Multiplex PCR reaction
|
|
- Millicent Griffin
- 6 years ago
- Views:
Transcription
1 Multiplexed Detection of Pathogens using Fluorescence Resonance Energy Transfer in a Spatial Detection Format Multiplex PCR reaction Bruce Applegate Collaborators: Sergei Savikhin Pina Fratamico Wilfredo Dominguez Hanyoup Kim Alex Aimet (Proligo) Michael Kane Beacon detection Multiplex PCR primer and beacon binding sites in target genes from L. monocytogenes, Salmonella spp, and E. coli O157:H7 Multiplex PCR reaction 600bp INVA SIPB FIMY SPVC FLICH7 STX2 STX1 EAEA HLYC RFBE IAP HLYA PRFA INLA SIPC Analysis of multiplex PCR reactions Capillary Electrophoresis (traces poster) ROX standard 100bp JOE, FAM and NED tagged Primers for PCR PCR of multiplex PCR primer pairs Multiplex PCR One reaction with 12 genes Three reactions with four genes for each pathogen 1
2 spvc sipc sipb inva prfa hlya inla iap Capillary electrophoretic fragment analysis for multiplex PCR from S. Enteritidis with approximately four copies of genomic DNA in 25 µl. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) Capillary electrophoretic fragment analysis for multiplex PCR from L. monocytogenes with approximately four copies of genomic DNA in 25 µl. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) eaea rfbe stxi hlyc sipb inva sipc eaea prfa hlya rfbe stxi spvc inla iap hlyc Capillary electrophoretic fragment analysis for multiplex PCR from E. coli O157:H7 gene fragments with approximately four copies of genomic DNA in 25 µl. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) Capillary electrophoretic fragment analysis for multiplex PCR with approximately 4x10 3 copies of genomic DNA in 25 µl from E.coli O157:H7, S. Enteritidis, and L. monocytogenes. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) eaea mpcr results for E. coli O157:H7 inoculated ground beef rfbe stxii hlyc Fragment analysis using capillary electrophoresis of a positive multiplex PCR from E. coli O157:H7 inoculated beef. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) 2
3 mpcr results for S. enteritidis inoculated on lettuce sipc spvc sipb inva Fragment analysis using capillary electrophoresis of a positive multiplex PCR from S. Enteritidis inoculated lettuce. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) mpcr results for L. monocytogenes inoculated hotdogs prfa hlya inla iap Fragment analysis using capillary electrophoresis of a positive multiplex PCR from L. monocytogenes inoculated hot dog. (The red peaks represent the size standard ROX. The green, blue, and black peaks represent the multiplex PCR products from the fluorescently labeled primers with JOE, FAM, and NED respectively. The X axis represents the electrophoresis time.) Beacon Concept Complementary strand Beacon detection Target strand A B C Molecular beacon closed (A), open (B), and hybridized (C). 3
4 Fluorescence of iap (Listeria) in solution with cy-3 and cy-5 dye labeled 1 Spatial format detection Fluorescence (a. u.) 0.5 A B C - control Wavelength (nm) 70 C (black, line) => 55 C (blue, line) => 40 C (red) => 55 C (blue, circle) => 70 C (black, circle) + control Arrayer (Genomic Solutions) Michael Kane Scanner (Genomic Solutions) Michael Kane Preliminary array experiments Preliminary array experiments Unhybridized beacon Hybridized beacon Target beacon eae Target beacon eae hybridized with complimentary oligo 4
5 Prototype Detector Microarray A. Results from 3 different microarrays hybridized with control (no DNA, top row), ng/ul of DNA (1:50 dilution of the PCR products, middle row), and 5-10 ng/ul of DNA (1:10 dilution of PCR products, bottom row). Note that in the absence of target DNA, the microarray features appear red due to FRET signaling (B), and in the presence of target DNA the microarray features appear green due to the absence of FRET signaling (C). Simplified setup of the biosensor. ND: neutral density filter, TS: translation stage, FL: collimating lens, FW: interference filter wheel, PMT: photomultiplier. TS and FW are pc-controlled and the data from PMT are sent to pc and analyzed. Two interference filters of 570 nm and 670 nm are switched during each measurement. The picture of the working biosensor prototype with the cover open. All components of the system are housed in a dark box. The green line in the picture is following the path of the green