Genomics and Transcriptomics of Spirodela polyrhiza
|
|
- Henry Wade
- 6 years ago
- Views:
Transcription
1 Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center
2 Desired Outcomes High-quality genomic reference sequence Transcriptome definition, functional annotation Comparison of several additional accessions
3 Genomic, RNA-Seq Data Spirodela accession 9509 deeply sequenced Additional 8 accessions, low coverage RNA-seq obtained from 9509 and two other accessions under Control and ABA conditions Kuehdorf, Jetschke, Ballani, and Appenroth 2013
4 Analysis Strategy Genome data acquisition Transcriptome data acquisition Data quality control Genome, transcriptome assembly Genome structural annotation Transcriptome functional annotation Differential expression analysis*
5 Genome
6 Data Acquisition Genomic Illumina HiSeq Diverse library set Overlap bp Several mate-pair Illumina HiSeq 2000
7 Quality Control Raw Data Visualize Adaptors Verify Insert Sizes Retain Pairs Only Trim 3 Low Quality Insert Size Stdev Read Length Trimmed Avg Read Length Read Pairs Passed QC 329 Mbp ,630, ,683, ,684, ,328, ,172, ,051, ,983, ,782, ,316,
8 Genomic Data Insert Sizes Distribution, ,000 bp, 26, 23% 180 bp, 31, 28% 5,000 bp, 11, 10% 2,000 bp, 20, 17% 500 bp, 25, 22% Insert size, estimated coverage, fraction of total data.
9 Genome Assembly Several iterations Preliminary assemblies with Velvet, SOAPdenovo Final assembly with AllPathsLG Polished with SSPACE
10 Genome Assembly Statistics Assembly 9509 (Mbp) (152 exp.) 146 (96% of exp.) Scaffolds (#) 774 Scaffolds >= 1 Mbp (#) 32 (4.13%) N50 scaffold length (bp) 4,305,909 L50 scaffold (#) 11 N90 scaffold length (bp) 1,428,181 L90 scaffold (#) 31 Ns (%) 7.7
11 Genomic Physical Coverage Physical Coverage by Library (Total: 370x) Coverage (x) bp 500bp 2,000bp 5,000bp 20,000bp
12 Genome Assembly Quality Assessment Reads used in assembly? Reads align to assembly? Core eukaryotic genes present?
13 Genomic Reads Used, Aligned 180bp 500bp 2,000bp 5,000bp 20,000bp 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Reads Used (%) Reads Align (%)
14 Core Eukaryotic Genes Core Eukaryotic Genes Mapping Approach (CEGMA), Korf lab (korflab.ucdavis.edu/) Search genome for 248 low copy, highly conserved genes Assess completeness of genome
15 Core Eukaryotic Genes Number of Core Genes Identified A.thaliana (99.60%) Complete B.distachyon (99.19%) Partial Z.mays (97.18%) Species (core genes at least partial %) S.polyrhiza (97.18%)
16 Resequencing
17 Resequencing Kuehdorf, Jetschke, Ballani, and Appenroth 2013
18 Resequencing Kuehdorf, Jetschke, Ballani, and Appenroth, 2013
19 Resequencing Data 120 Sequencing Depth of Coverage Coverage Depth Strain
20 Resequencing Variation SNP/INDEL Rate Per Accession 600,000 SNP Positions INDEL Positions 500,000 Num. Positions 400, , , , (0.12%) 9504 (0.39%) 9506 (0.35%) 9316 (0.37%) 9242 (0.37%) 9502 (0.20%) 9511 (0.21%) 9512 (0.29%) 9501 (0.20%) Accession (Total Variant Positions %)
21 Resequencing Assemblies Per accession: ~30x coverage, single library Assembled each using Velvet Mean assembled size: 128 Mbp (~84%) (stdev: 6 Mbp) Mean N50: 15kb (stdev: 1.5kb) Nearly all contigs (>98%) align to 9509 genome assembly Defining structural differences in progress
22 Transcriptome
23 RNA-Seq Data Kuehdorf, Jetschke, Ballani, and Appenroth, 2013
24 RNA-Seq Data Kuehdorf, Jetschke, Ballani, and Appenroth, 2013
25 RNA-Seq Data 250 RNA-Seq Reads per Accession and Treatment No. 101 bp Reads (M) Control 9509 ABA 9316 Control 9316 ABA 9501 Control 9501 ABA
26 Transcriptome Discovery 1. Reference-guided assembly Tophat2 Cufflinks2 2. De novo predictions Maker, informed by assembly SNAP, Augustus, GeneMarkHMM Iteratively trained SNAP
27 (1) Reference-Guided Transcriptome Assembly Align each RNA-seq library (6) to genome For each, define transcripts based on alignments Merge resulting assemblies to discover gene models, alternative splicing Output: Gene, transcripts annotation (GFF3) Transcripts (FASTA)
28 (2) De novo Transcriptome Discovery Discover genes not expressed in RNA-seq experiments Train algorithms on reference-guided assembly 1. Call high-confidence open reading frames in transcript sequences 2. Use transcripts and translated proteins to inform and train de novo gene callers 3. Iteratively train SNAP on resulting output
29 (2) De novo Transcriptome Assembled: 25,090 loci 41,884 transcripts Discovery Of 41,884 transcripts, complete ORF and at least 33 amino acids: 39,076 Initial training using these transcripts and proteins
30 Transcriptome Discovery: Results Preliminary maker output: 28,600 genes Prune: Must have RNA-seq evidence across >= 50% or, >= 100 amino acids with complete ORF Prune bacterial scaffolds Final gene set: 23,495 genes Transcriptome size (nucleic acids): 33 Mbp Mean protein length: 358 amino acids 19,380 (82%) have functional prediction from BLASTP and/or InterProScan
31 Transcriptome Functional Annotation BlastP (77%) 1, InterProScan (66%) ,066 2, ,238 (89%) RNA-Seq Evidence 877 (3.7%)
