GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus

Size: px
Start display at page:

Download "GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus"

Transcription

1 GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus T. Thekke-Veetil 1, S. Sabanadzovic 2, K.e. Keller 3, R.R. Martin 3, I.e. Tzanetakis 1* 1 Department of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701, USA; 2 Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS 39762, USA; 3 USDA-ARS, Corvallis, OR 97330, USA. itzaneta@uark.edu abstract Blackberry yellow vein disease (BYVD) is an important viral disease in blackberry. Recently, several new viruses associated with BYVD have been identified, one of which is the subject of this communication. Experiments were conducted to characterize the virus, determine its geographic distribution and population structure in the US. Phylogenetic analysis revealed the close relationship of the virus with Grapevine leafroll associated virus-3, the type member of genus Ampelovirus in the family Closteroviridae. Analysis of nucleotide and amino acid diversities among the US isolates revealed considerable variations in all three regions studied. Fig.1. Symptoms observed on ampelovirus-infected blackberry plant. Introduction Blackberry yellow vein disease (BYVD) is the most important disease in fresh market blackberries in the southern United States. Symptoms include oak-leaf patterns, irregular chlorosis, line patterns, yellowing of veins, and ultimately dieback resulting in substantial yield losses (Susaimuthu et al., 2006; 2007). Symptom onset is associated with the presence of multiple viruses and often single infections are symptomless. Blackberry yellow vein-associated virus, Blackberry virus 371

2 Petria -22 nd international ConFerenCe on Virus and other trandmissible diseases of Fruit CroPs Y, Beet pseudo-yellows virus, Blackberry chlorotic ringspot virus, Blackberry virus E, Blackberry virus S, Impatiens necrotic spot virus, and Tobacco ringspot virus have often been found associated with BYVD (Martin et al., 2012). A new closterovirus was identified in symptomatic plants in Mississippi (Sabanadzovic et al., 2011) (Fig. 1). This paper discusses the molecular characterization and population structure of this virus. Materials and Methods Identification and characterization: Double-stranded RNA from infected plants was extracted with protocol involving selective chromatography (Valverde, 1990), and used as a template for further molecular work. Virus sequences were obtained by random-primed cloning and next-generation sequencing using the Illumina platform as previously described (Laney et al., 2011). Terminal sequences of the virus genome were determined by 5 and 3 RACE (Invitrogen). The relationship of the virus with other members of the family Closteroviridae was determined after phylogenetic analysis of heat shock protein 70 homolog (HSP70h) sequences using MEGA5 software (Tamura et al., 2011). Genetic diversity: Blackberry samples collected between were screened for the presence of the virus and total of twenty five isolates obtained from Arkansas, Georgia, Mississippi, North and South Carolina were used for the diversity analysis. Total nucleic acids were extracted from 50 mg tissue (Tzanetakis et al., 2007), and reverse transcribed using random primers. Primers were designed to amplify ~1,200 nucleotide (nt) region of cdnas in polyprotein (region between methyltransferase and helicase domains), HSP70h, and minor coat protein (CPm) genes (Tab. 1) using Phire Hot Start II DNA Polymerase (New England Biolabs) by two-step PCR. The samples were subjected to an initial denaturation at 98 0 C for 30 s, followed by 35 cycles of denaturation at 98 0 C for 5 s and annealing and extension at 72 0 C for 30 s, and a final extension at 72 0 C for 1 min. The PCR products were purified using the GeneJet PCR purification kit (Fermentas Life Sciences), added A overhang using Taq polymerase, purified, and cloned into Topo 2.1 vector according to manufacturer s protocol (TOPO-TA cloning Kit, Invitrogen). The -select chemically competent Escherichia coli cells (Bioline) were transformed with the cloning mixture according to the protocol and transformed colonies were grown on Luria-Bertani (LB) plate containing 50 µg/ µl Kanamycin and 40 µm Bromo-chloro-indolyl-gaactopyranoside (X-gal). The white colonies were screened by colony PCRs with gene-specific primers and Taq DNA polymerase (GenScript). Thermal cycler program consisted of 3 min initial denaturation step at 94 0 C, followed by 40 cycles of 30 s denaturation at 94 0 C, 20 s annealing at 54 0 C and 1 min 30 s extension at 72 0 C. The recombinant colonies were sequenced at the Functional Biosciences facilities at Wisconsin with M13 forward and reverse primers. Sequences were edited using the Sequence Scanner Software v1.0 (Applied Biosystems) and assembled by CAP3 (Huang and Madan, 1999). Variation in nt and predicted amino acids (aa) sequences were determined with ClustalW. 372

