Product Name : Simple mirna Detection Kit
|
|
- Miranda Harmon
- 6 years ago
- Views:
Transcription
1 Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components Amount Storage 1 2 Ligation Buffer 100 µl - 20 C 2 RNase-free water 1 ml - 20 C 3 Ligase 3 20 µl - 20 C 4 Optimum RT Buffer 180 µl - 20 C 5 Reverse Transcriptase 20 µl - 20 C 6 2 Ampli Buffer 500 µl - 20 C 7 Taq DNA polymerase 40 µl - 20 C Store at -20 C (Do not store in a frost-free freezer) The product is stable under the above storage conditions for 2 years from the date of receipt. Additional Materials and Equipments Needed MicroRNA specific primer (Target RNA specific primer) PCR tubes or 96-well plates Thermal cycler Polyacrylamide gel (10%) Apparatus for polyacrylamide gel electrophoresis Power supply Microcentrifuge Ice bucket Vortex mixer - 1 -
2 Experiment Outline The Simple mirna Detection Kit is a product to detect microrna. The detection system is composed of three steps. In the first step, microrna in the solution is directly ligated to an oligonucleotide tag (ON Tag). The tagged microrna is reverse-transcribed in the second step. In the final step, the resulting cdna is amplified with a microrna specific primer of the user s choice. We recommend examining the PCR products with polyacrylamide gel electrophoresis but not agarose gel electrophoresis for high sensitivity and accuracy. The ON Tag can be ligated to 3 -OH of microrna, even if the 2 -OH at the 3 end of the microrna is methylated (1). The microrna specific primers can be prepared based on the 5 sequence of the target microrna. This gives you flexibility to detect microrna from many sources. The Simple mirna Detection Kit can be utilized not only for microrna detection but also the detection of RNA bearing a 3 -OH end which is similar in size to microrna. Fig. 1 MicroRNA detection scheme 1. ON Tag Ligation to MicroRNA 5 P Ligation OH 3 5 ON Tag 2. Reverse-Transcription Reaction Reverse transcription RT Primer 3. PCR Amplification microrna specific primer Universal Reverse Primer Amplified product - 2 -
3 Before Starting 1. Design a microrna specific primer To detect microrna of your interest, a microrna specific primer (forward sense primer) is required to be prepared. A reverse primer (antisense primer) is provided as a Universal Reverse Primer which is included in the 2 Ampli Buffer. Generally micrornas range in size from nucleotides. The seed sequence is at positions 2-7 from the 5 -end of microrna. The sequence is essential for the binding to the mrna and conserved (2). In most cases, the microrna specific primer can be designed directly according to nucleotides of sequence on the 5' side of the microrna. The Tm* of the primer is best to be C. Self-complementary or complementary to the Universal Reverse Primer should be avoided. In some cases, primer dimers may disturb the microrna detection. To avoid this, we recommend that the microrna specific primer is tested by this detection system without RNA. To be more definite, perform ON Tag ligation using pure water instead of RNA, and subject the ligated product to a reverse-transcription reaction, then test whether the microrna specific primer causes bands or not on PCR amplification according to this protocol (See Troubleshooting ). If bands are seen, the microrna specific primer is not appropriate. The microrna specific primer should be prepared in RNase-free water and the concentration should be adjusted to 3 µm. *The equation for Tm: 4(G + C) + 2(A + T) C. A, G, C, and T are the number of each nucleotide in a primer. The sequence of Universal Reveres Primer: 5 GGTGCATTGATTCCCGAGT (19 mer) An example of microrna specific primer design for hsa-mir-93 is shown below: Sequence of hsa-mir-93: CAAAGUGCUGUUCGUGCAGGUAG Primer 1: CAAAGTGCTGTTCGTGCAG (19 nt) Primer 2: AAAGTGCTGTTCGTGCAGG (19 nt) bp Fig 1. Electrophoresis of PCR products PCR products obtained with the Simple mirna Detection Kit were run on 10% polyacrylamide with 1 TBE as running buffer. Visualized by ethidium bromide staining. Lane 1: DynaMarker Small DNA Lane 2: PCR product with Primer 1 Lane 3: PCR product with Primer 2 Both of the primer 1 & 2 work successfully as shown in the Fig. In the above example, the size of the amplicon from hsa-mir-93 as a template can be calculated as below: The amplicon with Primer 1: 47 bp = 23 (length of hsa-mir-93) + 24 *1 The amplicon with Primer 2: 46 bp = 23 (length of hsa-mir-93) -1 * *1 *1 : the nucleotide length formed with Universal Reverse Primer *2 : See the position of Primer 2 on the sequence of hsa-mir
