Genomic and bioinformatics resources

Size: px
Start display at page:

Download "Genomic and bioinformatics resources"

Transcription

1 Genomic and bioinformatics resources 徐唯哲 Paul Wei-Che HSU Assistant Research Specialist Bioinformatics Core, Institute of Molecular Biology, Academia Sinica, Taiwan, R.O.C. 1 What Bioinformatics Can Do for You Data mining Data analysis Dry lab Experimental verification Wet lab 2 1

2 Data analysis Sequence Analysis RNAi Design Motif Searching DNA Primer Design Pathway Analysis Microarray Analysis Protein Interactions Prediction 3D Structure Modeling 3D Structure Comparison RNA Secondary Structure Prediction Biomolecular Interaction Protein Secondary Structure Prediction Subcellular Localization Prediction Protein Functional (Domain) Analysis NAR Database Summary Paper Category List Nucleotide Sequence Databases RNA sequence databases Protein sequence databases Structure Databases Genomics Databases (non-vertebrate) Metabolic and Signaling Pathways Human and other Vertebrate Genomes Human Genes and Diseases Microarray Data and other Gene Expression Databases Proteomics Resources Other Molecular Biology Databases Organelle databases Plant databases Immunological databases 4 2

3 Data Mining Data mining (knowledge discovery in databases): Extraction of interesting ( non-trivial, implicit, previously unknown and potentially useful) information from data in large databases Genome databases Nucleotide databases Protein databases Structure databases Other databases Watson and Crick propose the double helix model for DNA 1955 The first protein sequence, bovine insulin, is announced by F. Sanger. Establishing a Biotech and genetic engineering November 4, 1988 Bioinformatics booming Structure analysis Gene annotation Genotyping Cross-species comparisons Function annotation Gene regulation analysis 1970 The details of the Needleman-Wunsch algorithm for sequence comparison are published 1977 Protein Data Bank is published The Smith-Waterman algorithm for sequence alignment is published Genetics Computer Group (GCG) created as a part of the University of Wisconsin of Wisconsin Biotechnology Center 1988 The National Center for Biotechnology Information (NCBI) is established at the National Cancer Institute Using of multi-dimensional NMR for protein structure determination The PCR reaction is described by Kary Mullis and co-workers The BLAST program (Altschul, et. al.) is published Begin the Human Genome Project (HGP), an international research program The creation and use of expressed sequence tags (ESTs) is described Microsoft releases version 1.0 of Internet Explorer Affymetrix produces the first commercial DNA chips RNA interference is discovered in C. elegans by Mello and Fire The Human Genome Project (HGP) is completed Next-generation sequencing (NGS) technologies are advancing in quality and applications 3

4 Most commonly used webs in bioinformatics NCBI ( National Center for Biotechnology Information Ensembl ( Ensembl is a joint project between European Bioinformatics Institute (EBI), an outstation of the European Molecular Biology Laboratory (EMBL), and the Wellcome Trust Sanger Institute (WTSI). UCSC ( University of California Santa Cruz 7 NCBI Organizational Structure Computational Biology Branch (CBB) Developing innovative algorithms (BLAST, PSI-BLAST, SEG, VAST, and COGs) and novel research approaches (text neighboring) Information Engineering Branch (IEB) Designing and building NCBI's production software and databases Information Resources Branch (IRB) Plans, directs, and manages the technical operations of NCBI, including the computer systems used for research and development as well as the computer systems used to access public databases 8 4

5 BLAST 9 Basic Local Alignment Search Tool (BLAST)

6 Basic BLAST BLAST Specialized BLAST 11 Request ID 12 6

7 13 Score 1. Score for match = Mismatch penalty = Assume gap opening (GO) penalty = -2 and gap extension (GE) penalty = -1 Expectation Values K = constant (correction for non-independence of possible starting points for matches) m = total length of sequences in database n = length of query sequence λ = scaling constant S = score of the high-scoring sequence pair (HSP) 14 7

8 Basic BLAST BLAST Specialized BLAST 15 Example: Search Conserved Domains on a protein 16 8

9 17 Homolog Homolog: A gene related to a second gene by descent from a common ancestral DNA sequence. Ortholog: Orthologs are genes in different species that have evolved from a common ancestral gene via speciation. Paralog: Paralogs are genes produced via gene duplication within a genome. 18 9