3 Tab. 1 - Primer sequences used for the amplification of genes for diversity analysis. Primer name Primer sequences Position CPm-1F 5 - GACGAATTCGAGGAGAGAGAGGCTT-3 + strand CPm-2F 5 - AGGGTAGACAATTTTTCGCGGTTGT-3 + strand CPm-1R 5 - AGGCACTGGCCAAAGCGTTAGC-3 - strand CPm-2R 5 - ACTGCTCCTTCCCCTCACCCTTT-3 - strand CPm-3R 5 - TATACTGCTCCTTCCCCTCACCCT-3 - strand HSP 70h-1F 5 - GGACGTGGGCATAGACTTCGG -3 + strand HSP 70h-2F 5 - TGCTATTCGGCGTCGGGTGC-3 + strand HSP 70h-3F 5 - TGCAGGAGGTTGTACCAGGG-3 + strand HSP 70h-4F 5 - CAGGGTGGCAGGTAGCATCTT -3 + strand HSP 70h-1R 5 - CTGAACGTTAGTTCGTTGAGGTAACTACGA -3 - strand HSP 70h-2R 5 - CGTACTTAACCGTATCCGTTCTCTTGCC-3 - strand HSP 70h-3R 5 - TCAGCGTCCCATCGAGCGAT-3 - strand HSP 70h-4R 5 - GCCATTGATAGTGACGCTCAGCG -3 - strand Polyprotein-1F 5 - TGGTTGTCCCTTTGCGGTCAC-3 + strand Polyprotein-2F 5 - TCGGGCTGTTGTCAGTGGAT-3 + strand Polyprotein-3F 5 - GGTGTCTTTCGGCGATCTTGTGG-3 + strand Polyprotein-1R 5 - CTAGCTAAGCCAGCAACACCCAC-3 - strand Polyprotein-2R 5 - AAGTCTGACCTCCCCACTCC-3 - strand Polyprotein-3R 5 - CACCGATGCAGGGAGAAGTCTG-3 - strand Polyprotein-4R 5 - CAACTCCCCACACCGATGCAGG-3 - strand HSP70h- Heat shock protein 70 homolog CPm- minor coat protein Results and Discussion Genome sequence analysis revealed that the new virus belongs to the genus Ampelovirus, family Closteroviridae. The genome is approximately 18.5 kb long and resembles Grapevine leafroll-associated virus 3 (GLRaV-3) in organization. ORF 1a contains conserved domains of protease, methyl transferase, AlkB, and helicase, whereas ORF 1b encodes the RNA-dependent RNA polymerase (RdRp). ORFs 2-7 encode two small proteins with transmembrane motifs, HSP70h, coat protein homolog (CPh), major coat protein (CP), and CPm, respectively. A putative RNA silencing protein is encoded by ORF 8. The proteins encoded by the 3 -proximal ORFs do not show significant similarity to known viral proteins. Phylogenetic tree constructed using the sequences of HSP70h showed the close relationship of the new virus with members of the Ampelovirus Subgroup II, and in particular with GLRaV-3 (Fig. 2). The RdRp is 65% identical with the GLRaV-3 ortholog, whereas the CP (34 kda) and CPm (54 kda) are 53% and 34% identical with their counterparts in GLRaV-3 and 373

