Linkage Disequilibrium. Adele Crane & Angela Taravella
|
|
- Luke Manning
- 6 years ago
- Views:
Transcription
1 Linkage Disequilibrium Adele Crane & Angela Taravella
2 Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay Patterns of LD in human populations GWAS and fine-scale mapping
3 What is Linkage Disequilibrium (LD)? Linkage disequilibrium: non-independence of alleles at different sites (Pritchard & Pzeworski, 2001) LD exists due to shared ancestry In absence of recombination, diversity arises through mutation Ardlie et al. (2002)
4 Example: Allele Frequencies Biallelic Loci Locus 1 (alleles A and a) and Locus 2 (alleles B and b) are studied for LD Allele A a B b Allele Frequency p A p a p B p b Gamete Frequency p AB p Ab p ab p ab
5 Example: Allele Frequencies Biallelic Loci Expected frequencies when loci are in linkage equilibrium (loci are independent): p AB = p A p B p Ab = p A p b p ab = p a p B p ab = p a p b How do we quantify the difference between expected and observed frequencies?
6 LD Measurements: D & D Linkage Disequilibrium Coefficient D: D = p AB - p A p B D = 0 in linkage equilibrium D 0 in linkage disequilibrium +/- sign for D depends on how alleles are labeled
7 LD Measurements: D & D Normalized coefficient D better measurement: D depends on allelic frequencies D is [D] over maximum possible values given allele frequencies D = 1 if alleles have not been separated by recombination during history of sample analyzed (complete linkage disequilibrium) D < 1 if LD is disrupted Weakness: D values can be inflated by small samples or low frequencies of minor alleles
8 LD Measurements: r 2 ( 2 ) r 2 = 1 if alleles have not been separated by recombination and have same allele frequency (perfect linkage disequilibrium) r 2 less inflated by small sample sizes
9 Comparison of D and r 2 + is D and is r 2 Simulated decay of D and r 2 as a function of genetic distance (cm) under a constant population size and random mating D and r 2 behave differently and high values of D may not be consistent with low values of r 2. More random variation in D values Pritchard & Pzeworski, 2001
10 LD parameter ρ r 2 can have inverse relationship with ρ = 4N e c N e : effective population size c : recombination rate (varies over time and across regions) ρ is a scaled recombination rate Expected r 2 : E(r 2 ) 1 / (1 + ρ) Large N e : E(r 2 ) 1 / ρ LD increases as ρ decreases Advantages: Can compare LD observed in studies using different marker spacing or types of data (SNP vs. microsatellite data) Provides estimate of recombination rate per generation
11 Genetic factors shaping LD Recombination Mutation Inversions Hotspots high recombination breaks down haplotype blocks low LD Comparisons of LD in different parts of the genome may not be informative unless local recombination rates are known Myers hotspot motif Introduces diversity into haplotype blocks (especially in non-recombining regions) Suppresses recombination Strong LD can develop Gene conversion Gene conversion can affect short scale LD LD may be broken up by gene conversion
12 Selection Shaping LD Hitchhiking effect Haplotype near a favored variant swept into high frequency or fixation Background selection Loss of diversity at neutral locus due to negative selection against linked deleterious alleles Epistatic selection Epistasis: interaction between genes (ex: suppression of phenotypic expression) Needs to be strong to maintain allelic association over long distance
13 Demographic Factors Shaping LD Inbreeding Inbreeding: mating between related individuals Decreased diversity levels can increase LD Minor effect in humans Bottlenecks Temporary reduction in population size can increase LD Long term bottlenecks can lead to sharp reduction in Ne and thus higher LD Populations outside of Africa have higher LD Admixture LD between unlinked sites seen at time of admixture LD increases over long range with recent admixture of populations with different allele frequencies rapid decay Breaks down with random mating
14 Demographic Models and Expected LD Decay r hat r hat Genetic distance (cm) Genetic distance (cm) Standard model Panmictic population of constant size (N e =10 4 ). Considerable variability is expected Kruglyak model Exponential population growth, from 10 4 to 5x10 9 Low LD between loci expected under this model because of large N e 1 island sample All individuals are drawn from the same sub population 2 island sample All individuals are drawn from both sub populations equally. Population structure tends to increase levels of LD Pritchard & Pzeworski, 2001
15 Demographic Models and Expected LD Decay Different growth models Neutral model (solid line) population growth leads to reduction in LD but the effect is not as great as with the Kruglyak model Kruglyak model (long dashed line) Expanding population get dramatic reduction in LD Can use LD decay to make inferences on human demographic history Pritchard & Pzeworski, 2001
16 Pattern of LD in Human Populations LD in global populations LD increases outside of Africa Bottlenecks LD in African Populations Southern African origin for modern humans LD decay averaged across populations within each of six geographic regions The highest correlation coefficient in blue indicates the best fit with a potential geographic origin
17 GWAS and LD Genome wide association study (GWAS) Testing cases and controls to determine potential variants associated with a disease trait Low r 2 will have little power to detect association at the marker locus Want marker locus linked to disease susceptibility mutation Need a marker density with high probability of strong LD between at least one marker locus and the disease susceptibility mutation Issues with finding causative SNPs (gene localization) Long range LD is problematic Human populations vary in LD and recombination
18 References Ardlie, K., Kruglyak, L., & Seielstad, M. Patterns of linkage disequilibrium in human genome. Nature Reviews Genetics 3 (2002): doi: /nrg777 Henn, B. M., et al. "Hunter-gatherer genomic diversity suggests a southern African origin for modern humans." Proceedings of the National Academy of Sciences (2011): International HapMap Consortium. A haplotype map of the human genome. Nature 437 (2005): doi: /nature04226 Jallow, M., et al. "Genome-wide and fine-resolution association analysis of malaria in West Africa." Nature genetics 41.6 (2009): Jobling, M., Hurles, M., & Tyler-Smith, C. Human evolutionary genetics: origins, peoples & disease. Garland Science, Pritchard, Jonathan K., & Przeworski, M. "Linkage disequilibrium in humans: models and data." The American Journal of Human Genetics 69.1 (2001): 1-14.
Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationAn Introduction to Population Genetics
An Introduction to Population Genetics THEORY AND APPLICATIONS f 2 A (1 ) E 1 D [ ] = + 2M ES [ ] fa fa = 1 sf a Rasmus Nielsen Montgomery Slatkin Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationLINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION?
LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION? A. COLLINS Department of Human Genetics University of Southampton Duthie Building (808) Southampton General Hospital
More informationGenetics Effective Use of New and Existing Methods
Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for
More informationExplaining the evolution of sex and recombination
Explaining the evolution of sex and recombination Peter Keightley Institute of Evolutionary Biology University of Edinburgh Sexual reproduction is ubiquitous in eukaryotes Syngamy Meiosis with recombination
More informationConifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 3 Population Genetics Nicholas Wheeler & David Harry Oregon
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationHAPLOTYPE BLOCKS AND LINKAGE DISEQUILIBRIUM IN THE HUMAN GENOME
HAPLOTYPE BLOCKS AND LINKAGE DISEQUILIBRIUM IN THE HUMAN GENOME Jeffrey D. Wall* and Jonathan K. Pritchard* There is great interest in the patterns and extent of linkage disequilibrium (LD) in humans and
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationb. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.
NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops
More informationThe evolutionary significance of structure. Detecting and describing structure. Implications for genetic variability
Population structure The evolutionary significance of structure Detecting and describing structure Wright s F statistics Implications for genetic variability Inbreeding effects of structure The Wahlund
More informationTwo-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles:
The human genome has ~30,000 genes. Drosophila contains ~10,000 genes. Bacteria contain thousands of genes. Even viruses contain dozens of genes. Clearly, one-locus models are oversimplifications. Unfortunately,
More informationGenome-wide analyses in admixed populations: Challenges and opportunities
Genome-wide analyses in admixed populations: Challenges and opportunities E-mail: esteban.parra@utoronto.ca Esteban J. Parra, Ph.D. Admixed populations: an invaluable resource to study the genetics of
More informationWhy do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationLD Mapping and the Coalescent
Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave
More information5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations
Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.
More informationThe Evolution of Populations
The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationHow Populations Evolve. Chapter 15
How Populations Evolve Chapter 15 Populations Evolve Biological evolution does not change individuals It changes a population Traits in a population vary among individuals Evolution is change in frequency
More informationDeep learning sequence-based ab initio prediction of variant effects on expression and disease risk
Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong
More informationQuestions we are addressing. Hardy-Weinberg Theorem
Factors causing genotype frequency changes or evolutionary principles Selection = variation in fitness; heritable Mutation = change in DNA of genes Migration = movement of genes across populations Vectors
More informationPopulation Genetics II. Bio
Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT
More informationSignatures of a population bottleneck can be localised along a recombining chromosome
Signatures of a population bottleneck can be localised along a recombining chromosome Céline Becquet, Peter Andolfatto Bioinformatics and Modelling, INSA of Lyon Institute for Cell, Animal and Population
More informationThe Human Genome Project has always been something of a misnomer, implying the existence of a single human genome
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique
More informationSNP Selection. Outline of Tutorial. Why Do We Need tagsnps? Concepts of tagsnps. LD and haplotype definitions. Haplotype blocks and definitions
SNP Selection Outline of Tutorial Concepts of tagsnps University of Louisville Center for Genetics and Molecular Medicine January 10, 2008 Dana Crawford, PhD Vanderbilt University Center for Human Genetics
More informationSummary. Introduction
doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size
More informationThe Evolution of Populations
Microevolution The Evolution of Populations C H A P T E R 2 3 Change in allele frequencies over generations Three mechanisms cause allele frequency change: Natural selection (leads to adaptation) Genetic
More information-Is change in the allele frequencies of a population over generations -This is evolution on its smallest scale
Remember: -Evolution is a change in species over time -Heritable variations exist within a population -These variations can result in differential reproductive success -Over generations this can result
