RNA Part I: Chemical Structure of RNA

Size: px
Start display at page:

Download "RNA Part I: Chemical Structure of RNA"

Transcription

1 RA Part I: Chemical Structure of RA

2 Structural differences between RA and DA

3 Resistance of phosphate esters to basic hydrolysis

4 The 2 - group of RA facilitates chemical cleavage in aqueous a by forming a cyclic phosphate ester

5 Ribonucleases rapidly degrade RA: S2-like attack on phosphate

6 C to U mutation: the thymine methyl group allows the repair machinery To distinguish dt da from du dg Pairs with G Pairs with A!

7 RA adopts A-form helices primarily because of the C.3 endo pucker of the ribose sugar. A form B-form Z-form The major groove of the A-form helix is deep and narrow, the minor groove is wide and shallow.

8 Common RA Secondary Structures

9 RA folds into complex globular structures DA ammerhead ribozyme tra

10 Formation of hairpin (stem-loop) structures by intramolecular base pairing UCG typically forms the loop Structure.

11 Viral RA tertiary structure

12 Primary, Secondary, and Tertiary structure of tra

13 RA Part 2: Chemical Synthesis of RA

14 Monomeric units with 2 protecting group MMTr B R=Si(t-Bu)Me 2 (TBS) P R R=C 2 Si(iPr) 3 (TM) C Silyl ethers are easily cleaved with fluoride ion (TBAF) TBS ethers are sterically bulky and slow the rate of the coupling reaction, decreasing yields in some cases TBS ethers are also sensitive to the basic conditions needed in base deprotection TM ethers overcome these limitations

15 Synthesis of Monomers with Acylated bases

16 Standard deprotection/coupling/capping/oxidation cycle

17 Two step deprotection: basic conditions/fluoride

18 RA polymerases create new strands of RA

19 Inhibitor of RA polymerase

20 Transcription of mra involves many proteins and many regions of DA (Sequences rich in A and T)

21 Major Groove Recognition of DA by Proteins minor groove major groove GC4 Zif268 Lambda repressor Sequence Specific Contacts Arg R C 2 Asp R Asn, Gln R Thr, Ala, (Lys, Tyr) C 2 C 2 R major groove C C C C C 3 C 3 hydrophobic interaction R G C R R A T R

22 TBP: a minor groove binding transcription factor More weakly stacked A T base pairs makes TATA box more flexible

23 Transcription factors bind to DA with high sequence specificity Lac repressor DA sequence mismatch Lac repressor DA sequence match Upon identifying the match sequence, the hinge region forms An α-helix and bends the DA

24 Bacterial gene expression

25 Transcription factors Activators Repressors RAPs GTP cap, methylation (spliceosomes + ribozymes) Poly-A binding protein guides to riboso Ribosome rra, tra uman gene expression

26 The 5 -ends of mra are capped and methylated with SAM

27

28 RA Part 3: Small molecule Binding of RA

29 Early Examples of Small Molecule-RA Binding guanosine R G264 C311 R 2 C arginine R G264 2-aminopurine C311 R R A254 U311 R 2 citrulline R A264 C U311 R Amidine and guanidine functional groups useful in the recognition f A and G!

30 Aminoglycosides are naturally occuring aminosugars that Bind to RA primarily by electrostatic interactions. They Associate with A-form helices in regions where there is a distortion (single base pair bulge) 2 R= eomycin B R 2 R= eomycin-thymine conjugate 2 aminoglycoside binding site A C U C A G U A U G C U A G C U A G C C G G U G C tau exon 10 splicing regulatory element binding site for Mitoxantrone Conjugate designed to target the bulged A base

31 eomycin nestled in the major groove of RA near a 2 bp bulge site

32 Tobramycin in the major groove of RA near a 2bp bulge

33 Intercalators planar aromatic moeities capable of inserting in the base-pair stack of RA again occuring at regions in which the helix is distorted by an internal loop or bulge glycoside g site A C U C A G U A U G C U A G C U A G C C G G U G C tau exon 10 splicing regulatory element binding site for Mitoxantrone Cationic side chains in Major groove Mitoxantrone Ethidium bromide, DAPI, aminoquinolines, netropsin are also bulge binders