32 Transcriptome Annotation Brachypodium distachyon Sorghum bicolor Cicer arietinum Setaria italica Solanum lycopersicum Fragaria vesca Zea mays Cucumis sativus Ricinus communis Glycine max Prunus persica Populus trichocarpa Oryza sativa Theobroma cacao Vitis vinifera Annotations by Species
33 Alternative Splicing Genes With Num. Isoforms Num. Genes with Num. Isoforms (log 10) Num. Isoforms
34 Identify Differentially Expressed Genes 250 RNA-Seq Reads per Accession and Treatment No. 101 bp Reads (M) Control 9509 ABA 9316 Control 9316 ABA 9501 Control 9501 ABA
35 Differentially Expressed Genes 1,727 genes identified as significantly differentially expressed 1,105 isoforms identified as significant Molecular verification in progress
36 Ongoing Assemble repetitive elements Assemble, annotate mitochondria, chloroplast Accessions, structural differences Molecular investigation of differentially expressed genes of interest
37 Thank you
Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
More informationGenome Assembly With Next Generation Sequencers
Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationSupplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
More informationHow much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationThe genome of Fraxinus excelsior (European Ash)
The genome of Fraxinus excelsior (European Ash) Elizabeth Sollars, Laura Kelly, Bernardo Clavijo, David Swarbreck, Jasmin Zohren, David Boshier, Jo Clark, Anika Joecker, Sarah Ayling, Mario Caccamo, Richard
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationRNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More information02 Agenda Item 03 Agenda Item
01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application
More informationAnalysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationMAKER: An easy to use genome annotation pipeline. Carson Holt Yandell Lab Department of Human Genetics University of Utah
MAKER: An easy to use genome annotation pipeline Carson Holt Yandell Lab Department of Human Genetics University of Utah Introduction to Genome Annotation What annotations are Importance of genome annotations
More informationNext Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park
Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast
More informationSupplemental Figure 1. Phylogenetic relationship of 128 LCAT-like sequences from 38 plant species. The maximum likelihood tree was generated using
Supplemental Figure 1. Phylogenetic relationship of 128 LCAT-like sequences from 38 plant species. The maximum likelihood tree was generated using the MrBayes program. The land plant LCAT-like sequences
More informationSequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
More informationNGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationWheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
More informationTranscriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)
More informationHaploid Assembly of Diploid Genomes
Haploid Assembly of Diploid Genomes Challenges, Trials, Tribulations 13 October 2011 İnanç Birol Assembly By Short Sequencing IEEE InfoVis 2009 2 3 in Literature ~40 citations on tool comparisons ~20 citations
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationSUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA
SUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA Authors: Li Song, Dhruv S. Shankar, Liliana Florea Table of contents: Figure S1. Methods finding contig connections
More informationDe novo meta-assembly of ultra-deep sequencing data
De novo meta-assembly of ultra-deep sequencing data Hamid Mirebrahim 1, Timothy J. Close 2 and Stefano Lonardi 1 1 Department of Computer Science and Engineering 2 Department of Botany and Plant Sciences
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationBST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1
BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationGenome Assembly and Annotation of Isochrysis Galbana
Genome Assembly and Annotation of Isochrysis Galbana By: Yi Wang Institution: California State University San Marcos Date: May 14, 2014 Abstract Isochrysis Galbana is a species of cocoolithophores, which
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationpmyrsaur78 psosein4+ psosetr1+ psosetr2+
SAUR77 SAUR78 SAUR76 Figure S1 Phylogenetic analysis of Arabidopsis SAUR proteins. The analyses were conducted in MEGA5, using the Neighbor-Joining method. The percentage of replicate trees in which the
More informationRNASEQ WITHOUT A REFERENCE
RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationEucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationwww.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange
More informationRapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;
More informationOverview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
More informationA draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
More informationIntroduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
More informationTaking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013
Taking Advantage of Long RNA-Seq Reads Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013 Overview Proof-of-Principle SMART-cDNA Synthesis PB-SBL size distributions Gene Annotation
