accurate Mass Measurements Paul-Gerhard Lassahn 1, Kai Scheffler 2, Myriam Demant 3, Nathanael
Application of RNA Interference to Anti-Doping. Matthew Fedoruk, Ph.D. Gene & Cell Doping Symposium 2013, Beijing, China
Application of RNA Interference to Anti-Doping Matthew Fedoruk, Ph.D. Gene & Cell Doping Symposium 2013, Beijing, China From Plants to Worms to Humans: Discovery and Mechanism of RNAi Alnylam Pharmaceuticals
John Mehl, Bogdan Sleczka, Eugene Ciccimaro, Christian Caporuscio, Ekaterina Deyanova, Richard Huang, Timothy Olah, Celia D Arienzo
Bioanalytical strategies for the quantitation of in-vivo site specific modifications of therapeutic antibodies in early discovery cyno studies using IP-LC-MS John Mehl, Bogdan Sleczka, Eugene Ciccimaro,
Thermo Scientific Peptide Mapping Workflows. Upgrade Your Maps. Fast, confident and more reliable peptide mapping.
Thermo Scientific Peptide Mapping Workflows Upgrade Your Maps Fast, confident and more reliable peptide mapping. Smarter Navigation... Peptide mapping is a core analytic in biotherapeutic development.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
mircute mirna Isolation Kit
mircute mirna Isolation Kit For purification of total RNA, including mirna, from cells, tissues and animal blood www.tiangen.com/en DP121221 mircute mirna Isolation Kit Kit Contents (Spin Column) Cat.
A Highly Accurate Mass Profiling Approach to Protein Biomarker Discovery Using HPLC-Chip/ MS-Enabled ESI-TOF MS
Application Note PROTEOMICS METABOLOMICS GENOMICS INFORMATICS GLYILEVALCYSGLUGLNALASERLEUASPARG CYSVALLYSPROLYSPHETYRTHRLEUHISLYS A Highly Accurate Mass Profiling Approach to Protein Biomarker Discovery
ProteoExtract Protein Precipitation Kit Cat. No
User Protocol 539180 Rev. 12-October-06 JSW ProteoExtract Protein Precipitation Kit Cat. No. 539180 Note that this user protocol is not lot-specific and is representative of the current specifications
Kit Specifications 45 g. 45 g of RNA 8 L
RNA Clean-Up and Concentration Micro-Elute Kit Product # 61000 Product Insert Norgen s RNA Clean-Up and Concentration Micro-Elution Kit provides a rapid method for the purification, cleanup and concentration
quantification of an oligonucleotide
Challenges with a LCMS method for quantification of an oligonucleotide Lieve Dillen Regulated Bioanalysis Pictured above: IV absorption utline Introduction to the compound Anticipated challenges LC-MS/MS
How discovery activities can influence metabolic profiling in the regulatory space? C. DELATOUR EBF, 25 th September 2015
How discovery activities can influence metabolic profiling in the regulatory space? C. DELATOUR EBF, 25 th September 2015 Outline 2 ן Background - Objectives - Shift in Workflow - Metabolite in safety
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Plant microrna Purification Kit Product # 54700
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plant microrna Purification Kit Product # 54700 Product Insert
LC/MS. Why is it the fastest growing analytical technique?
LC/MS Why is it the fastest growing analytical technique? Discussion topics Evolution of LC/MS Advantages of API Why should I use LC/MS? LC/MS markets Evolution of LC/MS interfaces 1970s to Present Moving
Supporting Information
Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a
Increasing Throughput and Efficiency with Exactive LC/MS and Triple Quadrupole LC/MS/MS
Increasing Throughput and Efficiency with Exactive LC/MS and Triple Quadrupole LC/MS/MS Nicholas Duczak Thermo Scientific Annual Mass Spectrometry Users Meeting Somerset, NJ October 12th, 2011 Lead Finding
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets
Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
Synthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis
Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis 2D gel electrophoresis remains a dominant technique in proteomics. Obtaining high quality gels requires careful and tedious
Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
ProMass HR Applications!
