Supplementary appendix

Size: px
Start display at page:

Download "Supplementary appendix"

Transcription

1 Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Quan J, Li X, Chen Y, et al. Prevalence of mcr-1 in Escherichia coli and Klebsiella pneumoniae recovered from bloodstream infections in China: a multicentre longitudinal study. Lancet Infect Dis 2017; published online Jan org/ /s (16)0528-x.

2 Supplementary table 1. The primers of common chromosomal mutations used in the study. Genes primer name Sequence (5'-') Reference or source KP-mgrB KP-phoP KP-phoQ KP-pmrA KP-pmrB EC-mgrB EC-phoP EC-phoQ EC-pmrA EC-pmrB KPmgrB-F AAGGCGTTCATTCTACCACC KPmgrB-R TTAAGAAGGCCGTGCTATCC KPphoP-F GAGCTTCAGACTACTATCGA KPphoP-R GGGAAGATATGCCGCAACAG KPphoQ-F ATACCCACAGGACGTCATCA KPphoQ-R CAGGTGTCTGACAGGGATTA KPpmrA-F CATTTCCGCGCACTGTCTGC KPpmrA-R CAGGTTTCAGTTGCAAACAG KPpmrB-F ACCTACGCGAAAAGATTGGC KPpmrB-R GATGAGGATAGCGCCCATGC ECmgrB-F AAGGTAGGTGAAACGGAGATT This study ECmgrB-R CCGATACAACCAAAGACGC ECphoP-F ATGGCGATGCTGTCCG This study ECphoP-R TCCGTAGGCAAGCGAAA ECphoQ-F GCAAAGTGGTCAGCAAAGA This study ECphoQ-R AATCGGGCCAGTTAAGAGT ECpmrA-F TGCTGTGGCTGTCGGA This study ECpmrA-R AATCTGCTCGGTACTTTCATG ECpmrB-F CCAACACCCTGGAAGTGC This study ECpmrB-R TGATGAATAAGCTGAAACGGA

3 Supplementary table 2. The primers of ESBLs and carberpenemases used in the study. Genes Primers Primer sequence (5 ) Reference TEM-F TCGGGGAAATGTGCG bla TEM bla SHV bla CTX-M-1 bla CTX-M-2 bla CTX-M-8 bla CTX-M-9 bla VEB bla PER bla GES bla OXA-2 bla OXA-10 bla NDM TEM-R TGCTTAATCAGTGAGGCACC SHV-F GCCTTTATCGGCCTTCACTCAAG SHV-R TTAGCGTTGCCAGTGCTCGATCA CTX-M-1-F CAGCGCTTTTGCCGTCTAAG CTX-M-1-R GGCCCATGGTTAAAAAATCACTGC CTX-M-2-F GCATTCGCCGCTCAATGTTA CTX-M-2-R GGTTCGTTGCAAGACAAGAC CTX-M-8-F ACTTCAGCCACACGGATTCA CTX-M-8-R CGAGTACGTCACGACGACTT CTX-M-9-F GTTACAGCCCTTCGGCGATGATTC CTX-M-9-R GCGCATGGTGACAAAGAGAGTGCAA VEB-F GCGGTAATITAACCAGA VEB-R GCCTATGAGCCAGTGTT PER-F CCTGACGATCTGGAACCTTT PER-R TGGTCCTGTGGTGGTTTC GES-F CCGATCTTGAGAAGCTAGAG GES-R GACCGACAGAGGCAACTAAT OXA-2-F GGAGCAGCAACGATGTTACG OXA-2-R GGCGGTAACGCTTCAATAGA OXA-10-F CCACCAAGAAGGTGCCATGA OXA-10-R GCGACCTTGAGCGACTTGTT NDM-F GGCGGAATGGCTCATCACGA This study NDM-R CGCAACACAGCCTGACTTTC

4 Supplementary table. The chromosomal mutations identified in colistin-resistant or mcr-1 positive E. coli and K. pneumoniae isolates. Isolates MIC of colistin(mg/l) phop phoq pmra pmrb mgrb 04HAE WT a WT A64T WT WT 04HAE0 16 WT WT WT WT WT 05HAE09 8 I44L N46K WT H2R/D28G/A60V WT 05HAE16 4 I44L N46K WT H2R/D28G/A60V WT 05HAE0 4 I44L L477M WT H2R/D28G WT 06COE21 8 I44L WT G144S H2R/D28G WT 07HAE27 8 WT WT WT WT WT 10HAE1 8 WT E464D/A482T WT WT WT 18HAE25 4 I44L A449V WT D28G/Y58N WT 19COE11 8 WT WT WT WT WT 20COE1 8 WT WT WT H2R/D28G/A60V WT 20HAE28 4 I44L I175F WT D28G/Y58N WT 20HAE29 8 WT A482T WT H2R/D28G/A60V WT 2COE28 16 WT WT WT WT WT 2HAE4 8 I44L WT WT H2R/A242T/D28G/A60V WT 24COE0 8 WT WT WT WT L16V 24COE26 8 I44L WT G144S H2R/E12D/D28G/V51I WT 27COE18 8 I44L WT T1S/I128N/G144S H2R/D28G N41S 27COE19 8 I44L WT R18H D28G/Y58N WT 27HAE25 4 I44L WT R18H D28G/Y58N WT 28HAK10 2 WT WT WT WT WT 01COK02 2 WT WT WT R256G WT