4 Petria -22 nd international ConFerenCe on Virus and other trandmissible diseases of Fruit CroPs include conserved motifs at their C-termini. Screening of samples collected from southern US indicated the presence of the virus in five states. Sequence analysis of three selected genes (approximately 20% of the total genome) revealed significant diversity among the isolates studied. The polyprotein region was more divergent than the other two studied genes, reaching up to 23% diversity in both the nt and aa (data not shown). For the HSP70h, identity Fig. 2 - Phylogenetic tree of members of the Closteroviridae based on heat shock protein 70 homolog (HSP70h) amino acid sequences. The new virus clearly clusters with members of the genus Ampelovirus. among studied isolates was % in the nt and % in the predicted aa sequences. The CPm nt sequences had % nt identities compared to the % aa conservation. Our study revealed considerable intra-species variations among US isolates of the new blackberry ampelovirus in all genome areas studied. Replication of RNA genomes are error prone and closteroviruses have relatively large genomes. Also, plant RNA viruses especially those infecting clonally propagated perennial crops can accrue considerable mutations over time. These, along with recombinations, would explain the high variation rate observed among the isolates studied. Blackberry is vegetatively propagated and asymptomatic plants that harbor some of the viruses associated with BYVD could possibly be used for propagation in the nurseries. This could facilitate the introduction and spread of the disease to newer areas. Hence, it is important to develop detection primers in consideration with the variation existing among the virus population to avoid false negatives during quarantine screenings. Sensitive and 374

5 universal conventional and real-time PCR detection assays will be developed based on the sequence information obtained from this study to detect a wide range of isolates which would in turn minimize movement of the virus via propagative material. acknowledgements The authors acknowledge the financial support provided by NIFA-SCRI ( ), USDA- NCPN ( ) and Special Research Initiative Program of the MAFES, Mississippi State University. References huang X., a. madan, CAP3: A DNA sequence assembly program. Genome Research, 9, laney, a.g., k.e. keller, r.r. martin, i.e. tzanetakis, A discovery 70 years in the making: Characterization of the Rose rosette virus. Journal of General Virology, 92, martin, r.r., s. macfarlane, s. sabanadzovic, d. quito, b. Poudel, i.e. tzanetakis, Viruses and virus diseases of Rubus. Plant disease, (In press). sabanadzovic s., k.e. keller, r.r. martin, i.e. tzanetakis, Identification and characterization of a new ampelovirus infecting cultivated and wild blackberries. Phytopathology, 101, S158. susaimuthu, J., i.e. tzanetakis, r.c. geregrich, r.r. martin, Yellow veinaffected blackberries and presence of a novel crinivirus. Plant Pathology, 55, susaimuthu, J., r.c. geregrich, m.m. bray, k.a. Clay, J.r. Clark, i.e. tzanetakis, r.r. martin, Incidence and ecology of blackberry yellow vein associated virus. Plant Disease, 91, tamura, k., d. Peterson, n. Peterson, g. stecher, m. nei, s. kumar, MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, tzanetakis, i.e., a. halgren, n. mosier, r.r. martin, Identification and characterization of Raspberry mottle virus, a novel member of the Closteroviridae. Virus Research 127, ValVerde, r.a., Analysis of double-stranded RNA for plant virus diagnosis. Plant Disease, 74,

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio 2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John

More information

Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio 2013 Plant Management Network. Accepted for publication 21 December 2012. Published. Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

More information

INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO

INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO Zindović J., 1 Božović V., 1 Miladinović Z., 2 Rubies Autonell C. 3, Ratti C. 3 1 2 3 Peach production in Montenegro Stone fruit

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Molecular detection and characterization of viruses infecting sweet cherry trees in Greece

Molecular detection and characterization of viruses infecting sweet cherry trees in Greece Molecular detection and characterization of viruses infecting sweet cherry trees in Greece V.I. Maliogka, A.T. Katsiani, V. Drougkas, K. Efthimiou, N.I. Katis Lab of Plant Pathology, School of Agriculture,

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

FAQs: PCR Polymerases from Takara Bio

FAQs: PCR Polymerases from Takara Bio FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Chapter 4. Recombinant DNA Technology

Chapter 4. Recombinant DNA Technology Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

Title of Project: Screening Blueberry Seedling Progenies for Pollen Transmission of Blueberry Latent Virus. Progress Report