34 bulged A Major Groove Minor Groove

35 The eomycin-acridine conjugate has high affinity for A-form nucleic acids: RA, GC-rich DA 2 eo-ac binding site eomycin-acridine conjugate S A UG G G CGCAGCGU C AC A G G GCGUCGCA U single uridine base bulge RRE G A A U 2 Conjugate binds distorted helical region by intercalation and major groove binding

36 elix-threading peptides place groups in the major and minor grooves of RA simultaneously weaker intercalator 2 2 helix threading peptides K D =20 nm U C U A C A U G C G C C G G C C G A A G C U U G C G C U A G U A U C G binding site for helix-threading peptides K D =208 nm Single base pair loop required for binding; no binding observed when loop was removed.

37 Janus-face ligands recognize U-U (RA, or T-T, DA) mismatches CUG repeats implied in myotonic dystrophy

38 Deoxystreptamine dimers selectively bind RA hairpin loops Kd µm µm µm µm

39

40

41 The massive ribosome consists of proteins and RA: rra and tra

42

43 Attachment of amino acid to 3 -adenine tra structure

44

45 Amide bond formation promoted by a ribosomal adenine base

46 pseudouridine

47

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

A. Incorrect! A sugar residue is only part of a nucleotide. Go back and review the structure of nucleotides.

A. Incorrect! A sugar residue is only part of a nucleotide. Go back and review the structure of nucleotides. Organic Chemistry - Problem Drill 24: ucleic Acids o. 1 of 10 1. What are the components of a nucleotide? (A) A sugar residue (B) A sugar residue + a nitrogenous base (C) A sugar residue + a nitrogenous

More information

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure

More information

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription

More information

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are macromolecules composed of chains of mononucleotides joined by phosphodiester bonds. The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are universal

More information

Chem 250 Answer Key In-class Quiz #3v1

Chem 250 Answer Key In-class Quiz #3v1 age 1 of 6 Quiz #3 ame. Chem 250 Answer Key In-class Quiz #3v1 This exam is composed of 20 questions. lease scan them all before starting. As discussed in the course syllabus, honesty and integrity are

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Structural Bioinformatics GENOME 541 Spring 2018

Structural Bioinformatics GENOME 541 Spring 2018 Molecular composition of a rapidly dividing Escherichia coli cell Structural Bioinformatics GENOME 541 Spring 2018 Lecture 4: Nucleic Acids Frank DiMaio (dimaio@uw.edu) The major biopolymers DNA structure

More information

From mechanism to medicne

From mechanism to medicne From mechanism to medicne a look at proteins and drug design Chem 342 δ δ δ+ M 2009 δ+ δ+ δ M Drug Design - an Iterative Approach @ DSU Structural Analysis of Receptor Structural Analysis of Ligand-Receptor

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

Biochemistry 302. Exam 2. March 10, Answer Key

Biochemistry 302. Exam 2. March 10, Answer Key 1 Biochemistry 302 Exam 2 March 10, 2004 Answer Key 2 Biochemistry 302, Spring 2004 Exam 2 (100 points) Name I. Short answer 1. Identify the 5 end, 3 end, amino acid acceptor nucleoside, and bases comprising

More information

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

The Stringent Response

The Stringent Response The Stringent Response When amino acids are limiting a response is triggered to shut down a wide range of biosynthetic processes This process is called the Stringent Response It results in the synthesis

More information

Chapter 11 Nucleic Acids and Protein Synthesis

Chapter 11 Nucleic Acids and Protein Synthesis Chapter 11 ucleic Acids and Protein Synthesis Molecular Biology Biomolecules are synthesized in the same order. replication general transfer: occurs normally in cells transcription translation special

More information

Chapter Fundamental Molecular Genetic Mechanisms

Chapter Fundamental Molecular Genetic Mechanisms Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise

More information

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words).