5 0HAK08 64 WT WT WT R256G WT 06COE08 16 I44L R6H T1S/I128N/G144S H2R/E12D/D28G/V51I N8G\Y17H\N41S 10COE06 4 I44L WT T1S H2R/E12D/V161G/D28G/V51I Q1K\N41S 1COE09 8 I44L R6H T1S/I128N/G144S H2R/E12D/V161G/D28G/V51I N8G\Y17H\N41S 28COK WT WT WT R256G insersation inactivation a WT: wild type

6 Supplementary table 4. The antimicrobial susceptibility of index mcr-1-positive isolates and their transconjugants MIC (mg/l) Isolates name TZP FEP CTX CPS2/1 IPM MEM CST a AMK TGC MIN CIP ATM 05HAE HAE09-EC HAE HAE16-EC COE COE21-EC HAE HAE1-EC HAE HAE25-EC COE COE11-EC COE COE18-EC COE COE19-EC ATCC25922 b E. coli EC TZP, piperacillin/tazobactam;fep, cefepime;ctx, ceftriaxone;cps2/1, cefoperazone/sulbactam; IPM, imipenem; MEM, meropenem; CST, colistin; AMK, amikacin; TGC, tigecycline; MIN, minocycline; CIP, ciprofloxacin; ATM, aztreonam.

7 a Drug susceptibility was determined with broth microdilution method. All susceptibility tests were repeated at least three times according to CLSI method. The results of colistin susceptibility were interpreted according to EUCAST breakpoints. b quality control strain

8 Methods Patient and isolate data The E. coli 04HAE12 isolate was recovered from a 64-year-old female patient admitted to the hospital for biliary calculi in Beijing, China, April The strain was cultured from blood during the patient hospitalization. Initially, the patient only received cefuroxime (1.5g, q12h) for days. Following treatment with surgery, the therapeutic regimen was adjusted to cefoperazone/sulbactam (g, q12h) for 6 days and the patient was cured. Plasmid DNA extraction and analysis Plasmid extraction and analysis was performed as previously described. 4 Briefly, the plasmid DNA of strain E. coli 04HAE12 was extracted using a QIAamp DNA MiniKit (Qiagen, Valencia, CA, USA) following the manufacturer s recommendations. The plasmids were sequenced on an Illumina-Hiseq TM 2000 (Illumina Inc, San Diego, U.S.A) using a paired-end bp protocol. Sequence reads were assembled using the CLC Genomics Workbench software package (CLC Bio 8.0). Gaps were closed by standard PCR and Sanger sequencing according to a protocol from a previous study. 5 The RAST annotation website server was then used to annotate the genomes of the plasmid. The CG viewer was used to compare the pec_04hae12 sequence with that of the reference plasmid phnshp45 (accession number KP47127). 6 Cloning experiments The mcr-1 gene and part of the flanking sequence were amplified with primers MCR-F/R from the strains E. coli 04HAE12 and E. coli 20COE1 (mcr-1-positive and colistin resistance strain, unpublished data). The purified PCR products were cloned into the pcr 2.1-TOPO vector (Invitrogen, Shanghai, China), giving recombinant plasmids pec_04hae12::mcr-1 and p20coe1::mcr-1. The recombinant plasmids were then introduced into the colistin-susceptible E. coli DH5α strain via electroporation. Transformants (Supplementary table 5) were selected on LB agar plates containing 2 mg/l colistin and were confirmed by sequencing. Nucleotide sequence accession number The nucleotide sequence reported in the present study has been deposited in the GenBank nucleotide database under accession no. KX Results Isolate characteristics The mcr-1 gene was detected in E. coli 04HAE12 by PCR amplification and DNA sequencing revealed 100% identity compared with the originally reported gene sequence. Antimicrobial susceptibility testing showed that strain E. coli 04HAE12 was resistant to piperacillin/tazobactam, cefepime, ceftriaxone, ciprofloxacin, aztreonam, amikacin and tetracycline and sulfonamides, but susceptible to colistin (MIC 0.06 mg/l). PCR and sequence analyses showed various resistance genes, such as bla CTX-M-15, aada5, stra, aac()-iia, strb, mph(a), tet(a) and sul1, in isolate E. coli 04HAE12. The mcr-1 gene was detected in this strain with a colistin- susceptible phenotypic. Southern blot showed that the mcr-1 gene was located in a plasmid (ca. 60k). In addition, this strain belonged to a new ST clonal lineage ( ). Plasmid analysis The mcr-1-harbouring plasmid from E. coli 04HAE12 belonged to IncI2 incompatibility group with a

9 G+C content of 42.5%. The BLASTn search results showed that pec_04hae12 exhibited only 92% query coverage and 97% identity to the originally described mcr-1-encoding plasmid phnshp45. The mcr-1-encoding pec_04hae12 plasmid sequence was 59,99 bp in size and was nearly identical to plasmid phnshp45, mainly differing by (i) the lack of a 2704 bp insertion of IS68 downstream of the repa gene; and (ii) the absence of ISApl1 transposable element in the plasmid pec_04hae12, however, insertion sequence IS1 was present. Notably, insertion sequence IS1 was identified among the -10 promoter sequence of mcr-1 and disrupted this box (TACAAT) (Supplementary figure 1). It is therefore plausible that this genetic event is responsible for the modified of expression of mcr-1. To confirm this hypothesis, cloning experiments were performed. As we expected, MIC of strain E. coli D04HAE12, transformed by pec_04hae12::mcr-1 plasmid, is 0.06 mg/l of colistin. In contrast, MIC of strain E. coli D20COE1, transformed by p20coe1::mcr-1 plasmid, displayed 4 mg/l of colistin (Supplementary table 6). In addition, wild type E. coli DH5α and plasmid control strain E. coli DT1 are both 0.06 mg/l of colistin. Overall,these results demonstrated that the insert sequence IS1 in the -10 promoter box breaks the functionality of the mcr-1 promoter region and conferred to colistin susceptibility, which might affect the expression of mcr-1.