exciting laser (532 nm) which is hitting the target MB spot. The close view of the MB arrayed slide with the laser on. During the measurement, the neutral filters will be inserted at the output of the laser to adjust the intensity of the excitation. The temporary manual translation stage for the adjustment of the vertical height of the slide is also seen. The screen shot of the biosensor controlling software. (A) Individual measurement control with the choice of spot position and filter. (B) The status box showing the position, filter choice and PMT measurement at each spot. (C) The automated scan result is shown here and real time analysis is presented. 5
6 Summary Individual four gene mpcrs were able to yield a detectable signal with as low as four copies of template chromosomal DNA Collective twelve gene mpcr was able to yield a detectable signal with 4E+03 copies of template chromosomal DNA Summary The method to extract the DNA from the samples was inefficient for L. monocytogenes in hotdogs Array detection of PCR products using the beacon approach was successful Prototype detection device has been completed and is currently being evaluated An enrichment step was necessary to yield a detectable signal in all three cases Acknowledgments Purdue University Agriculture Research Programs Center for Food Safety Engineering, Purdue University Purdue core sequencing facility National Aeronautics and Space Administration USDA/ARS cooperative agreement Future work Evaluating array with multiple beacons Optimizing hybridization parameters Design and develop a hand held device for scanning array incorporating a peltier heating and cooling block Purdue Research Foundation Trask Fund 6
Multi-pathogen Screening and/or Confirmation via Microarray Detections. Bruce Applegate, Sergei Savikhin and Michael Kane
Multi-pathogen Screening and/or Confirmation via Microarray Detections Bruce Applegate, Sergei Savikhin and Michael Kane Multiplex PCR Detect multiple target DNA sequences Multiple organism detection Reduction
More informationMultiplex PCR. Bruce Applegate, Michael Kane and Sergei Savikhin. Analysis of multiplex PCR reactions. Detect multiple target DNA sequences
Improved Detection Techniques for Food Borne Pathogens Use of Multi-Plex Detection Platforms Bruce Applegate, Michael Kane and Sergei Savikhin Multiplex PCR Detect multiple target DNA sequences Multiple
More informationNanoparticle-based DNA multiplexed probes for pathogen detection using confocal raman microscopy
/4/27 Nanoparticle-based DNA multiplexed probes for pathogen detection using confocal raman microscopy PI: Joseph Irudayaraj, Purdue University Collaborator: Chobi Debroy, Penn State University Graduate
More informationConsiderations Dynamic Range Detection Linearity Components Software Comparing qpcr Instrumentation Sensitivity Specificity of Detection sigma.
Considerations When Higuchi et. al 1 designed a qpcr system, a conventional PCR block, a UV light source and a camera for signal detection were the instruments used. Since the design of the first qpcr
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationOptimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.
Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.
More informationMLPA assays on the SeqStudio Genetic Analyzer
APPLICATION NOTE MLPA assays on the SeqStudio Genetic Analyzer SeqStudio Genetic Analyzer In this application note, we demonstrate that: The new Applied Biosystems SeqStudio Genetic Analyzer generates
More informationPulseNet MLVA protocols General overview
PulseNet MLVA protocols General overview Eija Trees, Ph.D., D.V.M. PulseNet Methods Development and Reference Unit Enteric Diseases Laboratory Branch CDC, Atlanta, GA 1 Multiple-Locus VNTR Analysis (MLVA)
More informationPERFORMANCE MADE EASY REAL-TIME PCR
PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationBiochemistry. Dr. Shariq Syed. Shariq AIKC/FinalYB/2014
Biochemistry Dr. Shariq Syed Shariq AIKC/FinalYB/2014 What is DNA Sequence?? Our Genome is made up of DNA Biological instructions are written in our DNA in chemical form The order (sequence) in which nucleotides
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationThe Agilent Total RNA Isolation Kit
Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationQPCR Designed for You. Superior Instruments, Reagents, and Support.