Title of Project: Screening Blueberry Seedling Progenies for Pollen Transmission of Blueberry Latent Virus. Progress Report Title of Project: Screening Blueberry Seedling Progenies for Pollen Transmission of Blueberry Latent Virus Progress Report Grant Code: SRSFC Project # 2014-11 Research Proposal Names, Mailing and Email

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

winter savings one place High Quality Costs Less Look inside to find great deals on Thermo Scientific products for all your molecular biology needs

winter savings one place High Quality Costs Less Look inside to find great deals on Thermo Scientific products for all your molecular biology needs A quarterly publication containing special offers for significant savings on a variety of molecular biology products CDA winter savings High Quality Costs Less RNAi PCR / qpcr Look inside to find great

More information

Development of Positive Control for Hepatitis B Virus

Development of Positive Control for Hepatitis B Virus Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

TECHNICAL SHEET No. 23. Virus Detection: Potato virus Y (PVY) and PVY N

TECHNICAL SHEET No. 23. Virus Detection: Potato virus Y (PVY) and PVY N TECHNICAL SHEET No. 23 Virus Detection: Potato virus Y (PVY) and PVY N Method: RT-PCR General Virus detected: PVY from potato tubers and leaf. General method is reverse transcription PCR (RT-PCR). Developed

More information

Detection of Tomato yellow leaf curl virus Isolates by Multiplex. Polymerase Chain Reaction

Detection of Tomato yellow leaf curl virus Isolates by Multiplex. Polymerase Chain Reaction Technical Sheet No. 32 Detection of Tomato yellow leaf curl virus Isolates by Multiplex Polymerase Chain Reaction GENERAL Virus Detected: TYLCV isolates from tomato plants. DEVELOPED BY Name of researchers

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Identification of Two Tobacco rattle virus Variants Associated with Line Pattern Disease of Bleeding Heart in Ohio

Identification of Two Tobacco rattle virus Variants Associated with Line Pattern Disease of Bleeding Heart in Ohio 2013 Plant Management Network. Accepted for publication 19 December 2012. Published. Identification of Two Tobacco rattle virus Variants Associated with Line Pattern Disease of Bleeding Heart in Ohio John

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

QUICK-Clone TM User Manual. cdna

QUICK-Clone TM User Manual. cdna QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

PCR and qpcr solutions

PCR and qpcr solutions A A A C A A A C A A A C A A A C A A A T A A A C A A A C A A A C A A A C A A A T A A A C A A A C A A A C A A A C A A C G A A A A A A A A A A A A A A A A A A A A A A C A A A C A A A C A A A C A A A A A C

More information

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION 1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Quant Reverse Transcriptase

Quant Reverse Transcriptase 1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

DNA fragments generated with the KAPA Plant PCR Kits are A-tailed and suitable for use with TA cloning vectors.

DNA fragments generated with the KAPA Plant PCR Kits are A-tailed and suitable for use with TA cloning vectors. KAPA Plant PCR Kit Technical Data Sheet Product description Amplification of plant-derived DNA is a challenging application due to the diversity of plant tissue types and the potent PCR inhibitors contained

More information

MightyAmp DNA Polymerase Ver.3

MightyAmp DNA Polymerase Ver.3 Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...

More information

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Ali Mahmoudpour Department of Plant Pathology, University of California, Davis, CA, 95616, USA Current Address:

More information

THUNDERBIRD SYBR qpcr Mix

THUNDERBIRD SYBR qpcr Mix Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]

More information

Taq + dntps #EZ U

Taq + dntps #EZ U #EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +

More information

Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19

Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 IVANA KOMLJENOVIC Department of Microbiology and Immunology,

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Gene Cloning and DNA Analysis: An introduction

Gene Cloning and DNA Analysis: An introduction Gene Cloning and DNA Analysis: An introduction T. A. Brown. 6th edition 2010 Published by Blackwell Science Ltd & 140.128.147.174/yclclass/ =>2011 Part I The Basic Principles of Gene Cloning and DNA Analysis