10 Supplementary table 5. Bacterial isolates, plasmids and primers used in this study Isolate, plasmid, or primer Relevant description Source or reference Strains E. coli DH5α E. coli E. coli 04HAE12 mcr-1-positive and colistin susceptible strain This study E. coli 20COE1 mcr-1-positive and colistin resistance strain This study E. coli DT1 E. coli DH5α was transformed by expression plasmid pcr2.1-topo as a control This study E. coli D04HAE12 E. coli DH5α was transformed by pec_04hae12::mcr-1 plasmid This study E. coli D20COE1 E. coli DH5α was transformed by p20coe1::mcr-1 plasmid This study Plasmids pcr2.1-topo E. coli expression plasmid, Amp r, KM r pec_04hae12::mcr-1 IS1 and mcr-1 from E. coli 04HAE12 were together cloned into the plasmid pcr2.1-topo, Km r This study p20coe1::mcr-1 mcr-1 from E. coli 20COE1 was cloned into pcr2.1-topo plasmid, Km r This study Primers Nucleotide sequences (5 - ) mcr-ms_f AGACGGCAAGATTCTTGAGG; forward primer for amplification upstream of mcr-1 for cloning This study mcr-ms_r CCCCATACCCAGATAAAAC; reverse primer for amplification upstream of mcr-1 for cloning This study Km: kanamycin; Amp: ampicillin; r: resistance.

11 Supplementary table 6. MICs of colistin (mg/l) Strains colistin E. coli DH5α 0.06 E. coli DT E. coli D04HAE E. coli D20COE1 4 E. coli 20COE1 8 Supplementary figure 1. Circular genetic map and mechanism of pec_04hae12 from colistin-susceptible E. coli 04HAE12 carrying mcr-1. (A): Comparison of pec_04hae12 (KX592672) from E. coli 04HAE12 with complete plasmid sequence phnshp45 (KP47127) from E. coli SHP45. (B) The zoomed-in view of the mcr-1 mobile element in the plasmid pec_04hae12. The large blank arrow indicates ORF of mcr-1 (it is encoded on the forward strand). The blank block indicates mobile element of IS1. The -10 and -5 promoter sequences of the mcr-1 gene are indicated by the underline. IRL (Inverted Repeat Left) and IRR (Inverted Repeat Right) of IS1 are also indicated by the red body words. Reference 1 Cannatelli A, D'Andrea MM, Giani T, et al. In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrb regulator. Antimicrob Agents Chemother 201; 57:

12 Jayol A, Poirel L, Brink A, Villegas MV, Yilmaz M, Nordmann P. Resistance to colistin associated with a single amino acid change in protein PmrB among Klebsiella pneumoniae isolates of worldwide origin. Antimicrob Agents Chemother 2014; 58: Quan J, Zhao D, Liu L, et al. High prevalence of ESBL-producing Escherichia coli and Klebsiella pneumoniae in community-onset bloodstream infections in China. J Antimicrob Chemother DOI: /jac/dkw72 4 Fu Y, Liu L, Li X, et al. Spread of a common blandm-1-carrying plasmid among diverse Acinetobacter species. Infect Genet Evol 2015; 2: Fu Y, Du X, Ji J, Chen Y, Jiang Y, Yu Y. Epidemiological characteristics and genetic structure of blandm-1 in non-baumannii Acinetobacter spp. in China. J Antimicrob Chemother 2012; 67: Liu YY, Wang Y, Walsh TR, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis 2016; 16:

Antimicrobial Agents and Chemotherapy New Data Letter

Antimicrobial Agents and Chemotherapy New Data Letter AAC Accepted Manuscript Posted Online 15 August 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01519-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 Antimicrobial Agents

More information

Title: Description of the First Escherichia coli Clinical Isolate Harboring Colistin-

Title: Description of the First Escherichia coli Clinical Isolate Harboring Colistin- AAC Accepted Manuscript Posted Online 24 October 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01945-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 Title: Description

More information

Molecular susceptibility testing

Molecular susceptibility testing Molecular susceptibility testing Dr Andrew Ginn Supervising Scientist Antimicrobial Resistance Reference Laboratory ICPMR, Westmead Hospital Resistance genes Gram negatives Transmissible; e.g. ESBLs, MBLs,

More information

Use of Molecular Assays for Resistance Detection

Use of Molecular Assays for Resistance Detection Use of Molecular Assays for Resistance Detection Antimicrobial resistance and susceptibility are complex, and current in vitro methods have been developed to predict a microorganism s response to antibacterial

More information

Genetic support of Extended- Spectrum ß-Lactamases

Genetic support of Extended- Spectrum ß-Lactamases Genetic support of Extended- Spectrum ß-Lactamases Laurent Poirel Dept of Microbiology (Pr Nordmann) Bicêtre Hospital. South-Paris Medical School. France ESCMID Conference on ESBL 29-31 May 2006 TEM-like

More information

by author How to effectively report laboratory findings to clinicians (Breakpoints and Interpretation)

by author How to effectively report laboratory findings to clinicians (Breakpoints and Interpretation) How to effectively report laboratory findings to clinicians (Breakpoints and Interpretation) A Vatopoulos National School of Public Health & Central Public Health Laboratory KEELPNO Antibiotic Activity

