RNA Structure Prediction and Comparison. RNA Biology Background

Size: px
Start display at page:

Download "RNA Structure Prediction and Comparison. RNA Biology Background"

Transcription

1 RN Structure Prediction and omparison Session 1 RN Biology Background Robert iegerich Faculty of Technology robert@techfak.ni-bielefeld.de October 13, 2013 Robert iegerich

2 Overview of lecture topics The lecture plan has 5 parts... 1 RN biology (short) 2 RN structure prediction based on thermodynamics 3 omparative (multiple) structure prediction 4 Stochastic models 5 RN structure comparison 6 Selected special topics Robert iegerich

3 Literature There is no textbook on this topic yet. urrently, many authors are cooperting to write one. (I am contributing chapters on bstract Shape nalysis and Stochastic Models.) The slides of this lecture and related research articles will be made available via the lecture home page at StrukturWS12 ll of last year s material is already on the page, but some things will certainly change as the lecture proceeds. Robert iegerich

4 Functional roles of RN The three classical roles of RN: mrna - the messenger RN: spelling the genetic code rrn - the ribosomal RN: performing protein synthesis trn - the transfer RN: linking codons to amino acids Robert iegerich

5 The (ancient) RN world hypothesis The only plausible theory about the origin of life sees RN as the early carrier of evolution This is solves the chicken-and-egg problem that proteins need DN to be encoded, and DN needs proteins to be processed. RN has both of these functions - it can store information (though less reliably than DN) it has catalytic activity (though less efficient than proteins) cording to the entral Dogma of molecular biology, all important functions in today s organism are carried out by proteins Robert iegerich

6 dversary observations Over the decades, a number of observations had been made which were inconsistent with the entral Dogma... a handful of RNs with enzymatic activity (hammerhead ribozyme) H/ and D-box sno-rns self-splicing introns the catalytic core of the ribosome is purely RN no protein nearby. many more see work by John Mattick... there were thought of as the exception to the rule. Robert iegerich

7 The fall of the entral Dogma and the advent of the New RN World The entral Dogma broke down around the year 2001/2002: The human genome project yielded an unxepected small number of protein-coding genes around , maybe less This small number of protein genes cannot explain organismic complexity of higher eucaryotes lternative splicing was perceived to be the rule rather than an exception, but it cannot create enough variety ttention was redirected to long-known facts about regulatory roles of RN The most prominent of those were mirns and RN interference Robert iegerich

8 The variety of RN functions The universe of RN functions is of increasing interest today: bacterial riboswitches: e.g. temperature sensing regulatory signals: e.g. iron responsive elements group 1 introns: self-splicing microrn and small interfering RN: translation supression tmrn: freeing stalled ribosomes from incomplete mrn RISPR RN: bacterial immune system and Lamarckian evolution and many 100s more... computer analogy: DN is the hard disk, RN the main memory. Robert iegerich

9 RN function: Some examples Depening on student background, let us discuss a few of the above RN functions (or some other ones) in some detail. Robert iegerich

10 RN chemistry RN is a chain molecule built from nucleosides, with a backbone of alternating ribose and phosphate groups. Robert iegerich

11 The four bases used in RN: Robert iegerich

12 RN (tertiary) structure n RN molecule folds back onto itself, forming helices and loops. RN helices are extremely stiff, exposing loops in welldefined positions. omputational challenge: Recognize signals from structure ND sequence. The structure itself is not uniquely defined, but must be seen as a Boltzmann ensemble, governed by free energy. RN 3D structure is difficult to resolve; two known examples are trn and group 1 introns Robert iegerich

13 Structure of a trn: Robert iegerich

14 Structure of a group 1 intron: Robert iegerich

15 Forces of structure formation: Hydrogen bonds between bases standard base pairs: Watson-rick,, and wobble non-standard base pairs almost any other base pair stacking, i.e. helix formation helix continuation ( dangling bases ) Negative (destabilizing) forces from loops Influence of Na+, K+ Mg+ (help to bend negative backbone) coaxial stacking of helices triple and quadruple helices Robert iegerich

16 Structural stability: Stability is measured in free energy Free energy is measured experimentally by melting temperature Energy contributions of local configurations have been determined experimentally Robert iegerich

17 look at the present energy parameters: See http: //rna.urmc.rochester.edu/nndb/turner04/index.1.html Robert iegerich

18 The folding process RN folds in an hierarchic fashion: 1 Local helices form, helped by metal ions 2 Local folding brings remote parts to vicinity; more helices form 3 Helices arrange themselves in 3D 4 Loops in distant helices may form long-distance base pairs and additional interactions (pseudo-knots) of increasing complexity 5 The process is reversible a folded structure may reshape with a certain probability There are also conformational switches, triggered by external events (sensors, thermometers) Robert iegerich

19 o-transcriptional folding Folding begins immediately when the RN is transcribed Molecule may be trapped in a non-optimal state fter heating and refolding the complete molecule, the native structure may not be recovered The folding path is engineered to avoid traps (cf. Meyer I.M., Miklos I. o-transcriptional folding is encoded within RN genes. BM Mol Biol ug 6;5(1):10) Some RN viruses have different structure before and after replication. Robert iegerich