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words). 1 Quiz1 Q1 2011 Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words) Value Correct Answer 1 noncovalent interactions 100% Equals hydrogen bonds (100%) Equals H-bonds

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information

Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA

Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA 1 Biochemistry 302, February 11, 2004 Exam 1 (100 points) Name I. Structural recognition (very short answer, 2 points each) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed

More information

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO

More information

Figure A summary of spontaneous alterations likely to require DNA repair.

Figure A summary of spontaneous alterations likely to require DNA repair. DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic

More information

Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background:

Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background: Molecular biology WID 602 - Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background: DNA and RNA each consists of only four different nucleotides.

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Chapters 31-32: Ribonucleic Acid (RNA)

Chapters 31-32: Ribonucleic Acid (RNA) Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine

More information

DNA and RNA are both made of nucleotides. Proteins are made of amino acids. Transcription can be reversed but translation cannot.

DNA and RNA are both made of nucleotides. Proteins are made of amino acids. Transcription can be reversed but translation cannot. INFORMATION TRANSFER Information in cells Properties of information Information must be able to be stored, accessed, retrieved, transferred, read and used. Information is about order, it is basically the

More information

Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No

Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

30 Gene expression: Transcription

30 Gene expression: Transcription 30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes

More information

Nucleic Acids: Information Storage & Expression

Nucleic Acids: Information Storage & Expression ucleic Acids: Information Storage & Expression I. ITRDUCTI A. Why you are like your parents, and your kids are (will be) like you? (Identical twins?) 1. Inherited traits result from the transfer of specific

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different

More information

Spring 2006 Biochemistry 302 Exam 2

Spring 2006 Biochemistry 302 Exam 2 Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

Nucleic Acids. Information specifying protein structure

Nucleic Acids. Information specifying protein structure Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information

More information

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

GENETICS - CLUTCH CH.7 DNA AND CHROMOSOME STRUCTURE.

GENETICS - CLUTCH CH.7 DNA AND CHROMOSOME STRUCTURE. !! www.clutchprep.com COCEPT: DA AS THE GEETIC MATERIAL DA wasn t always thought of as the genetic material To be genetic material, a molecule needs to have certain - Store information - Transmit information

More information

The discovery of the role of RNA RNA structure, synthesis and function

The discovery of the role of RNA RNA structure, synthesis and function Central Dogma The discovery of the role of RNA RNA structure, synthesis and function! Fundamental observations in genetics!! Genes are located in nuclei (in eukaryotes)!! Polypeptides are synthesised in

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

BASIC MOLECULAR GENETIC MECHANISMS Introduction:

BASIC MOLECULAR GENETIC MECHANISMS Introduction: BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:

More information

The Central Dogma. DNA makes RNA makes Proteins

The Central Dogma. DNA makes RNA makes Proteins The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF

More information

Drug DNA interaction. Modeling DNA ligand interaction of intercalating ligands

Drug DNA interaction. Modeling DNA ligand interaction of intercalating ligands Drug DNA interaction DNA as carrier of genetic information is a major target for drug interaction because of the ability to interfere with transcription (gene expression and protein synthesis) and DNA

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline

More information

(Due Sept 9 th ) Problem Set 2

(Due Sept 9 th ) Problem Set 2 Problem Set 2 (Due Sept 9 th ) 1. Consider these two polynucleotides: AAGCGT GCACTG a. Draw each molecule in the 2 deoxy form (DNA). SEE BELOW b. What is the sequence of the complementary strand? Write

More information

Programme Good morning and summary of last week Levels of Protein Structure - I Levels of Protein Structure - II

Programme Good morning and summary of last week Levels of Protein Structure - I Levels of Protein Structure - II Programme 8.00-8.10 Good morning and summary of last week 8.10-8.30 Levels of Protein Structure - I 8.30-9.00 Levels of Protein Structure - II 9.00-9.15 Break 9.15-11.15 Exercise: Building a protein model

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids ucleotides and ucleic Acids ucleotides: Composed of a sugar; a weak nitrogenous base; at least one phosphoryl group - - P - C 2 Base *ucleoside: sugar + base 2 Classes of ucleotides: Ribonucleotides and