More information

12 th EURL-AR Workshop

12 th EURL-AR Workshop 12 th EURL-AR Workshop The EURL protocol on mcr-1, -2, -3, -4, -5 Ana Rita Rebelo Research Assistant Colistin resistance in Enterobacteriaceae Mechanisms pmra/pmrb mutations not totally defined at this

More information

SUMMARY. Key words: antibioticresistance, Enterobacteriaceae, ESBL, CTX-M,

SUMMARY. Key words: antibioticresistance, Enterobacteriaceae, ESBL, CTX-M, SUMMARY Key words: antibioticresistance, Enterobacteriaceae, ESBL, CTX-M, The doctoral thesis entitled Prevalence of Enterobacteriaceae producing extendedspectrum beta-lactamases (ESBL) isolated from broilers

More information

Prevalence and molecular characterization of clinical isolates of Escherichia coli expressing an AmpC phenotype

Prevalence and molecular characterization of clinical isolates of Escherichia coli expressing an AmpC phenotype J Antimicrob Chemother 2010; 65: 460 464 doi:10.1093/jac/dkp484 Advance publication 22 January 2010 Prevalence and molecular characterization of clinical isolates of Escherichia coli expressing an AmpC

More information

Detection of aac(6 0 )-Ib-cr in KPC-producing Klebsiella pneumoniae isolates from Tel Aviv, Israel

Detection of aac(6 0 )-Ib-cr in KPC-producing Klebsiella pneumoniae isolates from Tel Aviv, Israel Journal of Antimicrobial Chemotherapy (2009) 64, 718 722 doi:10.1093/jac/dkp272 Advance Access publication 4 August 2009 Detection of aac(6 0 )-Ib-cr in KPC-producing Klebsiella pneumoniae isolates from

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

Detection and characterization of extended spectrum β-lactamase producing Escherichia coli from poultry of eastern India

Detection and characterization of extended spectrum β-lactamase producing Escherichia coli from poultry of eastern India Detection and characterization of extended spectrum β-lactamase producing Escherichia coli from poultry of eastern India Dr. Samiran Bandyopadhyay Scientist Indian Veterinary Research Institute Eastern

More information

WELCOME. to the CDS WORKSHOP

WELCOME. to the CDS WORKSHOP WELCOME to the CDS WORKSHOP Sydney 2010 Excel Spreadsheet for Registration Recent Additions to the CDS Doripenem 10mg disc A carbapenem claimed to be more active against Pseudomonas than Meropenem Daptomycin:

More information

Real world applications of whole genome sequencing. Henrik Hasman Bacteria, parasites and fungi Statens Serum Institut, Denmark

Real world applications of whole genome sequencing. Henrik Hasman Bacteria, parasites and fungi Statens Serum Institut, Denmark Real world applications of whole genome sequencing Henrik Hasman Bacteria, parasites and fungi Statens Serum Institut, Denmark REAL WORLD APPLICATIONS or application of WGS for outbreak detection, national

More information

Emergence of pan-resistance in KPC-2 carbapenemase-producing Klebsiella pneumoniae in Crete, Greece: a close call

Emergence of pan-resistance in KPC-2 carbapenemase-producing Klebsiella pneumoniae in Crete, Greece: a close call J Antimicrob Chemother 2016; 71: 1207 1212 doi:10.109/jac/dkv467 Advance Access publication 26 January 2016 Emergence of pan-resistance in KPC-2 carbapenemase-producing Klebsiella pneumoniae in Crete,

More information

Are There Non-Carbapenem β-lactam Options for Treating ESBL Infections?

Are There Non-Carbapenem β-lactam Options for Treating ESBL Infections? CIDEIM Are There Non-Carbapenem β-lactam Options for Treating ESBL Infections? Pranita D. Tamma, M.D., M.H.S. Assistant Professor, Pediatrics Director, Pediatric Antimicrobial Stewardship Program CIDEIM

More information

Emergence and persistence of integron structures harbouring VIM genes in the Children s Memorial Health Institute, Warsaw, Poland,

Emergence and persistence of integron structures harbouring VIM genes in the Children s Memorial Health Institute, Warsaw, Poland, Journal of Antimicrobial Chemotherapy (2009) 63, 269 273 doi:10.1093/jac/dkn512 Advance Access publication 18 December 2008 Emergence and persistence of integron structures harbouring VIM genes in the

More information

Dissemination of transposon Tn6001 in carbapenem-non-susceptible and extensively drug-resistant Pseudomonas aeruginosa in Taiwan

Dissemination of transposon Tn6001 in carbapenem-non-susceptible and extensively drug-resistant Pseudomonas aeruginosa in Taiwan Journal of Antimicrobial Chemotherapy (2009) 64, 1170 1174 doi:10.1093/jac/dkp341 Advance Access publication 22 September 2009 Dissemination of transposon Tn6001 in carbapenem-non-susceptible and extensively

More information

Colistin resistance Lyngby, DK, April 4, Dik Mevius, Wageningen Bioveterinary Research (CVI- Lelystad)

Colistin resistance Lyngby, DK, April 4, Dik Mevius, Wageningen Bioveterinary Research (CVI- Lelystad) Colistin resistance Lyngby, DK, April 4, 2018 Dik Mevius, Wageningen Bioveterinary Research (CVI- Lelystad) 2 Discovery of a gene encoding for plasmid mediated colistin resistance MCR-history Retrospective

