DNA Replication and Repair
|
|
- Ezra Ferguson
- 6 years ago
- Views:
Transcription
1 DNA Replication and Repair
2
3 Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands to accurately replicate themselves.
4 DNA Replication genetic information is passed on to the next generation semi-conservative A T A T A T A T A T A T C G C G C G C G C G C G T A T A T A T A T A T A A T A T A T A T A T A T G C G C G C C G C G C G Parent molecule with two complementary molecules Parental strands separate Each parental strand is a template Each daughter DNA molecule consists of one parental and one new strand
5 Overview of replication Initiation DNA is unwound and stabilized Origins of replication: Replication bubble and replication fork Priming RNA primers bind to sections of the DNA and initiate synthesis Elongation Leading strand (5 3 ) synthesized continuously Lagging strand synthesized discontinuously then fragments are joined RNA primer replaced by DNA Proofreading Mismatch repair by DNA polymerase Excision repair by nucleases
6 Review of DNA structure double helix each strand has a 5 phosphate end and a 3 hydroxyl end strands run antiparallel to each other A-T pairs (2 H-bonds), G-C pairs (3 H-bonds)
7 SWYK CNs 3, 4, Sketch and label origins of replication: Replication bubble and replication fork 2. Describe the roles of the following proteins: - helicase - single-strand binding proteins - topoisomerase 3. Give two differences between prokaryotic and eukaryotic DNA replication.
8 STEP 1 Initiation at origins of replication separation sites on DNA strands Depend on a specific AT-rich DNA sequence Prokaryotes one site Eukaryotes multiple sites Replication bubble Replication fork Proceeds in two directions from point of origin
9 The proteins of initiation and priming
10 SWYK CNs 5, 6, What is the role of primase? 5. Why do we need RNA primers in replication? 6. What is the leading strand? How is it different from the lagging strand in terms of the priming step?
11
12 STEP 2 Priming initiation of DNA synthesis by RNA RNA primers bind to unwound sections through the action of primase leading strand only 1 primer lagging strand multiple primers replaced by DNA later
13 SWYK CNs 7, 25, Describe the roles of the following proteins: DNA polymerase (I/III) DNA ligase 8. Why is the leading strand synthesized continuously whereas the lagging strand is synthesized discontinuously? 9. Draw parental DNA being replicated. Label the following: parental DNA, leading strand, lagging strand, 3 and 5 ends, Okazaki fragments.
14
15
16
17 STEP 3 Elongation of a new DNA strand lengthening in the 5 3 direction DNA polymerase III can only add nucleotides to the 3 hydroxyl end Leading strand - DNA pol III adds nucleotides towards the replication fork; - DNA pol I - replaces RNA with DNA Lagging strand - DNA pol III - adds Okazaki fragments to free 3 end away from replication fork - DNA pol I - replaces RNA with DNA - DNA ligase joins Okazaki fragments to create a continuous strand
18 SWYK CNs 10, 11, How does DNA polymerase III function in mismatch repair? 11. How do nuclease, DNA pol III, and ligase function in excision repair? 12. What is the problem with telomeres at the 5' end? How is this solved in eukaryotic cells? You may use a diagram and labels for this.
19 STEP 4 Proofreading correcting errors in replication Mismatch repair DNA pol III proofreads nucleotides against the template strand Excision repair nuclease cuts damaged segment DNA pol III and ligase fill the gap left Telomeres at 5 ends of lagging strands no genes, only TTAGGG sequences to protect genes telomerase catalyzes lengthening of telomeres
20
21
22 Gene Expression From gene to protein Transcription and Translation
23 GENE EXPRESSION Genes code for polypeptide chains or for RNA molecules TRANSCRIPTION DNA-directed RNA synthesis produces mrna TRANSLATION mrna-directed polypeptide synthesis occurs on ribosomes Prokaryotes mrna translated immediately Eukaryotes pre-mrna processed before leaving the nucleus as mrna
24 SWYK CNs 12, 13, 14, 22, What is the role of RNA polymerase II in initiating transcription? 16. Assuming that the DNA template strand has the sequence 3 A T A T T T T A C G C G C C A 5, draw a) Nontemplate/coding/sense strand b) RNA strand
25
26 Transcription INITIATION ELONGATION TERMINATION
27 STEP 1 Initiation Occurs at a promoter Transcription factors bind to the TATA box on the DNA. RNA polymerase II and other transcription factors bind to promoter. DNA strands unwind. Polymerase initiates RNA synthesis at the start point.
28 STEP 2 Elongation mrna transcript lengthens RNA polymerase unwinds DNA. Polymerase adds nucleotides to 3 end. New RNA strand peels away from template. DNA strands reform a double helix.
29 Nontemplate Coding Sense Template Noncoding Antisense
30 STEP 3 Termination mrna transcript released Polymerase transcribes polyadenylation signal sequence (AAUAAA) pre-mrna is released Polymerase detaches from DNA.