4 2. Preparation of polyacrylamide gel Non-denaturing polyacrylamide gel electrophoresis is appropriate for analysis of the PCR products yielded in the Simple mirna Detection Kit. The electrophoresis can show the PCR band clearly and indicate the size accurately. Preparation of non-denaturing polyacrylamide gel (10%) is described in the section Procedure for Detection below. If the prepared gel plate is wrapped in film, the gel plate can be stored for at least one week at room temperature. 3. Notes on handling of RNA RNA is a labile molecule and easily degraded by RNase. To avoid RNases, use extreme care during manipulation to prevent nuclease contamination. Wear gloves and use clean apparatus. Nuclease-free disposable plasticware should be used. It is necessary to ensure that total RNA or fractionated RNA for microrna detection preserves small RNAs. You can use total RNA prepared by guanidinium thiocyanate-phenol-chloroform extraction method (3) or by commercial total RNA preparation kits. When using a commercial kit, be sure that the kit does not deplete small RNAs. Procedure for Detection In this procedure below, 50 pg to 1 µg of total RNA can be used as a starting sample. For low-content micrornas in the total RNA or in the fractionated RNA (for example, size-selected RNA), an increased amount may be required. The proper amount of RNA depends on the abundance of the microrna target in the sample. 1. ON Tag ligation to microrna Set up the following 10 µl reaction in a 0.5 ml nuclease-free tube and incubate at room temperature (20-25 C) for 15 min. After the 15 min, the ligation mixture is subjected to a reverse-transcription reaction in the next step. Table 1. Reaction mixture for ON Tag ligation to mirna Component Volume RNA (total RNA, fractionated RNA) variable 2 Ligation Buffer 5.0 µl RNase-free water variable Ligase µl ligation mixture 10.0 µl 2 Ligation Buffer includes ON Tag
5 2. Reverse-transcription Reaction 1) Add the following components below to the ligation mixture obtained in the above reaction, and incubate at 42 C for 30 min. Table 2. Reaction mixture for reverse-transcription reaction Component Volume Ligation mixture (see above) 10.0 µl Optimum RT Buffer 9.0 µl Reverse Transcriptase 1.0 µl RT product 20.0 µl Optimum RT Buffer includes RT primer. 2) Terminate the reaction by heating at 95 C for 5 min (This step is important). * The RT product can be stored at -80 C. Repeated freeze-thaw should be avoided. 3. PCR with microrna specific primer 1) Using the 4 µl of RT product prepared above, prepare a reaction mixture as below in a tube or a plate. Table 3. Reaction mixture for PCR Component Volume RT product (see above) 4.0 µl RNase-free water 16.5 µl 2 Ampli Buffer 25.0 µl 3 μm microrna specific primer 2.5 µl Taq DNA polymerase 2.0 µl Total volume 50.0 µl 2 Ampli Buffer includes Universal Reverse Primer and provides a final concentration of 2.8 mm MgCl 2. 2) Transfer the tube or the plate to a thermal cycler* then start PCR according to the PCR program below. * When using a thermal cycler without a heated lid, overlay with mineral oil. Initial denaturation 95 C for 3 min 30 Cycling 94 C for 15 sec 56 C for 30 sec 72 C for 30 sec Final Extension 72 C for 1 min 3. Examine the amplified products The amplified products obtained in the above reaction will be analyzed with non-denaturing polyacrylamide gel electrophoresis as below. 1) Preparation of 40% acrylamide : bis solution Dissolve acrylamide and N, N -methylenebisacrylamide as follows: Acrylamide 190 g N, N -methylenebisacrylamide 10 g H 2 O to 500 ml After mixing, filter the solution through a membrane filter (0.45 μm pore size)