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Fun with DNA polymerase

Fun with DNA polymerase Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase

More information

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

PlantDirect TM Multiplex PCR System

PlantDirect TM Multiplex PCR System PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Amplification Products for PCR and RT-PCR

Amplification Products for PCR and RT-PCR Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format

More information

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

Supplemental Information

Supplemental Information Supplemental Information ATP-dependent unwinding of U4/U6 snrnas by the Brr2 helicase requires the C-terminus of Prp8 Corina Maeder 1,3, Alan K. Kutach 1,2,3, and Christine Guthrie 1 1 Department of Biochemistry

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University

More information

Citrus tristeza virus (CTV) diagnosis and strain typing by PCR-based methods

Citrus tristeza virus (CTV) diagnosis and strain typing by PCR-based methods Citrus tristeza virus (CTV) diagnosis and strain typing by PCR-based methods Nolasco G. in D'Onghia A.M. (ed.), Menini U. (ed.), Martelli G.P. (ed.). Improvement of the citrus sector by the setting up

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture... Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- Neo 1109 F1066K KOD -Plus- Neo Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction

More information

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets

More information

Computational Biology 2. Pawan Dhar BII

Computational Biology 2. Pawan Dhar BII Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion

More information

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Supplementary Information

Supplementary Information Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.

More information

Rapid amplification of cdna ends (RACE)

Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE

More information

Maize Chlorotic Mottle Virus

Maize Chlorotic Mottle Virus TM Primerdesign Ltd Maize Chlorotic Mottle Virus Coat Protein Gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Maize Chlorotic Mottle Virus Maize chlorotic

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.

More information

RTS Wheat Germ LinTempGenSet, His 6 -tag Manual

RTS Wheat Germ LinTempGenSet, His 6 -tag Manual RTS Wheat Germ LinTempGenSet, His 6 -tag Manual For rapid production of linear expression templates using PCR RTS Wheat Germ LinTempGenSet, His6-tag, April, 2015 2015 biotechrabbit, all rights reserved.

More information

The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR

The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR S. Thomas, C. S. Fernando, J. Roach, U. DeSilva and C. A. Mireles DeWitt The objective

More information

Online Data Supplement

Online Data Supplement Persistence of Rhinovirus Infection of Lower Airways in Patients with Bronchial Asthma Monika Wo, Marek Sanak, Jerzy Soja, Henryk Olechnowicz,William W. Busse, Andrew Szczeklik Online Data Supplement 39

More information

Applied Bioinformatics - Lecture 16: Transcriptomics

Applied Bioinformatics - Lecture 16: Transcriptomics Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also

More information

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes

More information

VOLUME 2. Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N. Joseph Sambrook. David W. Russell

VOLUME 2. Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N. Joseph Sambrook. David W. Russell VOLUME 2 Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N Joseph Sambrook David W. Russell Chapter 8 In Vitro Amplification of DNA by the Polymerase 8. 1 Chain Reaction 1 The Basic Polymerase Chain

More information

HCV Genotype Primer Kit

HCV Genotype Primer Kit Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence

More information

KAPA HiFi HotStart ReadyMix PCR Kit

KAPA HiFi HotStart ReadyMix PCR Kit KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,

More information

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection

Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation

More information

Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening

Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening Supplementary Information Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening Tao Zhou 2,3, Hang Zhang 2,4, Tongfei Lai 1, Cheng Qin 1, Nongnong

More information

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21

More information

INTRODUCTION DEVELOPMENT OF DIAGNOSTICS FOR SWEETPOTATO FEATHERY MOTTLE VIRUS. Productivity of sweet potato is very low in India (8 tonnes/ ha)

INTRODUCTION DEVELOPMENT OF DIAGNOSTICS FOR SWEETPOTATO FEATHERY MOTTLE VIRUS. Productivity of sweet potato is very low in India (8 tonnes/ ha) DEVELOPMENT OF DIAGNOSTICS FOR SWEETPOTATO FEATHERY MOTTLE VIRUS Ganga Prasanth, Vinayaka Hegde, Makeshkumar.T, Jeeva M.L. and Edison.S INTRODUCTION Sweet potato ( Ipomoea batas L,) is an important starchy

More information