More information

Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B

Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture DNA microarray hybridization

More information

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References. 1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly

More information

Received 22 August 2012; returned 2 November 2012; revised 19 December 2012; accepted 21 December 2012

Received 22 August 2012; returned 2 November 2012; revised 19 December 2012; accepted 21 December 2012 J Antimicrob Chemother 03; 68: 036 04 doi:0.093/jac/dks535 Advance Access publication 8 January 03 Tigecycline susceptibility in Klebsiella pneumoniae and Escherichia coli causing neonatal septicaemia

More information

Ecology of bla NDM and mcr-1

Ecology of bla NDM and mcr-1 Editorial Page 1 of 5 Ecology of bla NDM and mcr-1 Jose Francisco Delgado-Blas, Bosco R. Matamoros, Bruno Gonzalez-Zorn Department of Animal Health and VISAVET, Universidad Complutense de Madrid, Madrid,

More information

Resistance, Yonsei University College of Medicine, Seoul, Korea; and 2 Department of

Resistance, Yonsei University College of Medicine, Seoul, Korea; and 2 Department of AAC Accepts, published online ahead of print on March 0 Antimicrob. Agents Chemother. doi:./aac.0- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Supplementary webappendix

Supplementary webappendix Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Falgenhauer L, Waezsada S-E, Yao Y, et

More information

Genetics Lecture Notes Lectures 13 16

Genetics Lecture Notes Lectures 13 16 Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons

More information

Genome analysis of the carbapenem- and colistin-resistant Escherichia coli isolate NRZ14408

Genome analysis of the carbapenem- and colistin-resistant Escherichia coli isolate NRZ14408 AAC Accepted Manuscript Posted Online 17 January 2017 Antimicrob. Agents Chemother. doi:10.1128/aac.02359-16 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 Genome analysis of

More information

Imipenem-susceptible, meropenem-resistant Klebsiella pneumoniae producing

Imipenem-susceptible, meropenem-resistant Klebsiella pneumoniae producing AAC Accepts, published online ahead of print on 15 December 2014 Antimicrob. Agents Chemother. doi:10.1128/aac.04330-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 Imipenem-susceptible,

More information

Received 5 June 2010/Returned for modification 27 June 2010/Accepted 6 August 2010

Received 5 June 2010/Returned for modification 27 June 2010/Accepted 6 August 2010 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2010, p. 4575 4581 Vol. 54, No. 11 0066-4804/10/$12.00 doi:10.1128/aac.00764-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. Emergence

More information

CRE Laboratory Testing and CRE Lab Testing Recommendations in-depth recommendations on CRE laboratory detection

CRE Laboratory Testing and CRE Lab Testing Recommendations in-depth recommendations on CRE laboratory detection December 2014 Dear Laboratory Director, The Illinois Department of Public Health (IDPH) amended the Control of Communicable Diseases Code (77 Ill. Adm. Code 690) to require reporting of Carbapenem-Resistant

More information

Efficient Multi-site-directed Mutagenesis directly from Genomic Template.

Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis

More information

Ongoing epidemic of bla VIM-1 -positive Klebsiella pneumoniae in Athens, Greece: a prospective survey

Ongoing epidemic of bla VIM-1 -positive Klebsiella pneumoniae in Athens, Greece: a prospective survey Journal of Antimicrobial Chemotherapy (2008) 61, 59 63 doi:10.1093/jac/dkm443 Advance Access publication 13 November 2007 Ongoing epidemic of bla VIM-1 -positive Klebsiella pneumoniae in Athens, Greece:

More information

Screening for Resistant Organisms and Infection Control

Screening for Resistant Organisms and Infection Control Screening for Resistant Organisms and Infection Control Dr Sonal Saxena Professor Department of Microbiology Lady Hardinge Medical College New Delhi 1 MDRO The proportion of K. pneumoniae and E. coli with

More information

ESBLs and KPCs: Impact of Revised CLSI Breakpoints on testing and Reporting Algorithms

ESBLs and KPCs: Impact of Revised CLSI Breakpoints on testing and Reporting Algorithms ESBLs and KPCs: Impact of Revised CLSI Breakpoints on testing and Reporting Algorithms Stephen G. Jenkins, Ph.D. Director, Clinical Microbiology Laboratories New York/Presbyterian Hospital Weill Cornell

More information

Setting Clinical Breakpoints/ECOFFS

Setting Clinical Breakpoints/ECOFFS 23 rd August 2016 Setting Clinical Breakpoints/ECOFFS Robin A Howe Antimicrobial use in Primary Care An E. coli is grown from blood cultures Cefuroxime MIC 2mg/L Zone around CXM 30ug disc 27mm Is it sensitive?