20 RN 2D structure RN secondary structure is the level of base pairing and helices. The secondary structure strongly determines 3D structure can be used to detect conservation of structure gives hints (only) to explore biochemical function can be computed by DP algorithms has become an accepted substitute for 3D structure Robert iegerich

21 Elements of secondary structure Multiple Loop Stacking Region Hairpin Loop Internal Loop Bulge Loop (left) Bulge Loop (right) Robert iegerich

22 bstraction (versus heuristic) RN secondary structure abstracts from 3D coordinates of atoms non-standard base pairs long-distance interactions coaxial stacking, triple and quadruple helices Secondary structure approximates phases 1 and 2 of hierarchical folding It is not a heuristic substitute for 3D structure Robert iegerich

23 omputational structure analysis: ll computational approaches concentrate on 2D structure. Some consider pseudo-knots, but most do not. lgorithms are available for Prediction of optimal or near-optimal structure(s) omputing free energy of a given structure omputing simarity/distances between structures Finding local similarities in structures ligning two or more structures Predicting consensus structure(s) from multiple sequences Simulating the kinetics of folding Predicting possibility of conformational switching and many more... Robert iegerich

24 Preview Next weeks session: Structure representations Structure prediction via base pair maximization Robert iegerich

RNA Structure Prediction and Comparison. RNA Biology Background

RNA Structure Prediction and Comparison. RNA Biology Background RN Structure Prediction and omparison Session 1 RN Biology Background édric Saule Faculty of Technology cedric.saule@ni-bielefeld.de pril 13, 2015 édric Saule Overview of lecture topics The lecture plan

More information

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

BASIC MOLECULAR GENETIC MECHANISMS Introduction:

BASIC MOLECULAR GENETIC MECHANISMS Introduction: BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:

More information

90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006

90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,

More information

Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background:

Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background: Molecular biology WID 602 - Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background: DNA and RNA each consists of only four different nucleotides.

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information

Transcription & Translation notes

Transcription & Translation notes Transcription & Translation notes TRNSRIPTION The entral Dogma DN RN proteins Protein Synthesis The DN inherited by an organism leads to specific traits by dictating the synthesis of proteins The process

More information

DNA: The Molecule Of Life

DNA: The Molecule Of Life DNA: The Molecule Of Life Introductory Concepts -One unique set of DNA in an organism is termed its genome (link to fig 1-3) -DNA is the main component of chromosomes -Humans are diploid organisms, with

More information

Current Status and Future Prospects p. 46 Acknowledgements p. 46 References p. 46 Hammerhead Ribozyme Crystal Structures and Catalysis

Current Status and Future Prospects p. 46 Acknowledgements p. 46 References p. 46 Hammerhead Ribozyme Crystal Structures and Catalysis Ribozymes and RNA Catalysis: Introduction and Primer What are Ribozymes? p. 1 What is the Role of Ribozymes in Cells? p. 1 Ribozymes Bring about Significant Rate Enhancements p. 4 Why Study Ribozymes?

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Figure A summary of spontaneous alterations likely to require DNA repair.

Figure A summary of spontaneous alterations likely to require DNA repair. DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

Reading for lecture 2

Reading for lecture 2 Reading for lecture 2 1. Structure of DNA and RNA 2. Information storage by DNA 3. The Central Dogma Voet and Voet, Chapters 28 (29,30) Alberts et al, Chapters 5 (3) 1 5 4 1 3 2 3 3 Structure of DNA and

More information

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

RNA secondary structure prediction and analysis

RNA secondary structure prediction and analysis RNA secondary structure prediction and analysis 1 Resources Lecture Notes from previous years: Takis Benos Covariance algorithm: Eddy and Durbin, Nucleic Acids Research, v22: 11, 2079 Useful lecture slides

More information

UNIT 3. Chapter 12 From DNA to Proteins

UNIT 3. Chapter 12 From DNA to Proteins UNI 3 hapter 12 From DN to Proteins hapter 12: From DN to Proteins I. Identifying DN as the enetic Material (8.1). riffith finds a transforming principle 1. riffith experimented with the bacteria that

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Unit 6 (Part 1) DNA, RNA, & Protein Synthesis

Unit 6 (Part 1) DNA, RNA, & Protein Synthesis Unit 6 (Part 1) DN, RN, & Protein Synthesis Name: Period: 1 DN Structure 1. Complete the table below to show how the structure of the DN molecule allows it to perform each essential function. Function

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome

Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Introduction to Molecular Biology Lodish et al Ch1-4 http://www.ncbi.nlm.nih.gov/books EECS 458 CWRU Fall 2004 DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Roadmap The Cell Lodish

More information

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH

More information

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09 Molecular Biology Primer pts 580, omputational enomics, Spring 09 Starting 19 th century What do we know of cellular biology? ell as a fundamental building block 1850s+: ``DNA was discovered by Friedrich

More information

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis

More information

Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<

Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<< Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

