Linkage Disequilibrium. Adele Crane & Angela Taravella

Size: px
Start display at page:

Download "Linkage Disequilibrium. Adele Crane & Angela Taravella"

Transcription

1 Linkage Disequilibrium Adele Crane & Angela Taravella

2 Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay Patterns of LD in human populations GWAS and fine-scale mapping

3 What is Linkage Disequilibrium (LD)? Linkage disequilibrium: non-independence of alleles at different sites (Pritchard & Pzeworski, 2001) LD exists due to shared ancestry In absence of recombination, diversity arises through mutation Ardlie et al. (2002)

4 Example: Allele Frequencies Biallelic Loci Locus 1 (alleles A and a) and Locus 2 (alleles B and b) are studied for LD Allele A a B b Allele Frequency p A p a p B p b Gamete Frequency p AB p Ab p ab p ab

5 Example: Allele Frequencies Biallelic Loci Expected frequencies when loci are in linkage equilibrium (loci are independent): p AB = p A p B p Ab = p A p b p ab = p a p B p ab = p a p b How do we quantify the difference between expected and observed frequencies?

6 LD Measurements: D & D Linkage Disequilibrium Coefficient D: D = p AB - p A p B D = 0 in linkage equilibrium D 0 in linkage disequilibrium +/- sign for D depends on how alleles are labeled

7 LD Measurements: D & D Normalized coefficient D better measurement: D depends on allelic frequencies D is [D] over maximum possible values given allele frequencies D = 1 if alleles have not been separated by recombination during history of sample analyzed (complete linkage disequilibrium) D < 1 if LD is disrupted Weakness: D values can be inflated by small samples or low frequencies of minor alleles

8 LD Measurements: r 2 ( 2 ) r 2 = 1 if alleles have not been separated by recombination and have same allele frequency (perfect linkage disequilibrium) r 2 less inflated by small sample sizes

9 Comparison of D and r 2 + is D and is r 2 Simulated decay of D and r 2 as a function of genetic distance (cm) under a constant population size and random mating D and r 2 behave differently and high values of D may not be consistent with low values of r 2. More random variation in D values Pritchard & Pzeworski, 2001

10 LD parameter ρ r 2 can have inverse relationship with ρ = 4N e c N e : effective population size c : recombination rate (varies over time and across regions) ρ is a scaled recombination rate Expected r 2 : E(r 2 ) 1 / (1 + ρ) Large N e : E(r 2 ) 1 / ρ LD increases as ρ decreases Advantages: Can compare LD observed in studies using different marker spacing or types of data (SNP vs. microsatellite data) Provides estimate of recombination rate per generation

11 Genetic factors shaping LD Recombination Mutation Inversions Hotspots high recombination breaks down haplotype blocks low LD Comparisons of LD in different parts of the genome may not be informative unless local recombination rates are known Myers hotspot motif Introduces diversity into haplotype blocks (especially in non-recombining regions) Suppresses recombination Strong LD can develop Gene conversion Gene conversion can affect short scale LD LD may be broken up by gene conversion

12 Selection Shaping LD Hitchhiking effect Haplotype near a favored variant swept into high frequency or fixation Background selection Loss of diversity at neutral locus due to negative selection against linked deleterious alleles Epistatic selection Epistasis: interaction between genes (ex: suppression of phenotypic expression) Needs to be strong to maintain allelic association over long distance

13 Demographic Factors Shaping LD Inbreeding Inbreeding: mating between related individuals Decreased diversity levels can increase LD Minor effect in humans Bottlenecks Temporary reduction in population size can increase LD Long term bottlenecks can lead to sharp reduction in Ne and thus higher LD Populations outside of Africa have higher LD Admixture LD between unlinked sites seen at time of admixture LD increases over long range with recent admixture of populations with different allele frequencies rapid decay Breaks down with random mating