6 2) Preparation of polyacrylamide gel plate To analyze the amplified products of the Simple mirna Detection Kit, 10% polyacrylamide is appropriate. Prepare 10% acrylamide solution as below and assemble glass plates for electrophoresis in a casting frame: 40% acrylamide : bis solution 5.0 ml 10 TBE 2.0 ml H 2 O to 20 ml To the 20 ml solution, add 20 μl of TEMED and 160 μl of 10% ammonium persulfate. Mix immediately and then pour the gel between the glass plates in a casting frame. Then quickly insert the appropriate comb between the glass plates. The 20 ml of gel solution is enough for the two gel plates described in Fig 2 (gel size: 7 cm 8 cm, 1.0 mm thickness, lane width = 5 mm). Be careful not to allow air under the comb. Let the gel sit until it is solid. 0.5 cm comb (1.0 mm thickness) 7 cm 10% polyacrylamide gel (between glass plates) 8 cm Fig.2. Example of a polyacrylamide gel plate 3) Electrophoresis Prepare loading samples by mixing amplified products of the Simple mirna Detection Kit and gel loading buffer (for example, 6 BPB Loading Dye, BioDynamics Laboratory, Code. No. DM210). Set up the gel apparatus according to the manufacturer s protocol. Before electrophoresis, remove the comb from the polyacrylamide gel plate and install it in the electrophoresis apparatus. Fill the apparatus with 1 TBE. Load the samples into wells with a pipet using gel loading tips. Start the electrophoresis according to the manufacturer s protocol. 4) Staining After electrophoresis, detach the gel from the glass plates and immerse the gel in a solution containing 0.5 μg/ml of ethidium bromide approximately for 20 min. Then examine the gel on a UV illuminator
7 Troubleshooting Problem No bands (or faint bands) were seen in the electrophoresed gel Unspecific bands are seen in the electrophoresed gel The size of amplified band is different from that of expected. Probable Cause & Suggested Solution Starting RNA is low. Even though the protocol is designed to detect microrna in as little as 50 pg of total RNA, actual microrna content depends on the expression level and RNA source. In this case, try to increase the amount of RNA if the samples are not limited. The microrna specific primer may not anneal well to a template. In this case, the best solution is to change the microrna specific primer. Longer primers (20, 21 mer) may work well. Alternatively, lowering the annealing temperature of the PCR cycle may improve the PCR amplification. If the microrna specific primer is self-complementary or complementary to the Universal Reverse Primer, unspecific bands such as primer dimers, oligomers resulting from primer dimers may be produced. In this case, the microrna specific primer should be changed. Although primer dimer is a low probability event in using the Simple mirna Detection Kit, primer dimers may be generated in some cases. To avoid it, the designed microrna specific primer should be tested as follows: Perform the ON Tag ligation using pure water instead of RNA, and subject the 10 µl of ligated product to reverse-transcription reaction, then apply 4 µl of the reverse transcribed product to PCR according to this protocol. If you see bands other than primers, they must be primer dimers or oligomers resulting from primer dimers. In this case, the microrna specific primer should be changed. See Fig. 3 The PCR over 30 cycles sometimes causes unexpected bands. In this case, perform PCR in less than 30 cycles. Reverse-transcribed cdna can be stored below -20 C but freeze-thaw cycle may cause unexpected bands. bp Fig 3. A generated primer dimer ON Tag ligation was done with human heart total RNA (lane 3) and without RNA (lane 2), then the ligated products were subjected to a reverse-transcription reaction. PCR was done with the reverse-transcribed products and an inappropriate microrna specific primer for PCR. Approximately 42-bp bands in lane 2 and 3 are primer dimers. The bands disturb the detection of correct bands. Lane 1: DynaMarker Small DNA Lane 2: PCR product (- total RNA) Lane 3: PCR product (+ total RNA) - 7 -
8 Trademarks Registered names, company names, trademarks, etc. used in this document are the property of their respective owners, even when not specifically marked as such. References 1. Yang Z, Ebright YW, Yu B, Chen X. (2006) HEN1 recognizes nt small RNA duplexes and deposits a methyl group onto the 2 OH of the 3 terminal nucleotide. Nucleic Acids Res 34: Lewis BP, Burge CB, Bartel DP (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microrna targets. Cell 120: Chomczynski P. and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:
Quant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationSunScript TM One Step RT-qPCR Kit
INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationSunScript One Step RT-PCR Kit
SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...