RNA World Hypothesis and RNA folding. By Lixin Dai

RNA World Hypothesis and RNA folding. By Lixin Dai RNA World Hypothesis and RNA folding By Lixin Dai Outline: RNA World Hypothesis RNA structure primary secondary tertiary Folding of RNA structure Problems with the folding Solutions RNA World Hypothesis:

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Gene Expression Transcription

Gene Expression Transcription Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction

More information

Outline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein

Outline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein ene Expression: RN and Synthesis ene Expression RN synthesis synthesis enetic ode Outline Splicing enes Introns and Exons omparison of ene Expression in Prokaryotes and Eukaryotes ene Expression 1. entral

More information

Molecular Biology: DNA, gene, chromosome and genome (Learning Objectives)

Molecular Biology: DNA, gene, chromosome and genome (Learning Objectives) Molecular Biology: DN, gene, chromosome and genome (Learning bjectives) Nucleic acid structure and composition ompare and contrast the structure of DN and RN: features they share and how do they differ?

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl

1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription

More information

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl

NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription

More information

Chapters 31-32: Ribonucleic Acid (RNA)

Chapters 31-32: Ribonucleic Acid (RNA) Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine

More information

COMP598: Advanced Computational Biology Methods & Research

COMP598: Advanced Computational Biology Methods & Research COMP598: Advanced Computational Biology Methods & Research Introduction to RNA secondary structure prediction Jérôme Waldispühl School of Computer Science, McGill RNA world In prebiotic world, RNA thought

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e

Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e 1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA

More information

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012

Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

وراثة األحياء الدقيقة Microbial Genetics

وراثة األحياء الدقيقة Microbial Genetics وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in

More information

Chapter Fundamental Molecular Genetic Mechanisms

Chapter Fundamental Molecular Genetic Mechanisms Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise

More information

Comparative Analysis of RNA structure

Comparative Analysis of RNA structure omparative nalysis of RN structure Stages of a comparative analysis Initial definition of the basic secondary structure few sequences May use thermodynamic prediction or probing data Resolution: helices

More information

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

A. Incorrect! A sugar residue is only part of a nucleotide. Go back and review the structure of nucleotides.

A. Incorrect! A sugar residue is only part of a nucleotide. Go back and review the structure of nucleotides. Organic Chemistry - Problem Drill 24: ucleic Acids o. 1 of 10 1. What are the components of a nucleotide? (A) A sugar residue (B) A sugar residue + a nitrogenous base (C) A sugar residue + a nitrogenous

More information

Gene Expression: From Genes to Proteins

Gene Expression: From Genes to Proteins The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes

More information

Molecular Biology of the Gene

Molecular Biology of the Gene Molecular Biology of the ene utline: Molecular Biology of the ene Readings: hapters 10-12 in ampbell et al istorical enetic Material Experiments hemical Nature of Nucleic cids Structure of DN DN Replication

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,

Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , , Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Transcription steps. Transcription steps. Eukaryote RNA processing

Transcription steps. Transcription steps. Eukaryote RNA processing Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Replication Transcription Translation

Replication Transcription Translation Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype

More information

Nucleic Acid Structure:

Nucleic Acid Structure: Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic

More information

(deoxyribonucleic acid)

(deoxyribonucleic acid) 1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

BIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: CCS: 10.BIO.4 a, 5 a, 5 b.

BIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: CCS: 10.BIO.4 a, 5 a, 5 b. BIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: 2017-18 CCS: 10.BIO.4 a, 5 a, 5 b. Name: Grade: 10 CHAPTER.8: SECTION 8.1, SECTION 8.2, SECTION 8.3, SECTION 8.4 & SECTION 8.5. NOTE: THE STUDENTS SHOULD

More information

Structure. Structural Components of Nucleotides Base. Sugar. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Sugar. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Phosphate Glycosidic bond 11 Structural Components of Nucleotides Base Sugar Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Phosphate Glycosidic bond H NUCLEOTIDE H Nucleic acid polymer of nucleotides

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

Warm Up #15: Using the white printer paper on the table:

Warm Up #15: Using the white printer paper on the table: Warm Up #15: Using the white printer paper on the table: 1. Fold it into quarters. 2. Draw out the possible structure of what you think this picture is showing in one of the boxes (Hint: This is a macromolecule).

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA

We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA 1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

Transcription and Translation

Transcription and Translation Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different

More information

Chapter 2 - DNA MC [37 marks]

Chapter 2 - DNA MC [37 marks] Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Introduction to Bioinformatics for Computer Scientists. Lecture 2

Introduction to Bioinformatics for Computer Scientists. Lecture 2 Introduction to Bioinformatics for Computer Scientists Lecture 2 Preliminaries Knowledge test I didn't expect you to know all that stuff Oral exam We can do it in German if you like Summer seminar: Hot

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it What is life made of? 1665: Robert Hooke discovered that organisms are composed of individual compartments called cells

More information

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Nucleic Acids. OpenStax College. 1 DNA and RNA

Nucleic Acids. OpenStax College. 1 DNA and RNA OpenStax-CNX module: m44403 1 Nucleic Acids OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 4.0 By the end of this section, you will be

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information