31 SWYK CNs 15, mrna in eukaryotes undergoes RNA processing. Draw, label, and explain the significance of the following structures a. 5 cap b. poly-a tail c. spliceosome
32 RNA processing alteration of premrna Facilitate export of mrna from nucleus Protect mrna from degradation by enzymes Help ribosomes attach to 5 end of RNA 5 cap Modified G added to 5 end Poly-A tail A added to 3 end RNA splicing
33 RNA processing RNA splicing Introns intervening sequences noncoding segments on pre-mrna May regulate gene activity Enable genes to give rise to two or more different polypeptides Facilitate evolution through exon shuffling Exons expressed sequences on premrna Signal for splicing is a short sequence at the ends of introns
34 small nuclear ribonucleoproteins (snrnps) with snrna recognize splice sites snrnps + proteins spliceosome release introns join together exons that flank introns
35
36 SWYK CNs 16, 17, 18, 19, 20 Initiator trna base with the anticodon (17. ) pairs with the start codon (18. ) 19. Draw and label the initiator trna, mrna, start codon, and large ribosomal subunits with EPA sites during initiation of translation. Ribosome reaches STOP codons (20.),, )
37 Translation Overview mrna moves through ribosome codons are translated into amino acids trna molecules: anticodon and amino acid ends amino acids added to a growing polypeptide chain rrna molecules + proteins ribosomes
38
39 trna structure
40 SWYK CNs 8, What is wobble? What is its significance? 22. What is the genetic code? Why is it described as redundant but not ambiguous? 23. Given a prokaryotic DNA template with the following sequence, write the sequence of the mrna transcript formed and the polypeptide synthesized: 3 T A T A A T C T A C A C A T T G C C G T A C T A A A T A 5,
41
42 Inosine
43 Ribosome structure
44 Building a polypeptide Initiation Translation Termination
45 Step 1 - Initiation Small R subunit binds to mrna Initiator trna base pairs with start codon (AUG) Large R subunit binds to complete the initiation complex Initiator trna in the P site, A site is empty
46 Step 2 Elongation
47
48 Step 3 Termination Ribosome reaches STOP codon (UAG, UAA, UGA) A site receives a release factor Release factor cleaves bond between trna and the last amino acid Two ribosomal subunits disassemble
49
50
51 Given the following sequence on a template DNA strand 3 AAA TAT TTT CCG TAC GGA TAG ACA CCG AAA ATC CGG GCA 5 What is the sequence on the non-template strand? 5 TTT ATA AAA GGC ATG CCT ATC TGT GGC TTT TAG GCC CGT 3 What is the mrna sequence transcribed (assuming transcription right occurs after the TATA sequence)? 5 AAA GGC AUG CCU AUC UGU GGC UUU UAG GCC CGU 3 What is the STOP codon? UAG What is the anticodon attached to the trna that corresponds to the STOP codon? There is no trna that corresponds to the STOP codon. Release factors take their place. What is the amino acid sequence in the polypeptide product? Met Pro Ile Cys Gly - Phe
DNA Replication and Repair
DN Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif DN Replication genetic information is passed on to the next generation semi-conservative Parent molecule with
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationWhere are we? We covered. REPLICATION now.. TRANSCRIPTION + TRANSLATION
Where are we? We covered REPLICATION now.. TRANSCRIPTION + TRANSLATION Figure 14.4 Which is a Bacterial cell? Which is a Eukaryotic cell? What is transcription? What is translation? TRANSCRIPTION DNA Nuclear
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationReplication, Transcription, and Translation
Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More information3.A.1 DNA and RNA: Structure and Replication
3.A.1 DNA and RNA: Structure and Replication Each DNA polymer is made of Nucleotides (monomer) which are made of: a) Phosphate group: Negatively charged and polar b) Sugar: deoxyribose- a 5 carbon sugar
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationWe have. Learned the structure of DNA. Talked about DNA replication and all of the complicated vocabulary that goes with it
Do Now 1. What enzyme inserts new DNA nucleotides during replication? 2. Name 2 other important players in DNA replication and their function. 3. In what direction can DNA polymerase add nucleotides? 4.
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationName Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationLecture #18 10/17/01 Dr. Wormington
Lecture #18 10/17/01 Dr. Wormington DNA Replication The Story So Far Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationالحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1
الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء 222Cell Biolgy 1 Lecture 14 222Cell Biolgy 2 DNA replication DNA replication is a semi-conservative
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationThe Structure of DNA
The Structure of DNA Questions to Ponder 1) How is the genetic info copied? 2) How does DNA store the genetic information? 3) How is the genetic info passed from generation to generation? The Structure
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationQ. No. 1. How can RNA be distinguished from DNA?
Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationFig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationProposed Models of DNA Replication. Conservative Model. Semi-Conservative Model. Dispersive model
5.2 DNA Replication Cell Cycle Life cycle of a cell Cells can reproduce Daughter cells receive an exact copy of DNA from parent cell DNA replication happens during the S phase Proposed Models of DNA Replication
More informationStation 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.
1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationDNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2
DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More information3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:
1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what
More informationGRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION
GRU5 LECTURE POST-TRANSCRIPTIONAL MODIFICATION AND TRANSCRIPTION Do Now 1. What was the DNA template for this mrna: 5 -A-A-C-G-U-3? (Write it 5 to 3 ) 2. State the Central Dogma of biology. 3. Name 3 differences
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationE) phosphate group E) x-ray crystallography B) RNA A) transformation A) Hershey and Chase (1952) B) Histones A) Nucleic acids B) euchromatin
1. Rosalind Franklin s pictures of the DNA double helix were taken using the technique known as A) bright field microscopy B) diffraction C) fluorescence D) transmission electron microscopy E) x-ray crystallography
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationNucleic Acid Structure:
Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationRapid Learning Center Presents. Teach Yourself High School Biology in 24 Hours. and Functions
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself High School Biology in 24 Hours Gene e Structures and Functions High School Biology Rapid Learning
More informationDNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationCHAPTER 16 MOLECULAR BASIS OF INHERITANCE
CHAPTER 16 MOLECULAR BASIS OF INHERITANCE DNA as genetic material? Deducted that DNA is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationMOLECULAR BASIS OF INHERITANCE
MOLECULAR BASIS OF INHERITANCE C H A P T E R 1 6 as genetic material? Deducted that is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationFrom DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
More information