QPCR Designed for You Superior Instruments, Reagents, and Support. Agilent s portfolio of qpcr products delivers speed, reliability, and above all confidence in your results. Technology Designed for You
More informationBENG 183 Trey Ideker (the details )
BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and
More informationNeogen Rapid Listeria Solutions: ANSR -More Sensitive than ISO. Listeria Right Now Results in 1 hour. Antonio Debán Valles
Neogen Rapid Listeria Solutions: ANSR -More Sensitive than ISO Listeria Right Now Results in 1 hour Antonio Debán Valles Microbiology Application Specialist Neogen Corporation The World s leading Animal
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationAttostar T4 Bacteriophage As a DNA extraction and PCR control
Attostar T4 Bacteriophage As a DNA extraction and PCR control Overview:... 2 Products Catalog No. Quantity... 2 AttoMaster 2X Mix for qpcr AM10 1.25 ml... 2 T4 bacteriophage DNase resistant BAC130 0.5
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More information13-2 Manipulating DNA Slide 1 of 32
1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study
More informationLab 1: Ensemble Fluorescence Basics
Lab 1: Ensemble Fluorescence Basics This laboratory module is divided into two sections. The first one is on organic fluorophores, and the second one is on ensemble measurement of FRET (Fluorescence Resonance
More informationAffymetrix Processing of ChIP or DamID DNA to GeneChip Drosophila Tiling 2.0R Array
http://www.flychip.org.uk/affy_chip.php Affymetrix Processing of ChIP or DamID DNA to GeneChip Drosophila Tiling 2.0R Array Outline For the following protocol 7.5 µg DNA containing dutp (see the corresponding
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationFor outstanding performance in real-time PCR
Rotor-Gene Q For outstanding performance in real-time PCR Outstanding thermal and optical performance due to rotary format An unmatched optical range spanning UV to infrared wavelengths State-of-the art
More informationSanger Sequencing: Troubleshooting Guide
If you need help analysing your Sanger sequencing output, this guide can help. CONTENTS 1 Introduction... 2 2 Sequence Data Evaluation... 2 3 Troubleshooting... 4 3.1 Reviewing the Sequence... 4 3.1.1
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationReal-Time PCR. Real-Time PCR meets Automation qtower 3 auto
Real-Time PCR Real-Time PCR meets Automation qtower 3 auto 2 qtower 3 auto qtower³ auto is ideally suited for connecting quantitative real-time PCR with robotic systems. Integration is simply a matter
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationQuantitative PCR Systems
QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE Mx3005P System FULL-FEATURED
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationReal Time PCR. Advanced Biotechnology Lab I Florida Atlantic University April 2, 2008
Real Time PCR Advanced Biotechnology Lab I Florida Atlantic University April 2, 2008 Introduction We wish to compare the expression levels of our gene under study (Drosophila MsrA) for two different treatment
More informationGenotyping Manual. KASP version 4.0. P Robinson Dr J Holme
Genotyping Manual 0 g KASP version 4.0 SNP Genotyping Manual P Robinson Dr J Holme 26 th May 2011 Contents KASP version 4.0 SNP Genotyping Manual Introduction Improvements of KASP version 4.0 Principal
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationIsothermal amplification system based on template-dependent extension
Electronic Supplementary Information (ESI) Isothermal amplification system based on template-dependent extension 1. Experimental Section The molecular beacon (Takara Biotechnology Co., Ltd. Dalian, China)
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationAPPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS
APPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS Hossein Keyvani Basic Diagnostic Methods in Virology Immunology and serology techniques (Antigen-Antibody Reactions) 1 ELISA ( Enzyme
More information7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes
Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect
More informationHigh-throughput detection of Shiga toxin-producing Escherichia coli using multiplex PCR and the QIAxcel Advanced system
Application Note High-throughput detection of Shiga toxin-producing Escherichia coli using multiplex PCR and the QIAxcel Advanced system Jianfa Bai, Ph.D., Director of Molecular Research and Development
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationDUPLICα REAL TIME SALMONELLA
Instruction Manual DUPLICα REAL TIME SALMONELLA Code EBR004032 Format 32 tests For in Vitro Use Only Store the kit components at +2-8 C Euroclone Life Sciences: Via Figino, 20/22-20016 Pero (MI) ITALY
More informationLabChip 90 System with DataViewer Software
Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic
More informationProcomcure Biotech. PCR Reagents
Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR
More informationAmpFlSTR Identifiler PCR Amplification Kit
Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationMicroarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation
Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationGENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
More informationInnovations To Meet Your Needs
Innovations To Meet Your Needs Cooled CCD Camera 1340 x 1037 pixel resolution for greatest image quality 12-bit precision provides 3 orders of linear dynamic range Windows and Power Macintosh Software
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationGENOMICS RESEARCH LABORATORY Sample Submission Requirements