10 Types of Databases Archival or Primary Data Text : PubMed DNA sequence : GenBank/EMBL/DDBJ Protein sequences/structures : PDB (RCSB) Curated or Processed Data Sequences : RefSeq (curated, non-redundant DNA, mrna, protein, etc.) Protein Sequences and Structures : MMDB Organism Maps : Entrez Genomes (human, mouse, yeast, etc.) Genes : LocusLink (loci), Homologene (orthologs), OMIM (disease) Specialized Databases Organism : Maps in Entrez Genomes (human, mouse, yeast, etc) Function : Sequences in UniVec (vectors), UniGene (genes) Sequencing Methods : dbest, dbgss, dbsts, HTG Databases Taxonomy Browser Article Abstracts MedLine VAST Taxonomy Map Viewer Genomes 3-D Structure MMDB BLAST Nucleotide Sequences Protein Sequences BLAST 10

11 Other Databases Genetic Variation dbsnp Cancer Chromosome Aberration CCAP Gene Expression SAGE Cancer Gene Expression CGAP Genetic Disease OMIM Protein Swiss Prot Entrez Homepage 11

12 Ensembl The Ensembl project was started in 1999 the Ensembl group consists of between 40 and 50 people Genebuild team Creates the gene sets for the various species Software team develops and maintains the BioMart data mining tool Comparation, Variation and Functional Genomics teams are responsible for the comparative and the variation and regulatory data, respectively Web team makes sure that all data are presented on the website in a clear and user-friendly way Outreach team answers questions from users and gives workshops 23 Genome browsers Ensembl public site + installable system UCSC Human Genome Browser NCBI Map Viewer 12

13 Ensembl naming conventions ENSG0000XXXX for gene ENST0000XXXX for gene transcripts ENS for human, ENSMUS for mouse, ENSRNO for rat, etc 51 species 26 13

14 Species homepage Species Version Chromosome maps 14

15 Chromosome maps The "MapView" page displays the map of chromosome bands. To the left, feature density plots for genes, GC contents, repetitive sequences and SNPs are shown. Chromosome-overview 15

16 Introduction to BioMart Data mining using BioMart BioMart is a query-oriented data management system developed jointly by the Ontario Institute for Cancer Research (OICR) and the European Bioinformatics Institute (EBI). The system can be used with any type of data and is particularly suited for providing 'data mining' like searches of complex descriptive data. 16

17 UCSC Genome Browser Center for Biomolecular Science and Engineering (CBSE) at the University of California Santa Cruz (UCSC). Photo: Jim MacKenzie 33 UCAC Genome Browser Genome Browser Zooms and scrolls over chromosomes, showing the work of annotators worldwide Gene Sorter Shows expression, homology and other information on groups of genes that can be related in many ways Blat Quickly maps your sequence to the genome. Table Browser Provides convenient access to the underlying database VisiGene Lets you browse through a large collection of in situ mouse and frog images to examine expression patterns Genome Graphs Allows you to upload and display genome-wide data sets 34 17

18 Genome Browser 35 Gene Sorter 36 18

19 Blat 37 Table Browser 38 19

20 VisiGene 39 Genome Graphs 40 20

21 Scenario 1: How to get genes with highest enrichment in embryonic stem cells (ES sells)? 41 Digital Differential Display (DDD) Expressed Sequence Tags (EST) A set of single-pass sequenced cdnas from mrnas derived from a specific tissue or cell population Digital Differential Display (DDD) DDD is a tool for comparing EST profiles in order to identify genes with significantly different expression levels 42 21

22 Step 1: Find UniGene in NCBI 43 Step 2: select species 44 22

23 Step 3: Define pools 45 Step 4: View Results 46 23

24 47 Scenario 2: Get gene sequences 48 24

25 Search Gene for Your gene name

26

27 53 Scenario 3:How to get all human transcription factor gene sequences Promoter analysis TF TF TF TF gene gene gene gene NCBI + Ensembl!! 54 27

28 STEP 1: Use NCBI Search bar to search keywords transcription factors! 56 28

29 STEP 2: Change Display: Summary -> Brief 57 STEP 3: Save file EntrezGene ID Associated Gene Name or HGNC symbol UI List HGNC: HUGO Gene Nomenclature Committee 58 29