More information

DNA & DNA : Protein Interactions BIBC 100

DNA & DNA : Protein Interactions BIBC 100 DNA & DNA : Protein Interactions BIBC 100 Sequence = Information Alphabet = language L,I,F,E LIFE DNA = DNA code A, T, C, G CAC=Histidine CAG=Glutamine GGG=Glycine Protein = Protein code 20 a.a. LIVE EVIL

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,

More information

BIOLOGY. Chapter 15 Genes & Proteins

BIOLOGY. Chapter 15 Genes & Proteins BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Nucleic acid and protein Flow of genetic information

Nucleic acid and protein Flow of genetic information Nucleic acid and protein Flow of genetic information References: Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology: Principles and Applications of Recombinant DNA, ASM Press, Washington DC, pages.

More information

Gene and DNA structure. Dr Saeb Aliwaini

Gene and DNA structure. Dr Saeb Aliwaini Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,

More information

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna? Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any

More information

Notes: (Our Friend) DNA. DNA Structure DNA is composed of 2 chains of repeating. A nucleotide = + +

Notes: (Our Friend) DNA. DNA Structure DNA is composed of 2 chains of repeating. A nucleotide = + + Notes: (Our Friend) DNA Some DNA Basics DNA stands for DNA functions to & genetic info. This information tells an organism s cells what to make and when to make them. Proteins form cell structures and

More information

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic

More information

Q. No. 1. How can RNA be distinguished from DNA?

Q. No. 1. How can RNA be distinguished from DNA? Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,

More information

CHEM-E8130 Medicinal Chemistry

CHEM-E8130 Medicinal Chemistry CEM-E8130 Medicinal Chemistry Lecture 9: RA/DA Mimicry & Interference Jan Deska Laboratory of rganic Chemistry 01.12.2016 DA & RA structurally rather low level of diversity o o o four nucleobases (compared

More information

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Proteins Amides from Amino Acids

Proteins Amides from Amino Acids Chapter 26 and Chapter 28 Proteins Amides from Amino Acids Amino acids contain a basic amino group and an acidic carboxyl group Joined as amides between the ¾NH 2 of one amino acid and the ¾CO 2 H to the

More information

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK?

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? Learning Outcomes All: Will be able to describe simple steps in protein synthesis: Transcription and Translation and be able to distinguish between them.

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.

Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. DNA ORIENTATION Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. Non-standard base pairs Wobble and mismatched base pairs still use

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related

More information

Unit 1. DNA and the Genome

Unit 1. DNA and the Genome Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression

More information

7.05 Recitation Schedule

7.05 Recitation Schedule 7.05 Spring 004 February 13, 004 7.05 Recitation Schedule Contact Information TA: Victor Sai Recitation: Friday, 3-4pm, -13 E-mail: sai@mit.edu ffice ours: Friday, 4-5pm, -13 Spring 004 Calendar Sun Monday

More information

Structure/function relationship in DNA-binding proteins

Structure/function relationship in DNA-binding proteins PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA

More information

Nucleic Acids. OpenStax College. 1 DNA and RNA

Nucleic Acids. OpenStax College. 1 DNA and RNA OpenStax-CNX module: m44403 1 Nucleic Acids OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 4.0 By the end of this section, you will be

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.

RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA. RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Dusty Carroll Lesson Plan 6: DNA to RNA How Protein Synthesis Works

Dusty Carroll Lesson Plan 6: DNA to RNA How Protein Synthesis Works Dusty Carroll Lesson Plan 6: DA to RA ow Protein Synthesis Works Target Audience AP chemistry class. I ll be assuming they have the appropriate background knowledge of the structure of DA and RA and proteins

More information

وراثة األحياء الدقيقة Microbial Genetics

وراثة األحياء الدقيقة Microbial Genetics وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in

More information

Nafith Abu Tarboush DDS, MSc, PhD

Nafith Abu Tarboush DDS, MSc, PhD Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides

More information

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid

More information

RNA: Transcription and Triplet Code

RNA: Transcription and Triplet Code RNA: Transcription and Triplet Code There are Five Kinds of RNA, All of Which are Templated from DNA. The first type of RNA is trna. The "t" stands for "transfer". This RNA is the RNA that transfers amino

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information