More informationCombined final report: genome and transcriptome assemblies
Combined final report: genome and transcriptome assemblies Nadia Fernandez- Trinity assembly, RSEM, Tophat and Cufflinks/Cuffmerge/Cuffdiff pipeline, and MAKER annotation Stephanie Gutierrez Avril Harder
More informationEvidentialGene: Perfect Genes Constructed from Gigabases of RNA Gilbert, Don Indiana University, Biology, Bloomington, IN 47405;
EvidentialGene: Perfect Genes Constructed from Gigabases of RNA Gilbert, Don Indiana University, Biology, Bloomington, IN 47405; gilbertd@indiana.edu Gene construction, not prediction. The decade of gene
More informationGene Prediction Group
Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT
More informationIntroduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
More informationIntroduction to Sequencher. Tom Randall Center for Bioinformatics
Introduction to Sequencher Tom Randall Center for Bioinformatics tarandal@email.unc.edu Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing
More informationRNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
More informationNature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationAssessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
More informationDraft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
More informationHigh throughput sequencing technologies
High throughput sequencing technologies and NGS applications Mei-yeh Lu 呂美曄 High Throughput Sequencing Core Manager g g p q g g Academia Sinica 6/30/2011 Outlines Evolution of sequencing technologies Sanger
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More informationDe novo genome assembly with next generation sequencing data!! "
De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationRNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
More informationCBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
More informationFRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis
FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries
More informationNext Generation Sequencing. Tobias Österlund
Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationGENOME ASSEMBLY FINAL PIPELINE AND RESULTS
GENOME ASSEMBLY FINAL PIPELINE AND RESULTS Faction 1 Yanxi Chen Carl Dyson Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica Rowell Ankit Srivastava Camila Medrano Trochez Venna Wang Seyed Alireza
More informationIntroduction to the MiSeq
Introduction to the MiSeq 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, BeadArray, BeadXpress, cbot, CSPro, DASL, Eco, Genetic Energy, GAIIx, Genome Analyzer, GenomeStudio, GoldenGate,
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationDe Novo Transcript Discovery using Long and Short Reads
De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationData Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationNGS Data Analysis and Galaxy
NGS Data Analysis and Galaxy University of Pretoria Pretoria, South Africa 14-18 October 2013 Dave Clements, Emory University http://galaxyproject.org/ Fourie Joubert, Burger van Jaarsveld Bioinformatics
More informationGenome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
More informationCompute- and Data-Intensive Analyses in Bioinformatics"
Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics
More informationRNA Sequencing Analyses & Mapping Uncertainty
RNA Sequencing Analyses & Mapping Uncertainty Adam McDermaid 1/26 RNA-seq Pipelines Collection of tools for analyzing raw RNA-seq data Tier 1 Quality Check Data Trimming Tier 2 Read Alignment Assembly
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationForm for publishing your article on BiotechArticles.com this document to
Your Article: Article Title (3 to 12 words) Article Summary (In short - What is your article about Just 2 or 3 lines) Category Transcriptomics sequencing and lncrna Sequencing Analysis: Quality Evaluation
More informationSCIENCE CHINA Life Sciences. Comparative analysis of de novo transcriptome assembly
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 156 162 RESEARCH PAPER doi: 10.1007/s11427-013-4444-x Comparative analysis of de novo transcriptome assembly CLARKE Kaitlin 1, YANG
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationQuantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationWet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
More informationGenome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION 1 Supplementary Figures Supplementary Figure 1 Assembly of the P. reichenowi and P. gaboni genome sequences. process. The process by which the genomes were assembled, are detailed
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationWorkflows and Pipelines for NGS analysis: Lessons from proteomics
Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More information1 st transplant user training workshop Versailles, 12th-13th November 2012
trans-national Infrastructure for Plant Genomic Science 1 st transplant user training workshop Versailles, 12th-13th November 2012 Paul Kersey, EMBL-EBI More people, less land Plant genome sequences, 2005
More informationDe Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
More information