30 Save this file 59 STEP 6: Go to Ensembl STEP 7: Click BioMart Ensembl Genome Browser 60 30

31 STEP 8: CHOOSE DATABASE: Select Ensembl STEP 9: CHOOSE DATASET: Select Homo sapiens genes (GRCh37) 62 31

32 STEP 11: Click GENE: STEP 10: Click Filters 63 STEP 12: Check ID list limit : 64 32

33 STEP 13: Select EntrezGene ID(s) 65 STEP 14: Input gene_result.txt or copy paste EntrezGene IDs 66 33

34 STEP 15: Click Attributes 67 STEP 16: Select Sequences STEP 17: Click SEQUENCES 68 34

35 STEP 18: Select Unspliced (Gene) 69 STEP 19: Click Header Information 70 35

36 STEP 21: Click Results STEP 20: Select Associated Gene Name

37 Scenario 4 To retrieve all the human genes in Chromosome I The retrieving gene information includes: Associated Gene Name Start Position (bp) End Position (bp) Strand 1000 bps 5 Upstream Constraints With a 5 UTR GO: : transcription regulator activity Gene Ontology 74 37

38 Fold Change (Log 2 ) 2010/11/22 Overview in the analysis of gene regulatory network PHX 15 1h 4h 8h 12h 24h 36h 48h 3d 4d 7d 10d Gene expression analysis Co-expressed genes - Normalization - Filtering - Clustering TF TF Promoter analysis TF TF gene gene gene gene Regulatory network - Promoter extraction - TF binding site (TFBS) - Motif discovery - Homologous analysis - Co-occurrence of TFBS - TF and targets - protein-protein interaction - pathway - protein modification 75 How to measure similarity between expression patterns? The Pearson correlation coefficient. Pearson s correlation coefficient measures the linear association between two sets of pairs {x i } and {y i } n ( y i y)( x i x) r i 1 x y n n 2 2 ( y i y) ( x i x) i 1 i 1 {x i } and {y i } are the paired percentage errors for multiplicative models {x i } and {y i } are the paired residuals for additive models 76 38

39 An illustrative Example 77 Log 2 Ratio (experimental/control) 78 39

40 Pearson s Correlation Coefficients 79 Hierarchical Clustering 80 40

41 Fold Change (Log 2 ) 2010/11/22 K-means Clustering 81 Co-expressed Gene Groups Co-expressed genes PHX 15 1h 4h 8h 12h 24h 36h 48h 3d 4d 7d 10d

42 HCE - Hierarchical Clustering Explorer 83 Gene regulation database: TRANSFAC 84 42

43 TRANSFAC a database on gene transcription regulation contains GENE encodes for SITE binds to and regulates FACTOR interacts is used to construct is an attribute of MATRIX TRANSFAC: FACTOR table, protein sequence 43

44 TRANSFAC: FACTOR table, protein domains TRANSFAC: FACTOR table, structural and functional features 44

45 TRANSFAC: FACTOR table, links to other databases TRANSFAC: classification of transcription factors 45

46 TRANSFAC: CLASS table TRANSFAC: FACTOR table, protein-dna and protein-protein interactions 46

47 TRANSFAC: MATRIX table TM Two important parameters matrix and core similarities in MATCH. TF matrix actgcgaattatcgc tacacgaatagaagc agcgcgaattgacct aatgcgaattaacgc core 47

48 TRANSFAC: Match TM tool TRANSFAC: Match TM output 48

49 Pathway Analysis & Data Mining for Gene Expression MetaCore (commercial ) Choose from ten network-creating algorithms and multiple filters for optimal data mining Take advantage of the annotated content database that took over 100 man-years to assemble Over 2,000 interactive maps with consensus knowledge of human biology and diseases Visualize mouse, rat, worm, fly, yeast, chimpanzee, bovine, zebrafish, mosquito, mold, rice, arabidopsis, candida, plasmodium and dog data on maps and networks Pathway Studio (commercial ) Find pathways and gene ontology groups affected in an experiment Overlay expression data on canonical pathways and visualize the effects Identify significant genes from a network relevance prospective Build new pathways/regulation networks using molecular and functional relationship information extracted from publicly available literature visant (free!) 97 MetaCore Pathway Studio visant 98 49