More information

NEXT STEP TO STOP THE SPREAD OF ANTIMICROBIAL RESISTANCE. Patricia Ruiz Garbajosa Servicio de Microbiología Hospital Universitario Ramón y Cajal

NEXT STEP TO STOP THE SPREAD OF ANTIMICROBIAL RESISTANCE. Patricia Ruiz Garbajosa Servicio de Microbiología Hospital Universitario Ramón y Cajal NEXT STEP TO STOP THE SPREAD OF ANTIMICROBIAL RESISTANCE Patricia Ruiz Garbajosa Servicio de Microbiología Hospital Universitario Ramón y Cajal ANTIMICROBIAL RESISTANCE AND HEALTHCARE-ASSOCIATED INFECTION

More information

OXA-type beta-lactamases among extended-spectrum cephalosporin-resistant Pseudomonas aeruginosa isolates in a university hospital in southern Taiwan

OXA-type beta-lactamases among extended-spectrum cephalosporin-resistant Pseudomonas aeruginosa isolates in a university hospital in southern Taiwan OXA-type J Microbiol ESBLs Immunol in P. Infect aeruginosa 2006;39:130-134 OXA-type beta-lactamases among extended-spectrum cephalosporin-resistant Pseudomonas aeruginosa isolates in a university hospital

More information

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is

More information

Genomic epidemiology of bacterial pathogens. Sylvain BRISSE Microbial Evolutionary Genomics, Institut Pasteur, Paris

Genomic epidemiology of bacterial pathogens. Sylvain BRISSE Microbial Evolutionary Genomics, Institut Pasteur, Paris Genomic epidemiology of bacterial pathogens Sylvain BRISSE Microbial Evolutionary Genomics, Institut Pasteur, Paris Typing Population genetics Analysis of strain diversity within species Aim: Local epidemiology?

More information

Game plan. Lecture. Lab. Antibiotics Antibiotic resistance Gene transfer Transformation Transduction Conjugation

Game plan. Lecture. Lab. Antibiotics Antibiotic resistance Gene transfer Transformation Transduction Conjugation Game plan Lecture Antibiotics Antibiotic resistance Gene transfer Transformation Transduction Conjugation Lab Review temp and UV labs Growth control: alcohol, antiseptics and antibiotics Pre-lab Transformation

More information

BIO440 Genetics Laboratory Transformation

BIO440 Genetics Laboratory Transformation BIO440 Genetics Laboratory Transformation The transfer of genetic information between bacteria has been occurring for billions of years. Humans first noticed this process in the laboratory in the 1920

More information

Emergence of carbapenem-resistant clinical Enterobacteriaceae isolates from a teaching hospital in Shanghai, China

Emergence of carbapenem-resistant clinical Enterobacteriaceae isolates from a teaching hospital in Shanghai, China Journal of Medical Microbiology (2012), 61, 132 136 DOI 10.1099/jmm.0.036483-0 Emergence of carbapenem-resistant clinical Enterobacteriaceae isolates from a teaching hospital in Shanghai, China Fupin Hu,

More information

Beta-lactamase inhibition: A potted history of beta lactamase and lessons from recent development of betalactamase inhibiter combinations

Beta-lactamase inhibition: A potted history of beta lactamase and lessons from recent development of betalactamase inhibiter combinations Beta-lactamase inhibition: A potted history of beta lactamase and lessons from recent development of betalactamase inhibiter combinations Dr Shampa Das, Senior Lecturer, Molecular and Clinical Pharmacology,

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

National Center for Emerging and Zoonotic Infectious Diseases The Role of Breakpoint Committees for New Drugs Perspectives from the United States

National Center for Emerging and Zoonotic Infectious Diseases The Role of Breakpoint Committees for New Drugs Perspectives from the United States National Center for Emerging and Zoonotic Infectious Diseases The Role of Breakpoint Committees for New Drugs Perspectives from the United States Jean B. Patel, PhD, D(ABMM) Science Lead, Antibiotic Resistance

More information

Haverford College Annual Progress Report: 2012 Formula Grant

Haverford College Annual Progress Report: 2012 Formula Grant Haverford College Annual Progress Report: 2012 Formula Grant Reporting Period January 1, 2013 June 30, 2013 Formula Grant Overview Haverford College received $18,238 in formula funds for the grant award

More information

Genotypic and Phenotypic Correlations of Multidrug Resistant Acinetobacter baumannii-

Genotypic and Phenotypic Correlations of Multidrug Resistant Acinetobacter baumannii- JCM Accepts, published online ahead of print on 25 August 2010 J. Clin. Microbiol. doi:10.1128/jcm.01585-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All

More information

Biology 4100 Minor Assignment 1 January 19, 2007

Biology 4100 Minor Assignment 1 January 19, 2007 Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on

More information

Emerging Resistance in Gram- Negative Bacteria CLSI Recommendations. James H. Jorgensen, PhD

Emerging Resistance in Gram- Negative Bacteria CLSI Recommendations. James H. Jorgensen, PhD Emerging Resistance in Gram- Negative Bacteria CLSI Recommendations James H. Jorgensen, PhD Most Important Emerging or Evolving Resistance in GNs Newer ESBLs Plasmid-mediated mediated AmpCs KPCs, VIM,

More information

Accurate and Timely Identification of Genes Conferring Resistance to Carbapenems Serves as an Important Tool for Infection Control Measures

Accurate and Timely Identification of Genes Conferring Resistance to Carbapenems Serves as an Important Tool for Infection Control Measures International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 05 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.705.296

More information

Simple Deletion: a vector- and marker-free method to generate and isolate site-directed

Simple Deletion: a vector- and marker-free method to generate and isolate site-directed Electronic supplementary materials Simple Deletion: a vector- and marker-free method to generate and isolate site-directed deletion mutants Yasuhiro Inoue 1, Seiji Tsuge 2 1 National Agriculture and Food

More information

Link to article, DOI: / es Publication date: Document Version Publisher's PDF, also known as Version of record

Link to article, DOI: / es Publication date: Document Version Publisher's PDF, also known as Version of record Downloaded from orbit.dtu.dk on: Sep 07, 2018 Detection of mcr-1 encoding plasmid-mediated colistin-resistant Escherichia coli isolates from human bloodstream infection and imported chicken meat, Denmark