More informationHy-Fy High Fidelity Mix (x2)
Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationHCV Genotype Primer Kit
Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence
More informationSOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR
Virus Bank SOP-HCV-001 1. Scope SOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR 1.1 This procedure describes a method for quantitation of the HCV genome in HCV-infected cells by RT-PCR.
More informationAccuScript High Fidelity 1 st Strand cdna Synthesis Kit
AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement
More informationPreparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)
Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo
More informationUser Manual. Version 5. Published February Catalog No. K1021 ~
GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More informationmrna Selective PCR Kit (AMV) Ver.1.1
Table of Content 1. Description...2 2. Features...2...2...2 3. Kit components...3 4. Reagents and instruments not supplied in this kit...3 5. Storage...4 6. Principle...4 7. Preparation of RNA sample...5
More informationTaq + dntps #EZ U
#EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +
More informationSuperiorScript III cdna Synthesis Kit Instruction Manual
SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment
More informationDIRECTION FOR USE. Art. No / /25 reactions in vitro Diagnosticum for birds
DIRECTION FOR USE Art. No. 31066 / 31067 100 /25 reactions in vitro Diagnosticum for birds Kylt Turkey Hemorrhagic Enteritis Virus PCR Detection Kit is for detection of the etiological agent of Infectious
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationFor in vitro Veterinary Diagnostics only. PCR Detection Kit for Fowl Adenovirus.
For in vitro Veterinary Diagnostics only. PCR Detection Kit for Fowl Adenovirus www.kylt.eu DIRECTION FOR USE Art. No. 31144 / 31145 Kylt Fowl Adenovirus PCR Detection Kit for Fowl Adenovirus 100 /25 reactions
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus
Cat. # RR82LR For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. A1901A. See section
More informationPCR Protocol Cooke Lab July 30, 2012
PCR Protocol Cooke Lab July 30, 2012 Contact Adriana Arango-Velez Contents 1. Before performing the PCR 2. Recommendations for the PCR 3. Performing the PCR 4. General Thermocycler program 5. Stock solutions
More informationmirna Cloning Kit High Efficient
DynaExpress mirna Cloning Kit High Efficient DynaExpress Product Name : mirna Cloning Kit High Efficient Code No. : DS330 Table of Contents Background - - - - - - - - - - - - - - - - - - - - - - - - -
More informationPreparing Samples for Analysis of Small RNA
Preparing Samples for Analysis of Small RNA FOR RESEARCH ONLY Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA
More informationSuperReal PreMix Plus (SYBR Green)
SuperReal PreMix Plus (SYBR Green) For fast, quantitative, real-time PCR using SYBR Green www.tiangen.com/en QP120627 SuperReal PreMix Plus (SYBR Green) Cat. no. FP205 Kit Contents Contents 2 SuperReal
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationEpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029
EpiQuik Quantitative PCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Quantitative PCR Fast Kit is designed for quantitative real time analysis of DNA samples
More informationTable of Contents. 2. Preparation of cell lysate from adherent cells cultured on 96-well plates...4
Table of Contents I. Description...2 II. III. IV. Kit Components...2 Materials Required but not Provided...2 Storage...2 V. General Considerations...3 VI. Protocol 1. Preparation of reagents...4 2. Preparation
More informationRapid amplification of cdna ends (RACE)
Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE
More informationGenoExplorer mirna qrt-pcr Kit for Catalog # s 2001, 2002, 2003, 2004
GenoSensor Corporation GenoExplorer mirna qrt-pcr Kit for Catalog # s 2001, 2002, 2003, 2004 Version A April 2007 User Manual Table of Contents Introduction 2 Product System... 2 Kit Components and Storage
More informationUses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA.
Methylamp MS-qPCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format
More informationPreparing Samples for Analysis of Small RNA
Preparing Samples for Analysis of Small RNA Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE Gel 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA Adapters 15
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationTaura Syndrome Virus (TSV) RT-PCR Kit
Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro
More informationFor in vitro Veterinary Diagnostics only. PCR Detection Kit for Salmonella Gallinarum, Pullorum (separate detection) & DIVA 9R.