50 : Integrative Visual Analysis Tool for Biological Networks and Pathways Hu, Z., Mellor, J., Wu, J. and DeLisi, C. (2004) VisANT: an online visualization and analysis tool for biological interaction data. BMC Bioinformatics, 5,

51 Introduction VisANT, an application for integrating biomolecular interaction data into a cohesive, graphical interface offers an online interface for a large range of published data sets on biomolecular interactions, including those entered by users integrated with standard databases for organized annotation, including GenBank, KEGG and SwissProt 101 URL:

52 Searching the Protein/Gene 103 Searching KEGG Pathway and Chemical Compounds

53 Load Your Own Data 105 ClustalW: Multiple Sequence Alignment

54 Multiple Sequence Alignment MSA is the process of finding the similarities among multiple sequences. 107 Sequence Homology Multiple Sequence Alignment E.g. ClustalW: A MSA Software S 1 S 2 S 3 S 4 A-CGTGCA ACCGTGCA A-CGTGC- A-CTTGCA * * *** *Match Insertion Deletion Substitution Distances Between Sequences E.g. Phylip: Neighbor-Joining Algorithm Constructing Evolutionary Trees S 1 S 2 S 3 S 4 S S S 3 5 S 4 S 1 S 2 S 3 S

55 Multiple sequence alignment: ClustalW

56 Results Phylogenetic tree

57 Motif Prediction 113 DNA Sequence

58 DNA Sequence Multiple Em for Motif Elicitation Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp , AAAI Press, Menlo Park, California,

59 Motif discovery tools: MEME 117 URL: Get the result by

60

61 121 Summary of motifs

62 melina II : A sequence logo generator Schneider TD, Stephens RM Sequence Logos: A New Way to Display Consensus Sequences. Nucleic Acids Res. 18 Crooks GE, Hon G, Chandonia JM, Brenner SE WebLogo: A sequence logo generator, Genome Research, 14: , (2004)

63 URL: Motifs can mutate on non important bases The five motifs at top right have mutations in position 3 and 5 Representations called motif logos illustrate the conserved regions of a motif Motif Logo TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA

64 TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA 5 TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA TGGGGGA TGAGAGA TGGGGGA : : 100 Entropy Define frequencies for the occurrence of each letter in each column p A = 1 or p A = 0.75, p T = 0.25 Compute entropy of each column X A, T, G, C p X log p X

65 Entropy: Example A A entropy 0 A A Best case 1. AATGAGGGA 2. ATTGTGAGA 3. ACTGCGGGA 4. AGTGGGAGA Worst case A T entropy G C 1 1 log ( 2) Entropy of an Alignment: Example column entropy: -( p A logp A + p C logp C + p G logp G + p T logp T ) A A A A C C A C G A C T Column 1 = -[1*log(1) + 0*log0 + 0*log0 +0*log0] = 0 Column 2 = -[( 1 / 4 )*log( 1 / 4 ) + ( 3 / 4 )*log( 3 / 4 ) + 0*log0 + 0*log0] = -[ ( 1 / 4 )*(-2) + ( 3 / 4 )*(-.415) ] = Column 3 = -[( 1 / 4 )*log( 1 / 4 )+( 1 / 4 )*log( 1 / 4 )+( 1 / 4 )*log( 1 / 4 ) +( 1 / 4 )*log( 1 / 4 )] = 4* -[( 1 / 4 )*(-2)] = +2 Column_height = 2 column_entropy

66 Motif Logos: An Example ( NATURE REVIEWS GENETICS, VOLUME 5,APRIL 2004,

67 133 BioPHP Minitools

68

69

70 139 Tools Summary IMB Bioinformatics Core (online tools & DB) EMBOSS BioPHP Genomic Databases Ensembl Genome Browser UCSC Genome Bioinformatics Home NCBI HomePage GeneCards Homepage Alignment ClustalW and others (Max-Planck) BLAST Motif Discovery The MEME Suite Melina II WebLogo

71 Thanks for your attention

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

user s guide Question 1

user s guide Question 1 Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

NCBI Molecular Biology Resources. Entrez & BLAST. Entrez: Database Integration. Database Searching with Entrez. WWW Access. Using Entrez.