ProMass HR Applications! ProMass HR Features Ø ProMass HR includes features for high resolution data processing. Ø ProMass HR includes the standard ProMass deconvolution algorithm as well as the full Positive
Introduction to Proteomics
Introduction to Proteomics Tasso Miliotis, PhD AstraZeneca R&D Gothenburg Translational Sciences tasso.miliotis@astrazeneca.com 1 Site Management Mölndal May 2008 Outline Drug Discovery AZ R&D Sample Preparation
Quantification of Host Cell Protein Impurities Using the Agilent 1290 Infinity II LC Coupled with the 6495B Triple Quadrupole LC/MS System
Application Note Biotherapeutics Quantification of Host Cell Protein Impurities Using the Agilent 9 Infinity II LC Coupled with the 6495B Triple Quadrupole LC/MS System Authors Linfeng Wu and Yanan Yang
DNA Visualizer Extraction Kit
DNA Visualizer Extraction Kit Catalog Number D0006 50 reactions Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
Development of an Immunoprecipitation and LC-MS/MS based Method for Quantifying the 105 kda Recombinant Protein SXN in Plasma.
Development of an Immunoprecipitation and LC-MS/MS based Method for Quantifying the 105 kda Recombinant Protein SXN101959 in Plasma. Richard Kay Principal Scientist, Bioanalytical Sciences, Quotient Bioresearch
Strategies in proteomics
Strategies in proteomics Systems biology - understand cellpathways, network, and complex interacting (includes Genomics, Proteomics, Metabolomics..) Biological processes - characterize protein complexes,
Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
XactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
Accelerate mab Characterization Using Automated Sample Prep
Accelerate mab Characterization Using Automated Sample Prep David Knorr, Ph.D. Automation Solutions Ning Tang, Ph.D. LC/MS 15 February 2012 Page 1 Protein Sample Processing Workflows Glycan Profiling Biological
rapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF
rapiflex Designed for Molecules that Matter. Innovation with Integrity MALDI TOF/TOF rapiflex TM The first MALDI-TOF/TOF that adapts to your needs. The rapiflex is the most advanced MALDI TOF/TOF system
Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
Strategies for Quantitative Proteomics. Atelier "Protéomique Quantitative" La Grande Motte, France - June 26, 2007
Strategies for Quantitative Proteomics Atelier "Protéomique Quantitative", France - June 26, 2007 Bruno Domon, Ph.D. Institut of Molecular Systems Biology ETH Zurich Zürich, Switzerland OUTLINE Introduction
State of the art in chromatographic analysis (LC MS/MS) of steroidal estrogens in surface water Status and Outlook
Schweizerisches Zentrum für angewandte Ökotoxikologie Centre Suisse d écotoxicologie appliquée Eawag-EPFL State of the art in chromatographic analysis (LC MS/MS) of steroidal estrogens in surface water
Lecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry
Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.
Component. Buffer RL
GenElute FFPE RNA Purification Catalog number RNB400 Product Description Sigma s GenElute FFPE RNA Purification Kit provides a rapid method for the isolation and purification of total RNA (including microrna)
User Rules & Regulations Core Facility for Mass Spectrometry and Proteomics (CFMP) at the Centre for Molecular Biology of Heidelberg University (ZMBH)
User Rules & Regulations Core Facility for Mass Spectrometry and Proteomics (CFMP) at the Centre for Molecular Biology of Heidelberg University (ZMBH) Accepted on 30. January 2017 1 Definition and aims
Separation of Native Monoclonal Antibodies and Identification of Charge Variants:
Separation of Native Monoclonal Antibodies and Identification of Charge Variants: Teamwork of the Agilent 31 OFFGEL Fractionator, Agilent 21 Bioanalyzer and Agilent LC/MS Systems Application Note Biosimilar
Preparing Samples for Analysis of Small RNA
Preparing Samples for Analysis of Small RNA Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE Gel 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA Adapters 15
Bioanalytical LC-MS of monoclonal antibody therapeutics
Bioanalytical LC-MS of monoclonal antibody therapeutics William D van Dongen, product manager pharma bioanalysis small molecules immunogenicity 40 years experience in bioanalysis Bioanalytical Expertise
Ligand Binding Mass Spectrometric Immunoassay (LB-MSIA ) Workflow with Deglycosylation for Therapeutic Antibodies
Ligand Binding Mass Spectrometric Immunoassay (LB-MSIA ) Workflow with Deglycosylation for Therapeutic Antibodies Kwasi Antwi, Amanda Ribar, Urban A. Kiernan, and Eric E. Niederkofler, Thermo Fisher Scientific,
Alternative to 2D gel electrophoresis OFFGEL electrophoresis combined with high-sensitivity on-chip protein detection.