For in vitro Veterinary Diagnostics only. PCR Detection Kit for Salmonella Gallinarum, Pullorum (separate detection) & DIVA 9R www.kylt.eu DIRECTION FOR USE Art. No. 31420 / 31421 Kylt SGP & 9R DIVA PCR
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationPCR Detection of Genetically Modified (GM) Foods Protocol
PCR Detection of Genetically Modified (GM) Foods Protocol Purpose Isolate DNA from corn-based food so that the Polymerase Chain Reaction can be used to determine whether the selected foods have been genetically
More informationC&E ExpressArt Micro dsdna Synthesis Add-On Module for Combination with mrna Amplification kits
C&E ExpressArt Micro dsdna Synthesis Add-On Module for Combination with mrna Amplification kits Bacterial Micro kit Cat.-No. 5199-A30 TR Micro kit Cat.-No. 6199-A30 Catalogue No. 8224-A30 (30 reactions:
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationDiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit
DiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit Description: Tuberculosis (TB) is caused by the acid-fast bacterium Mycobacterium tuberculosis. Although Mycobacterium tuberculosis most commonly
More informationGreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM)
G:\products\productflyer\pcr\polymerasen\hotstart\manu_m3052_green_en.docx GreenMasterMix (2) High RO (500nM) qpcr master mix with fluorescence dye and passive reference dye Contact & Technical support
More informationMarathon TM cdna Amplification Kit Protocol-at-a-Glance
(PT1115-2) Marathon cdna amplification is a fairly complex, multiday procedure. Please read the User Manual before using this abbreviated protocol, and refer to it often for interpretation of results during
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationPurification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost
Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen
More information1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
More informationQIAGEN Supplementary Protocol
QIAGEN Supplementary Protocol QIAGEN OneStep RT-PCR Kit Research Protocol for swine-origin influenza A virus (S-OIV) using end-point PCR This protocol is for use in swine-origin influenza A (H1N1) virus
More informationThis Product Description is only valid for Lot No. 36V.
HLA Wipe Test Negative Control Product Insert Page 1 of 8 Olerup SSP HLA Wipe Test Negative Control Product number: 102.101-01 including Taq polymerase Product number: 102.101-01u without Taq polymerase
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationCloning Small RNAs for Sequencing with 454 Technology
Cloning Small RNAs for Sequencing with 454 Technology Protocol provided by Dr. Greg Hannon, Cold Spring Harbor Laboratory 1. RNA preparation 1. Total RNA is isolated from tissue or cells with TRIZOL followed
More informationPrimeScript One Step RT-PCR Kit Ver.2 (Dye Plus)
Cat. # RR057A For Research Use PrimeScript Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 4 IV. Storage... 5 V. Principle... 5 VI.
More informationpgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents
More informationGENERAL INFORMATION...
BIOO LIFE SCIENCE PRODUCTS NEXTflex-96 TM DNA Barcodes (Illumina Compatible) Catalog #: 514106 BIOO Scientific Corp. 2012 V12.11 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents,
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationCat. # RR391A. For Research Use. Probe qpcr Mix. Product Manual. v201610da
Cat. # RR391A For Research Use Probe qpcr Mix Product Manual Table of Contents I. Introduction... 3 II. Principle... 3 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationDNA Visualizer Extraction Kit
DNA Visualizer Extraction Kit Catalog Number D0006 50 reactions Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationMag-Bind PX Blood RNA 96 Kit. M x 96 preps M x 96 preps
Mag-Bind PX Blood RNA 96 Kit M7763-00 1 x 96 preps M7763-01 4 x 96 preps June 2018 Mag-Bind PX Blood RNA 96 Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing
More informationPrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time)
For Research Use PrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided...
More information500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+
Hy-Taq 500U + dntps #EZ1012 500U Concentration: 5U/μl Contents: Hy-Taq DNA Polymerase 100μl 10xPCR Buffer(Mg 2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C For research only
More informationTable of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription...
Table of Contents I. Kit Components...2 II. III. Storage...2 Principle...2 IV. Precautions for operation...3 V. Protocol : reverse transcription...3 VI. Protocol : Real-time PCR...5 VII. Appendix...7 VIII.
More informationPrimeScript II 1st strand cdna Synthesis Kit
Cat. # 6210A/B For Research Use PrimeScript II 1st strand cdna Synthesis Kit Product Manual Table of Content I. Description... 3 II. Components... 3 III. Storage... 4 IV. 1st Strand cdna Synthesis Reaction...
More informationOptimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
More informationQuant Reverse Transcriptase
1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50
More informationHiPer Gel Extraction Teaching Kit (Column Based)
HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationPreparing Samples for Analysis of Small RNA Using the Oligo Only Kit
Preparing Samples for Analysis of Small RNA Using the Oligo Only Kit FOR RESEARCH ONLY Topics 3 Introduction 4 Kit Contents, User-Supplied Consumables, and Equipment Checklist 6 Isolate Small RNA by Denaturing
More informationSuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationPrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
More informationTe c htips. Simple Approaches for Optimization of RT-PCR TECH TIP 206
Te c htips TECH TIP 206 Fueling Innovation USB Corporation 26111 Miles Road Cleveland, Ohio 44128 800.321.9322 www.usbweb.com Simple Approaches for Optimization of RT-PCR Reverse transcription-polymerase
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationTB Green Premix Ex Taq II (Tli RNaseH Plus)
Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.
More informationpgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl
More informationAccura High-Fidelity Polymerase
Accura High-Fidelity Polymerase FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)
More informationHigh-Specificity mirna QPCR Core Reagent Kit
High-Specificity mirna QPCR Core Reagent Kit Instruction Manual Catalog #600545 Revision F Research Use Only. Not for Use in Diagnostic Procedures. 600580-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationQuant-X One-Step qrt-pcr TB Green Kit User Manual
Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationPCR Laboratory Exercise
PCR Laboratory Exercise Advance Protocol (updated 1/2018) Introduction Detection of TPA-25 Alu by PCR A Human DNA Fingerprinting Lab Protocol 1994 Cold Spring Harbor Laboratory DNA Learning Center In this
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationTB Green Premix Ex Taq (Tli RNaseH Plus)
Cat. # RR420A For Research Use TB Green Premix Ex Taq (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AK8101. See section V. Storage.
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationThis Product Description is only valid for Lot No. 42R.
HLA Wipe Test Negative Control Product Insert Page 1 of 12 Olerup SSP HLA Wipe Test Negative Control Product number: 102.101-01 including Taq polymerase Product number: 102.101-01u without Taq polymerase
More informationE.Z.N.A. Plant RNA Kit. R preps R preps R preps
E.Z.N.A. Plant RNA Kit R6827-00 5 preps R6827-01 50 preps R6827-02 200 preps September 2014 E.Z.N.A. Plant RNA Kit Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents and Storage...4
More informationTable of Contents. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...6. PCR Condition...8. VIII. Application...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. VII. Protocol...6 PCR Condition...8 VIII. Application...8 IX. Preparation of RNA Sample... 10
More informationOlerup SSP HLA Wipe Test Negative Control
HLA Wipe Test Negative Control Product Insert Page 1 of 12 Olerup SSP HLA Wipe Test Negative Control Product number: 102.101-01u without Taq polymerase Lot number: 80M Expiry date: 2014-March-01 Number
More informationCat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v201712da_2
Cat. # R100A For Research Use EpiScope MSP Kit Product Manual Table of Contents I. Description... 3 II. MSP Principle... 3 III. Components... 4 IV. Storage... 4 V. Materials Required but not Provided...
More informationCold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
More informationTaKaRa One Step RNA PCR Kit (AMV)
Cat. # RR024A For Research Use TaKaRa One Step RNA PCR Kit (AMV) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Features... 4 IV. Components... 4 V. Materials Required but
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk
Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. AK9104. See section IV.
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationGuidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature
Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationProtocol for amplification of measles sequencing window (N-450)
Annex 7.1 Protocol for amplification of measles sequencing window (N-450) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop their own
More informationCat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da
For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...
More informationsmall RNA Cloning Kit
Cat. # RR065 For Research Use small RNA Cloning Kit Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage... 6 V. Precautions
More informationUSDA RiceCAP DNA extraction using DNeasy Plant Mini Kit.
DNA extraction using DNeasy Plant Mini Kit. Preparatory work: 1. If using the kit for the first time, add ethanol to buffer AW and buffer AP3/E to obtain the working solutions. 2. Preheat a water bath
More information