More information

In Vitro - In Vivo Discordance with Humanized Piperacillin-Tazobactam Exposures

In Vitro - In Vivo Discordance with Humanized Piperacillin-Tazobactam Exposures AAC Accepted Manuscript Posted Online 31 October 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01208-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 Version Date: 7/1/2016

More information

Molecular Biology Techniques Supporting IBBE

Molecular Biology Techniques Supporting IBBE Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning

More information

TRANSMISSIBLE GENETIC ELEMENTS: PLASMIDS, TRANSPOSONS & INTEGRONS

TRANSMISSIBLE GENETIC ELEMENTS: PLASMIDS, TRANSPOSONS & INTEGRONS TRANSMISSIBLE GENETIC ELEMENTS: PLASMIDS, TRANSPOSONS & INTEGRONS MOBILE GENETIC ELEMENTS 1 PLASMIDS -MOST OFTEN CIRCULAR MOLECULES OF DOUBLE-STRANDED DNA -VARY WIDELY IN SIZE -SELF-TRANSMISSIBLE ELEMENTS

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/315/5819/1709/dc1 Supporting Online Material for RISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, Christophe Fremaux, Hélène Deveau,

More information

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during

More information

Abstract. Introduction

Abstract. Introduction ORIGINAL ARTICLE BACTERIOLOGY A sensitive and specific phenotypic assay for detection of metallo-blactamases and KPC in Klebsiella pneumoniae with the use of meropenem disks supplemented with aminophenylboronic

More information

Received 24 June 2008/Returned for modification 12 August 2008/Accepted 14 September 2008

Received 24 June 2008/Returned for modification 12 August 2008/Accepted 14 September 2008 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 2008, p. 4268 4273 Vol. 52, No. 12 0066-4804/08/$08.00 0 doi:10.1128/aac.00830-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. High

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

Combatting AMR: diagnostics

Combatting AMR: diagnostics Combatting AMR: diagnostics Professor Neil Woodford Antimicrobial Resistance & Healthcare Associated Infections (AMRHAI) Reference Unit Crown copyright Gonorrhoea: a paradigm for better diagnostics International

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Biotechnology:Principles and Processes

Biotechnology:Principles and Processes Biotechnology:Principles and Processes Very Short Answers Questions: 1. Define biotechnology? A: The integration of natural science and organisms, cells, parts thereof, and molecular analogues for products

More information

Environmental microbiota represents a natural reservoir for dissemination

Environmental microbiota represents a natural reservoir for dissemination AAC Accepts, published online ahead of print on August 0 Antimicrob. Agents Chemother. doi:./aac.001- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally.

The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. Name Microbial Genetics, BIO 410/510 2008 Exam II The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. 1.) Indicate where replication

More information

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3: Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of

More information

Curing antibiotic resistance in vivo. Muhammad Kamruzzaman

Curing antibiotic resistance in vivo. Muhammad Kamruzzaman Curing antibiotic resistance in vivo Muhammad Kamruzzaman Occurrence of resistance -Some bacteria are naturally resistant to certain antibiotics -Gene mutation -Horizontal transfer of antibiotic resistance

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China

Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China RESEARCH ARTICLE Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China Xingyu Zhang 1, Di Chen 2, Guifeng

More information

Prevalence and Molecular Characteristics of Carbapenemase-Producing Enterobacteriaceae From Five Hospitals in Korea

Prevalence and Molecular Characteristics of Carbapenemase-Producing Enterobacteriaceae From Five Hospitals in Korea Original Article Clinical Microbiology Ann Lab Med 6;6:9- http://dx.doi.org/.4/alm.6.6.6.9 ISSN 4-86 eissn 4-84 Prevalence and Molecular Characteristics of Carbapenemase-Producing Enterobacteriaceae From

More information

Cloning and Characterization of E. meningoseptica Beta Lactamase

Cloning and Characterization of E. meningoseptica Beta Lactamase Cloning and Characterization of E. meningoseptica Beta Lactamase Authors: Lindsey Purcell, Jessica Matts, Patricia Canaan* Department of Biochemistry and Molecular Biology Abstract Elizabethkingia meningoseptica

More information

Received 23 December 2010/Returned for modification 11 January 2011/Accepted 7 February 2011

Received 23 December 2010/Returned for modification 11 January 2011/Accepted 7 February 2011 JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2011, p. 1608 1613 Vol. 49, No. 4 0095-1137/11/$12.00 doi:10.1128/jcm.02607-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Evaluation

More information

AAC Accepts, published online ahead of print on 2 June 2008 Antimicrob. Agents Chemother. doi: /aac

AAC Accepts, published online ahead of print on 2 June 2008 Antimicrob. Agents Chemother. doi: /aac AAC Accepts, published online ahead of print on June 00 Antimicrob. Agents Chemother. doi:.11/aac.00175-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Laboratory Detection of Carbapenemase-producers

Laboratory Detection of Carbapenemase-producers Laboratory Detection of Carbapenemase-producers John D. Perry Clinical Scientist Freeman Hospital Newcastle upon Tyne Carbapenemase-producing Gram-negative Microorganisms. Where are we now? Challenges

More information

H. Wu, B.-G. Liu, J.-H. Liu, Y.-S. Pan, L. Yuan and G.-Z. Hu

H. Wu, B.-G. Liu, J.-H. Liu, Y.-S. Pan, L. Yuan and G.-Z. Hu Phenotypic and molecular characterization of CTX-M-14 extended-spectrum β-lactamase and plasmid-mediated ACT-like AmpC β-lactamase produced by Klebsiella pneumoniae isolates from chickens in Henan Province,