Alternative to 2D gel electrophoresis OFFGEL electrophoresis combined with high-sensitivity on-chip protein detection Application Note Christian Wenz Andreas Rüfer Abstract Agilent Equipment Agilent 3100
for water and beverage analysis
Thermo Scientific EQuan MAX Plus Systems Automated, high-throughput LC-MS solutions for water and beverage analysis Pesticides Pharmaceuticals Personal care products Endocrine disruptors Perfluorinated
FirePlex mirna Assay. Multiplex microrna profiling from low sample inputs
FirePlex mirna Assay Multiplex microrna profiling from low sample inputs Abstract We introduce a new assay for multiplex microrna (mirna) discovery and verification that enables simultaneous profiling
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
LavaDigest Protease Monitoring Kit
LavaDigest Protease Monitoring Kit Ordering LP-031020 LavaDigest protease monitoring kit for up to 2000 assays Order from http://www.fluorotechnics.com.au L.avaDigest Protocol March 2013 Content 2 LavaDigest
New Approaches to Quantitative Proteomics Analysis
New Approaches to Quantitative Proteomics Analysis Chris Hodgkins, Market Development Manager, SCIEX ANZ 2 nd November, 2017 Who is SCIEX? Founded by Dr. Barry French & others: University of Toronto Introduced
Sean M. McCarthy and Martin Gilar Waters Corporation, Milford, MA, U.S. INTRODUCTION EXPERIMENTAL RESULTS AND DISCUSSION
UPLC Separation of DNA Duplexes Sean M. McCarthy and Martin Gilar Waters Corporation, Milford, MA, U.S. INTRODUCTION Over the past 2 years there has been a considerable amount of effort focused on the
Kit Specifications 650 L 100 L. Product # (50 preps)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Water RNA/DNA Purification Kit Product # 26480 Product Insert
New techniques for extraction, separation, and detection of EPO Dr. Zhen Liu
Developments and challenges in the detection of doping with peptide hormones and related substances New techniques for extraction, separation, and detection of EPO Dr. Zhen Liu State Key Lab of Analytical
Comparability Analysis of Protein Therapeutics by Bottom-Up LC-MS with Stable Isotope-Tagged Reference Standards
Comparability Analysis of Protein Therapeutics by Bottom-Up LC-MS with Stable Isotope-Tagged Reference Standards 16 September 2011 Abbott Bioresearch Center, Worcester, MA USA Manuilov, A. V., C. H. Radziejewski
Plasma/Serum RNA/DNA Purification Mini Kit Product# 55200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plasma/Serum RNA/DNA Purification Mini Kit Product# 55200 Product
Rapid Peptide Catabolite ID using the SCIEX Routine Biotransform Solution
Rapid Peptide Catabolite ID using the SCIEX Routine Biotransform Solution Rapidly Identify Major Catabolites with the SCIEX X500R QTOF System and MetabolitePilot TM 2.0 Software Ian Moore and Jinal Patel
Appendix. Table of contents
Appendix Table of contents 1. Appendix figures 2. Legends of Appendix figures 3. References Appendix Figure S1 -Tub STIL (41) DVFFYQADDEHYIPR (55) (64) AVLLDLEPR (72) 1 451aa (1071) YLNENQLSQLSVTR (1084)
Universal Solution for Monoclonal Antibody Quantification in Biological Fluids Using Trap-Elute MicroLC-MS Method
Universal Solution for Monoclonal Antibody Quantification in Biological Fluids Using Trap-Elute MicroLC-MS Method Featuring the SCIEX QTRAP 6500+ LC-MS/MS System with OptiFlow Turbo V source and M5 MicroLC
AmpliScribe T7-Flash Transcription Kit
AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction
NEBNext RNase III RNA Fragmentation Module
SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2
SunScript TM One Step RT-qPCR Kit
INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting
ZipChip TM. Microfluidic CE-ESI Biotherapeutics CE-ESI-MS Applications. Please visit us at
ZipChip TM Microfluidic CE-ESI Biotherapeutics CE-ESI-MS Applications Please visit us at http://www.908devices.com/ // Actionable Intelligence HPMS & On-board Analytics / Slide 1 June 2016 // ZipChip CE-ESI
TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
3-Input Majority Logic Gate and Multiple Input Logic Circuit Based on DNA Strand Displacement
Supporting Information for 3-Input Majority Logic Gate and Multiple Input Logic Circuit Based on DNA Strand Displacement Wei Li, Yang Yang, Hao Yan, Yan Liu Department of Chemistry and Biochemistry and
Plant/Fungi Total RNA Purification Kit Product # 25800, 31350, 25850
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plant/Fungi Total RNA Purification Kit Product # 25800, 31350,
E.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps
E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3
Methylamp Coupled DNA Isolation & Modification Kit
Methylamp Coupled DNA Isolation & Modification Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The Methylamp Coupled DNA Isolation & Modification Kit is very suitable for methylation research
Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail. Marc C Morais et al., Nature Structural Biology 2003
Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail Marc C Morais et al., Nature Structural Biology 2003 Free scaffold 13+ 10 min 3 min 1 min 40 sec 100 % 0 100 % 0 100 % 0 100 % 0 Partially
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
mirna from serum and plasma samples
REFERENCE GUIDE mirna from serum and plasma samples Publication Number MAN0017497 Revision A.0 Introduction... 1 Use of serum or plasma... 2 Sample collection and handling... 2 Sample storage... 4 Extraction
Thermo Scientific Mass Spectrometric Immunoassay (MSIA) Pipette Tips. Next generation immunoaffinity. Robust quantitative platform
Thermo Scientific Mass Spectrometric Immunoassay (MSIA) Pipette Tips Next generation immunoaffinity Robust quantitative platform Immunoaffinity sample preparation Thermo Scientific Mass Spectrometric Immunoassay
Preparing Samples for Analysis of Small RNA
Preparing Samples for Analysis of Small RNA FOR RESEARCH ONLY Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA
N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF
N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF Application Note Authors Xianming Liu, Wei Zhang, Yi Du, Sheng Yin, Hong Que, and Weichang Zhou WuXi AppTec iopharmaceuticals
Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)
Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with
HOST CELL PROTEIN & BIOPROCESSING REAGENT DEVELOPMENT
HOST CELL PROTEIN & BIOPROCESSING REAGENT DEVELOPMENT INTRODUCTION Biopharmaceuticals require products to be free of residual host cell protein (HCP) contaminants from the bioprocessing workflow. To evaluate
11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
The Production of a Recombinant Biotechnology Product. Chapter 8
The Production of a Recombinant Biotechnology Product Chapter 8 Objectives Give a basic overview of genetic engineering. Describe the processes involved in isolating a piece DNA of interest Mass producing
Improving Sensitivity in Bioanalysis using Trap-and-Elute MicroLC-MS
Improving Sensitivity in Bioanalysis using Trap-and-Elute MicroLC-MS Using the SCIEX M3 MicroLC system for Increased Sensitivity in Antibody Quantitation Remco van Soest and Lei Xiong SCIEX, Redwood City,
Overview. Tools for Protein Sample Preparation, 2-D Electrophoresis, and Imaging and Analysis