NCBI Molecular Biology Resources. Entrez & BLAST. Entrez: Database Integration. Database Searching with Entrez. WWW Access. Using Entrez. NCBI Molecular Biology Resources Using Entrez WWW Access Entrez & BLAST March 2007 Phylogeny Entrez: Database Integration Taxonomy PubMed abstracts Genomes Word weight 3-D Structure VAST Neighbors Related

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu.   handouts, papers, datasets Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Guided tour to Ensembl

Guided tour to Ensembl Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement

More information

Microarray Data Analysis in GeneSpring GX 11. Month ##, 200X

Microarray Data Analysis in GeneSpring GX 11. Month ##, 200X Microarray Data Analysis in GeneSpring GX 11 Month ##, 200X Agenda Genome Browser GO GSEA Pathway Analysis Network building Find significant pathways Extract relations via NLP Data Visualization Options

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

ab initio and Evidence-Based Gene Finding

ab initio and Evidence-Based Gene Finding ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Klinisk kemisk diagnostik BIOINFORMATICS

Klinisk kemisk diagnostik BIOINFORMATICS Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,

More information

Identifying Regulatory Regions using Multiple Sequence Alignments

Identifying Regulatory Regions using Multiple Sequence Alignments Identifying Regulatory Regions using Multiple Sequence Alignments Prerequisites: BLAST Exercise: Detecting and Interpreting Genetic Homology. Resources: ClustalW is available at http://www.ebi.ac.uk/tools/clustalw2/index.html

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent

More information

Protein Architecture: Conserved Functional Domains

Protein Architecture: Conserved Functional Domains PROTOCOL Protein Motif Analysis compiled by John R. Finnerty Protein Architecture: Conserved Functional Domains Proteins are like machines in that different parts of the protein perform different sub-functions,

More information

Lecture 7 Motif Databases and Gene Finding

Lecture 7 Motif Databases and Gene Finding Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC

More information

Training materials.

Training materials. Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html

More information

DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences

DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences Huiqing Liu Hao Han Jinyan Li Limsoon Wong Institute for Infocomm Research, 21 Heng Mui Keng Terrace,

More information

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo South African National Bioinformatics Institute University of the Western Cape RELEVEANCE OF DATA SHARING! Fragmented data

More information

Introduction to NGS analyses

Introduction to NGS analyses Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

More information

March Product Release Information. About IPA. IPA Spring Release (2016): Release Notes. Table of Contents

March Product Release Information. About IPA. IPA Spring Release (2016): Release Notes. Table of Contents IPA Spring Release (2016): Release Notes Table of Contents IPA Spring Release (2016): Release Notes... 1 Product Release Information... 1 About IPA... 1 What s New in the IPA Spring Release (March 2016)...

More information

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.

Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy

More information

Deakin Research Online

Deakin Research Online Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM

More information

Training materials.

Training materials. Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org

More information

Aaditya Khatri. Abstract

Aaditya Khatri. Abstract Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

earray 5.0 Create your own Custom Microarray Design

earray 5.0 Create your own Custom Microarray Design earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries. PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,

More information

In silico identification of transcriptional regulatory regions

In silico identification of transcriptional regulatory regions In silico identification of transcriptional regulatory regions Martti Tolvanen, IMT Bioinformatics, University of Tampere Eija Korpelainen, CSC Jarno Tuimala, CSC Introduction (Eija) Program Retrieval

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Entrez Gene: gene-centered information at NCBI

Entrez Gene: gene-centered information at NCBI D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National

More information

File S1. Program overview and features

File S1. Program overview and features File S1 Program overview and features Query list filtering. Further filtering may be applied through user selected query lists (Figure. 2B, Table S3) that restrict the results and/or report specifically

More information

Browsing Genes and Genomes with Ensembl

Browsing Genes and Genomes with Ensembl Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

Current questions in science. How can Bioinformatics help to to solve them?

Current questions in science. How can Bioinformatics help to to solve them? Current questions in science How can Bioinformatics help to to solve them? Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome

More information

Challenging algorithms in bioinformatics

Challenging algorithms in bioinformatics Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use

More information

Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University

Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing

More information