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationWindfalls and pitfalls
254 review Evolution, Medicine, and Public Health [2013] pp. 254 272 doi:10.1093/emph/eot021 Windfalls and pitfalls Applications of population genetics to the search for disease genes Michael D. Edge 1,
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationLinkage Disequilibrium
Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level
More informationSupplementary File: In search of the Goldilocks zone for hybrid speciation
Supplementary File: In search of the Goldilocks zone for hybrid speciation Alexandre Blanckaert 1 and Claudia Bank 1 1 Instituto Gulbenkian de Ciencia, 2780-156 Oeiras, Portugal August 17, 2018 Extra figures
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationPOPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping
POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping - from Darwin's time onward, it has been widely recognized that natural populations harbor a considerably degree of genetic
More informationIntroduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill
Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research
More informationHaplotypes, linkage disequilibrium, and the HapMap
Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,
More informationLecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013
Lecture 19: Hitchhiking and selective sweeps Bruce Walsh lecture notes Synbreed course version 8 July 2013 1 Hitchhiking When an allele is linked to a site under selection, its dynamics are considerably
More informationCS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual
More informationAssociation studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationLinkage Disequilibrium. Biostatistics 666
Linkage Disequilibrium iostatistics 666 Logistics: Office Hours Office hours on Mondays at 4 m. Room 4614 School of Public Health Tower Previously asic roerties of a locus llele Frequencies Genotye Frequencies
More informationI See Dead People: Gene Mapping Via Ancestral Inference
I See Dead People: Gene Mapping Via Ancestral Inference Paul Marjoram, 1 Lada Markovtsova 2 and Simon Tavaré 1,2,3 1 Department of Preventive Medicine, University of Southern California, 1540 Alcazar Street,
More informationPopulation Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs
Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs Luis Hurtado, Isabel Caballero, Danielle Macedo, Mariana Mateos It is important
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics
CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated
More informationQuantitative Genetics for Using Genetic Diversity
Footprints of Diversity in the Agricultural Landscape: Understanding and Creating Spatial Patterns of Diversity Quantitative Genetics for Using Genetic Diversity Bruce Walsh Depts of Ecology & Evol. Biology,
More informationDetecting ancient admixture using DNA sequence data
Detecting ancient admixture using DNA sequence data October 10, 2008 Jeff Wall Institute for Human Genetics UCSF Background Origin of genus Homo 2 2.5 Mya Out of Africa (part I)?? 1.6 1.8 Mya Further spread
More informationOn the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study
On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study J.M. Comeron, M. Kreitman, F.M. De La Vega Pacific Symposium on Biocomputing 8:478-489(23)
More informationChapter 25 Population Genetics
Chapter 25 Population Genetics Population Genetics -- the discipline within evolutionary biology that studies changes in allele frequencies. Population -- a group of individuals from the same species that
More informationGenomics assisted Genetic enhancement Applications and potential in tree improvement
Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore
More informationBy the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
More informationThe Evolution of Populations
Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationPark /12. Yudin /19. Li /26. Song /9
Each student is responsible for (1) preparing the slides and (2) leading the discussion (from problems) related to his/her assigned sections. For uniformity, we will use a single Powerpoint template throughout.
More informationProblem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait.
Problem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait. Therefore, No Genotypes Could be Measured, and No Genotypic Means Could Be
More informationA brief introduction to population genetics
A brief introduction to population genetics Population genetics Definition studies distributions & changes of allele frequencies in populations over time effects considered: natural selection, genetic
More informationOverview of using molecular markers to detect selection
Overview of using molecular markers to detect selection Bruce Walsh lecture notes Uppsala EQG 2012 course version 5 Feb 2012 Detailed reading: WL Chapters 8, 9 Detecting selection Bottom line: looking
More informationVariation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?
Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies
More informationLecture 10 : Whole genome sequencing and analysis. Introduction to Computational Biology Teresa Przytycka, PhD
Lecture 10 : Whole genome sequencing and analysis Introduction to Computational Biology Teresa Przytycka, PhD Sequencing DNA Goal obtain the string of bases that make a given DNA strand. Problem Typically
More informationDrupal.behaviors.print = function(context) {window.print();window.close();}>
Page 1 of 7 Drupal.behaviors.print = function(context) {window.print();window.close();}> All the Variation October 03, 2011 All the Variation By Ciara Curtin People are very different from one another
More informationIntroduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15
Introduction to Population Genetics Spezielle Statistik in der Biomedizin WS 2014/15 What is population genetics? Describes the genetic structure and variation of populations. Causes Maintenance Changes
More informationRandom Allelic Variation
Random Allelic Variation AKA Genetic Drift Genetic Drift a non-adaptive mechanism of evolution (therefore, a theory of evolution) that sometimes operates simultaneously with others, such as natural selection
More informationStatistical Tests for Admixture Mapping with Case-Control and Cases-Only Data
Am. J. Hum. Genet. 75:771 789, 2004 Statistical Tests for Admixture Mapping with Case-Control and Cases-Only Data Giovanni Montana and Jonathan K. Pritchard Department of Human Genetics, University of
More informationStructure, Measurement & Analysis of Genetic Variation
Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine
More informationGenetic data concepts and tests
Genetic data concepts and tests Cavan Reilly September 21, 2018 Table of contents Overview Linkage disequilibrium Quantifying LD Heatmap for LD Hardy-Weinberg equilibrium Genotyping errors Population substructure
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationTake Home Message. Molecular Imaging Genomics. How to do Genetics. Questions for the Study of. Two Common Methods for Gene Localization
Take Home Message Molecular Imaging Genomics David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University This may be the most important thing I say in this lecture.
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2017 Human Genetics Series Tuesday 4/10/17 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationFamilial Breast Cancer
Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationhttp://genemapping.org/ Epistasis in Association Studies David Evans Law of Independent Assortment Biological Epistasis Bateson (99) a masking effect whereby a variant or allele at one locus prevents
More informationThe Evolution of Populations
Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationBST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics
BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics!1 Housekeeping HW1 will be posted on course website tonight 1st lab will be on Wednesday TA office hours have
More informationIt s not a fundamental force like mutation, selection, and drift.
What is Genetic Draft? It s not a fundamental force like mutation, selection, and drift. It s an effect of mutation at a selected locus, that reduces variation at nearby (linked) loci, thereby reducing
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation
More informationPopulation stratification. Background & PLINK practical
Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major
More informationPop Gen meets Quant Gen and other open questions
Pop Gen meets Quant Gen and other open questions Ryan D. Hernandez Tim O Connor ryan.hernandez@ucsf.edu 1 Modern Human Genomics 2 http://www.finca.org Human Colonization of the World Kennewick 9,500 years
More informationThe role of genomic islands of divergence during speciation. Connor Morgan-Lang November 18th
The role of genomic islands of divergence during speciation Connor Morgan-Lang November 18th Outline 1) Review of speciation 2) Genomic architectures 3) Genomic islands of divergence 4) Methods for identification
More information16.2 Evolution as Genetic Change
16.2 Evolution as Genetic Change 1 of 40 16-2 Evolution as Genetic Change 16-2 Evolution as Genetic Change If an individual dies without reproducing, it does not contribute to the gene pool. If an individual
More informationChromosome inversions in human populations Maria Bellet Coll
Chromosome inversions in human populations Maria Bellet Coll Universitat Autònoma de Barcelona - Genomics Table of contents Structural variation Inversions Methods for inversions analysis Pair-end mapping
More informationBST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics
BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics 1 Housekeeping HW1 due on Wednesday TA office hours today at 5:20 - FXB G11 What have we studied Background Structure
More informationLecture 5: Inbreeding and Allozymes. Sept 1, 2006
Lecture 5: Inbreeding and Allozymes Sept 1, 2006 Last Time Tandem repeats and recombination Organellar DNA Introduction to DNA in populations Organelle Inheritance Organelles can be excluded from one parent's
More informationLecture 2: Height in Plants, Animals, and Humans. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013
Lecture 2: Height in Plants, Animals, and Humans Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Is height a polygenic trait? http://en.wikipedia.org/wiki/gregor_mendel Case Study
More informationThe Theory of Evolution
The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationIntroduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies
Introduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies Lisa J. Strug, PhD Guest Lecturer Biosta)s)cs Laboratory Course (CHL5207/8) March 5, 2015 Gene Mapping in the News Study Finds Gene
More informationSNPpattern: A Genetic Tool to Derive Haplotype Blocks and Measure Genomic Diversity in Populations Using SNP Genotypes
20 SNPpattern: A Genetic Tool to Derive Haplotype Blocks and Measure Genomic Diversity in Populations Using SNP Genotypes Stephen J Goodswen 1,2 and Haja N Kadarmideen 3 1 University of Technology Sydney,
More informationOverview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat
Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,
More informationAssociation Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work
Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common
More informationLet s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are:
Problem Set 8 Genetics 371 Winter 2010 1. In a population exhibiting Hardy-Weinberg equilibrium, 23% of the individuals are homozygous for a recessive character. What will the genotypic, phenotypic and
More informationThe Evolution of Populations
Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationHISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY
Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université
More information