Expression Proteomics // Tools for Protein Separation and Analysis www.expressionproteomics.com 1 2 3 4 Overview Tools for Protein Sample Preparation, 2-D Electrophoresis, and Imaging and Analysis overview
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
RNA Clean-Up and Concentration Kit Product # 23600, 43200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product
Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3. Supplementary Figure S4
Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary Figure S7 Supplementary Figure S8 Supplementary
This is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
Proteomics and Cancer
Proteomics and Cancer Japan Society for the Promotion of Science (JSPS) Science Dialogue Program at Niitsu Senior High School Niitsu, Niigata September 4th 2006 Vladimir Valera, M.D, PhD JSPS Postdoctoral
Mimetic Blue Affinity Adsorbents Mimetic Blue 1 P6XL, Mimetic Blue SA P6XL Mimetic Blue SA HL P6XL, Mimetic Blue ELISA Kit
Mimetic Blue Affinity Adsorbents Mimetic Blue 1 P6XL, Mimetic Blue SA P6XL Mimetic Blue SA HL P6XL, Mimetic Blue ELISA Kit WWW.PROMETICBIOSCIENCES.COM/PRODUCT DATASHEET Mimetic Blue affinity chromatography
HOOK 6X His Protein Spin Purification (Bacteria)
222PR 03 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK 6X His Protein Spin Purification (Bacteria) For the Purification of His Tagged
Formation and Determination of Endogenous Methylated. Nucleotides in Mammals by Chemical Labeling coupled with. Mass Spectrometry Analysis
Supporting Information For Formation and Determination of Endogenous Methylated Nucleotides in Mammals by Chemical Labeling coupled with Mass Spectrometry Analysis Huan Zeng, 1, Chu-Bo Qi, 1,2, Ting Liu,
Streptavidin Mag Sepharose
GE Healthcare Life Sciences Data file 28-9921-05 AB Protein sample preparation Streptavidin Mag Sepharose Streptavidin Mag Sepharose (Fig 1) is a magnetic bead for simple and efficient enrichment of target
Improving Retention Time Precision and Chromatography of Early Eluting Peptides with Acetonitrile/Water Blends as Solvent B
Improving Retention Time Precision and Chromatography of Early Eluting Peptides with Acetonitrile/Water Blends as Solvent B Stephan Meding, Aran Paulus, and Remco Swart ¹Thermo Fisher Scientific, Germering,
Expand Your Research with Metabolomics and Proteomics. Christine Miller Omics Market Manager ASMS 2017
Expand Your Research with Metabolomics and Proteomics Christine Miller Omics Market Manager ASMS 2017 New Additions to Agilent Omics Workflows Acquisition Ion Mobility Q-TOF IM All Ions MS/MS Find Features
RNAsimple Total RNA Kit
RNAsimple Total RNA Kit For purification of high pure total RNA www.tiangen.com/en RP110413 Kit Contents Storage RNAsimple Total RNA Kit Cat. no. DP419 Contents Buffer RZ Buffer RD Buffer RW RNase-Free
1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
Towards an in vivo Stability Assay for ADCs and Their Metabolites in Serum by Affinity Capture LC-MS
Towards an in vivo Stability Assay for ADCs and Their Metabolites in Serum by Affinity Capture LC-MS mz (@Dr_mz13), PhD 11-Feb-2013 One of the challenges of ADCs includes the development of a method to
SurePrep Plant/Fungi Total RNA Purification Kit
1 Reagent Lane, Fair Lawn, NJ 07410 Phone: (201)-796-7100 Fa x: (201) 703-3159 Email: chem.techinfo@thermofisher.com SurePrep Plant/Fungi Total RNA Purification Kit Product Cat. # BP2817-50 Instruction
Application Note. Authors. Abstract
Automated, High Precision Tryptic Digestion and SISCAPA-MS Quantification of Human Plasma Proteins Using the Agilent Bravo Automated Liquid Handling Platform Application Note Authors Morteza Razavi, N.