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression

More information

BMC Research Notes. Open Access RESEARCH ARTICLE

BMC Research Notes. Open Access RESEARCH ARTICLE DOI 10.1186/s13104-017-2467-2 BMC Research Notes RESEARCH ARTICLE Open Access Expansion of highly stable bla OXA-10 β-lactamase family within diverse host range among nosocomial isolates of Gram-negative

More information

A Verification Study for Implementing the Revised CLSI Breakpoints. Summary. Breakpoint Differences Cephalosporin Breakpoints for Enterobacteriaceae

A Verification Study for Implementing the Revised CLSI Breakpoints. Summary. Breakpoint Differences Cephalosporin Breakpoints for Enterobacteriaceae A Verification Study for Implementing the Revised CLSI Breakpoints Jean B. Patel, PhD, D(ABMM) Deputy Director, Office of Antimicrobial Resistance National Center for Emerging and Zoonotic Infectious Disease

More information

Ten Minute, Reagent-Free identification of Bacteria Containing Resistance Genes Using a Rapid Intrinsic Fluorescence Method

Ten Minute, Reagent-Free identification of Bacteria Containing Resistance Genes Using a Rapid Intrinsic Fluorescence Method 548 Ten Minute, Reagent-Free identification of Bacteria Containing Resistance Genes Using a Rapid Intrinsic Fluorescence Method R. Rozen-Sadowsky 1, A. Shinderman 1, D. Gohman 1, D. Shimonov 1, Y. Gluckman

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:

More information

Antibiotic resistance genes located in integrons isolated from Escherichia coli recovered from humans and animals

Antibiotic resistance genes located in integrons isolated from Escherichia coli recovered from humans and animals University of Wollongong Research Online University of Wollongong Thesis Collection 1954-2016 University of Wollongong Thesis Collections 2009 Antibiotic resistance genes located in integrons isolated

More information

The Laboratory Diagnosis of Enterobacteriaceae that produce Carbapenemases. and Johann DD Pitout 1-3

The Laboratory Diagnosis of Enterobacteriaceae that produce Carbapenemases. and Johann DD Pitout 1-3 JCM Accepts, published online ahead of print on 19 September 2012 J. Clin. Microbiol. doi:10.1128/jcm.02117-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 The Laboratory Diagnosis

More information

A Verification Study for Implementing the Revised CLSI Breakpoints. Summary. Glossary CDC 1

A Verification Study for Implementing the Revised CLSI Breakpoints. Summary. Glossary CDC 1 A Verification Study for Implementing the Revised CLSI Breakpoints Jean B. Patel, PhD, D(ABMM) Deputy Director, Office of Antimicrobial Resistance National Center for Emerging and Zoonotic Infectious Disease

More information

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

The Prevalence of TEM-1 gene causing resistance to beta-lactam antibiotics in Klebsiella pneumoniae isolates from clinical samples and plasmid curing

The Prevalence of TEM-1 gene causing resistance to beta-lactam antibiotics in Klebsiella pneumoniae isolates from clinical samples and plasmid curing Available online at www.ijmrhs.com ISSN No: 2319-5886 International Journal of Medical Research & Health Sciences, 2016, 5, 11:557-561 The Prevalence of TEM-1 gene causing resistance to beta-lactam antibiotics

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

Inside the Burch Lab: E. Coli and Triclosan Resistance. By: Pamela Lammonds

Inside the Burch Lab: E. Coli and Triclosan Resistance. By: Pamela Lammonds Inside the Burch Lab: E. Coli and Triclosan Resistance By: Pamela Lammonds Purpose and Goals of Research Concerns over infectious disease have risen in the past few years. In response to this concern,

More information

jmb Generation of Newly Discovered Resistance Gene mcr-1 Knockout in Escherichia coli Using the CRISPR/Cas9 System Research Article Review

jmb Generation of Newly Discovered Resistance Gene mcr-1 Knockout in Escherichia coli Using the CRISPR/Cas9 System Research Article Review (2017), 27(7), 1276 1280 https://doi.org/10.4014/jmb.1611.11021 Review Research Article jmb Generation of Newly Discovered Resistance Gene mcr-1 Knockout in Escherichia coli Using the CRISPR/Cas9 System

More information

Tutorial. In Silico Cloning. Sample to Insight. March 31, 2016

Tutorial. In Silico Cloning. Sample to Insight. March 31, 2016 In Silico Cloning March 31, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com In Silico Cloning

More information

Lauren A. Darling1#, Ann M. Evans1, Kathleen A. Stellrecht1,2, Seela M. Nattanmai1,

Lauren A. Darling1#, Ann M. Evans1, Kathleen A. Stellrecht1,2, Seela M. Nattanmai1, JCM Accepted Manuscript Posted Online 20 September 2017 J. Clin. Microbiol. doi:10.1128/jcm.01185-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 JCM Letter to the Editor Submission

More information

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06 Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift

More information

Mycobacterium tuberculosis and Drug- Resistance Testing

Mycobacterium tuberculosis and Drug- Resistance Testing Mycobacterium tuberculosis and Drug- Resistance Testing Dr. med. Peter Keller, FAMH Medical Microbiology Head Molecular Diagnostics pkeller@imm.uzh.ch 08.03.2018 Molecular Diagnostics 2018 Page 1 Mycobacteria

More information