Sanger Sequencing GENOMICS RESEARCH LABORATORY Sample Submission Requirements The quality of the starting template is the key factor in the quality of DNA sequence data. Sequencing by capillary electrophoresis
More informationAim of lecture:to get an overview of the whole process of microarrays, from study design to publication
Microarray pipeline Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Rita Holdhus Intoduction to Microarray technology September 2010 Many of the
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationUnit 3c. Microbial Gene0cs
Unit 3c Microbial Gene0cs Microbial Genetics! Gene0cs: the science of heredity Genome: the gene0c informa0on in the cell Genomics: the sequencing and molecular characteriza0on of genomes Gregor Mendel
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationExploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION
Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Purpose: In this laboratory, we will set up a polymerase chain reaction to amplify the region of the caffeine
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationFunctional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook
More informationGenome Analysis. Bacterial genome projects
Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationSYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General
More informationNRAS Codon 61 Mutation Analysis Reagents
NRAS Codon 61 Mutation Analysis Reagents User Manual V1.0 Cat No. GP19 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment Required
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationPRECISE AND POWERFUL MOLECULAR PATHOGEN DETECTION
PRECISE AND POWERFUL MOLECULAR PATHOGEN DETECTION RAPID FOOD SAFETY YOU CAN RELY ON Food companies, service labs and government regulators around the world rely on the Hygiena BAX System, which uses the
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationCharacterization of the Pipette Wash Station for SNP Genotyping and Presence/Absence Testing on the Nexar System
PARTNERING WITH YOU TO MAKE THE WORLD A BETTER PLACE SNP Genotyping and Presence/Absence Testing on the Nexar System ABSTRACT A set of experiments was completed to demonstrate the efficacy of the Nexar
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationCALR Mutation Analysis Reagents
CALR Mutation Analysis Reagents User Manual V1.0 Cat No. GP20 32 reactions 1 CONTENTS Introduction 4 Materials Provided 4 Materials Required 5 Equipment Required 5 DNA Sample Preparation 6 Sequencer Setup
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationMulti-well formats. Overview method. Typical applications. 16-well slide. Surveillance chips 96-well SBS microplate
Multi-well formats Overview Formats Immobilization method Typical applications 16-well slide Various Surveillance chips 96-well SBS microplate Virus or bacterial identification Molecular diagnostics Dose
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationQuantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging
Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging Introduction In this application note, we will discuss the application of quantum dots in fluorescence imaging, both
More informationPATHOGENS DETECTION VIA PCR WITH AUTOMATED SAMPLE PREPARATION BASED ON IMMUNOMAGNETIC SEPARATION (IMS) mrama Workshop Barcelona 22 November 2017
PATHOGENS DETECTION VIA PCR WITH AUTOMATED SAMPLE PREPARATION BASED ON IMMUNOMAGNETIC SEPARATION (IMS) mrama Workshop Barcelona 22 November 2017 Assurance GDS Genetic Detection System A unique molecular
More informationDNA Labeling Kits Fluorescein-dCTP and -dutp Instruction Manual
DNA Labeling Kits Fluorescein-dCTP and -dutp Instruction Manual Catalog Number 170-8223 170-8224 For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723)
More informationHuman Genomics. 1 P a g e
Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationBrian Williams, Richele Gwirtz Version 1.0, December 29, 2003
Direct labeling of mouse genomic DNA for microarray hybridization using the Klenow fragment of E. coli DNA polymerase I and Cy3 dctp. This is a detailed version of the protocol published in Genomic DNA
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationRotor-Gene Multiplex Handbook
Second Edition July 2011 Rotor-Gene Multiplex Handbook Rotor-Gene Multiplex PCR Kit Rotor-Gene Multiplex RT-PCR Kit For fast multiplex real-time PCR, two-step RT-PCR, and one-step RT-PCR using sequence-specific
More informationWhite Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates
White Paper High Throughput SNP Genotyping White Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates Miniaturization and Automation Using a Novel New Reaction Substrate Originally
More informationEnterohaemorrhagic E. coli assay
Enterohaemorrhagic E. coli assay For the detection of EHEC stx1, EHEC stx2, EHEC eaea and EHEC hlya genes using the BD MAX TM system. Instructions for use (Version 3.0 February 2018) 1 Contents Introduction
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationSanger Sequencing & Fragment Analysis Services à la carte
Sanger Sequencing & Fragment Analysis Services à la carte www.seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationQPCR-S100 (100 rxns) Store -20. Functional analysis RealHelix qpcr Kit was evaluated by real-time PCR using the 10-fold serial-diluted human
RealHelix TM qpcr Kit [Intercalator type] CERTIFICATE OF ANALYSIS (1603-V01R03) Kit contents RealHelix TM qpcr Kit [Intercalator type] Cat. No. QPCR-S100 (100 rxns) QPCR-S500 (500 rxns) 2x qpcr PreMix
More information