14 Demographic Models and Expected LD Decay r hat r hat Genetic distance (cm) Genetic distance (cm) Standard model Panmictic population of constant size (N e =10 4 ). Considerable variability is expected Kruglyak model Exponential population growth, from 10 4 to 5x10 9 Low LD between loci expected under this model because of large N e 1 island sample All individuals are drawn from the same sub population 2 island sample All individuals are drawn from both sub populations equally. Population structure tends to increase levels of LD Pritchard & Pzeworski, 2001

15 Demographic Models and Expected LD Decay Different growth models Neutral model (solid line) population growth leads to reduction in LD but the effect is not as great as with the Kruglyak model Kruglyak model (long dashed line) Expanding population get dramatic reduction in LD Can use LD decay to make inferences on human demographic history Pritchard & Pzeworski, 2001

16 Pattern of LD in Human Populations LD in global populations LD increases outside of Africa Bottlenecks LD in African Populations Southern African origin for modern humans LD decay averaged across populations within each of six geographic regions The highest correlation coefficient in blue indicates the best fit with a potential geographic origin

17 GWAS and LD Genome wide association study (GWAS) Testing cases and controls to determine potential variants associated with a disease trait Low r 2 will have little power to detect association at the marker locus Want marker locus linked to disease susceptibility mutation Need a marker density with high probability of strong LD between at least one marker locus and the disease susceptibility mutation Issues with finding causative SNPs (gene localization) Long range LD is problematic Human populations vary in LD and recombination

18 References Ardlie, K., Kruglyak, L., & Seielstad, M. Patterns of linkage disequilibrium in human genome. Nature Reviews Genetics 3 (2002): doi: /nrg777 Henn, B. M., et al. "Hunter-gatherer genomic diversity suggests a southern African origin for modern humans." Proceedings of the National Academy of Sciences (2011): International HapMap Consortium. A haplotype map of the human genome. Nature 437 (2005): doi: /nature04226 Jallow, M., et al. "Genome-wide and fine-resolution association analysis of malaria in West Africa." Nature genetics 41.6 (2009): Jobling, M., Hurles, M., & Tyler-Smith, C. Human evolutionary genetics: origins, peoples & disease. Garland Science, Pritchard, Jonathan K., & Przeworski, M. "Linkage disequilibrium in humans: models and data." The American Journal of Human Genetics 69.1 (2001): 1-14.

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012 Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation

More information

Analysis of genome-wide genotype data

Analysis of genome-wide genotype data Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version

More information

Algorithms for Genetics: Introduction, and sources of variation

Algorithms for Genetics: Introduction, and sources of variation Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual

More information

An Introduction to Population Genetics

An Introduction to Population Genetics An Introduction to Population Genetics THEORY AND APPLICATIONS f 2 A (1 ) E 1 D [ ] = + 2M ES [ ] fa fa = 1 sf a Rasmus Nielsen Montgomery Slatkin Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Computational Workflows for Genome-Wide Association Study: I

Computational Workflows for Genome-Wide Association Study: I Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases

More information

LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION?

LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION? LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION? A. COLLINS Department of Human Genetics University of Southampton Duthie Building (808) Southampton General Hospital

More information

Genetics Effective Use of New and Existing Methods

Genetics Effective Use of New and Existing Methods Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for

More information

Explaining the evolution of sex and recombination

Explaining the evolution of sex and recombination Explaining the evolution of sex and recombination Peter Keightley Institute of Evolutionary Biology University of Edinburgh Sexual reproduction is ubiquitous in eukaryotes Syngamy Meiosis with recombination

More information

Conifer Translational Genomics Network Coordinated Agricultural Project

Conifer Translational Genomics Network Coordinated Agricultural Project Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 3 Population Genetics Nicholas Wheeler & David Harry Oregon

More information

Genome-Wide Association Studies (GWAS): Computational Them

Genome-Wide Association Studies (GWAS): Computational Them Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus

More information

Understanding genetic association studies. Peter Kamerman

Understanding genetic association studies. Peter Kamerman Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -

More information

HAPLOTYPE BLOCKS AND LINKAGE DISEQUILIBRIUM IN THE HUMAN GENOME

HAPLOTYPE BLOCKS AND LINKAGE DISEQUILIBRIUM IN THE HUMAN GENOME HAPLOTYPE BLOCKS AND LINKAGE DISEQUILIBRIUM IN THE HUMAN GENOME Jeffrey D. Wall* and Jonathan K. Pritchard* There is great interest in the patterns and extent of linkage disequilibrium (LD) in humans and

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Supplementary Note: Detecting population structure in rare variant data

Supplementary Note: Detecting population structure in rare variant data Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to

More information

b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.

b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus. NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops

More information

The evolutionary significance of structure. Detecting and describing structure. Implications for genetic variability

The evolutionary significance of structure. Detecting and describing structure. Implications for genetic variability Population structure The evolutionary significance of structure Detecting and describing structure Wright s F statistics Implications for genetic variability Inbreeding effects of structure The Wahlund

More information

Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles:

Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles: The human genome has ~30,000 genes. Drosophila contains ~10,000 genes. Bacteria contain thousands of genes. Even viruses contain dozens of genes. Clearly, one-locus models are oversimplifications. Unfortunately,

More information

Genome-wide analyses in admixed populations: Challenges and opportunities

Genome-wide analyses in admixed populations: Challenges and opportunities Genome-wide analyses in admixed populations: Challenges and opportunities E-mail: esteban.parra@utoronto.ca Esteban J. Parra, Ph.D. Admixed populations: an invaluable resource to study the genetics of

More information

Why do we need statistics to study genetics and evolution?

Why do we need statistics to study genetics and evolution? Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.

More information

What is genetic variation?

What is genetic variation? enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center

More information

LD Mapping and the Coalescent

LD Mapping and the Coalescent Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave

More information

5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations

5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.

More information

The Evolution of Populations

The Evolution of Populations The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether

More information

Crash-course in genomics

Crash-course in genomics Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is

More information

How Populations Evolve. Chapter 15

How Populations Evolve. Chapter 15 How Populations Evolve Chapter 15 Populations Evolve Biological evolution does not change individuals It changes a population Traits in a population vary among individuals Evolution is change in frequency

More information

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong

More information

Questions we are addressing. Hardy-Weinberg Theorem

Questions we are addressing. Hardy-Weinberg Theorem Factors causing genotype frequency changes or evolutionary principles Selection = variation in fitness; heritable Mutation = change in DNA of genes Migration = movement of genes across populations Vectors

More information

Population Genetics II. Bio

Population Genetics II. Bio Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT

More information

Signatures of a population bottleneck can be localised along a recombining chromosome

Signatures of a population bottleneck can be localised along a recombining chromosome Signatures of a population bottleneck can be localised along a recombining chromosome Céline Becquet, Peter Andolfatto Bioinformatics and Modelling, INSA of Lyon Institute for Cell, Animal and Population

More information

The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome

The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique

More information

SNP Selection. Outline of Tutorial. Why Do We Need tagsnps? Concepts of tagsnps. LD and haplotype definitions. Haplotype blocks and definitions

SNP Selection. Outline of Tutorial. Why Do We Need tagsnps? Concepts of tagsnps. LD and haplotype definitions. Haplotype blocks and definitions SNP Selection Outline of Tutorial Concepts of tagsnps University of Louisville Center for Genetics and Molecular Medicine January 10, 2008 Dana Crawford, PhD Vanderbilt University Center for Human Genetics

More information

Summary. Introduction

Summary. Introduction doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size

More information

The Evolution of Populations

The Evolution of Populations Microevolution The Evolution of Populations C H A P T E R 2 3 Change in allele frequencies over generations Three mechanisms cause allele frequency change: Natural selection (leads to adaptation) Genetic

More information

-Is change in the allele frequencies of a population over generations -This is evolution on its smallest scale

-Is change in the allele frequencies of a population over generations -This is evolution on its smallest scale Remember: -Evolution is a change in species over time -Heritable variations exist within a population -These variations can result in differential reproductive success -Over generations this can result

More information

S G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics

S G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public

More information

Human Genetics and Gene Mapping of Complex Traits

Human Genetics and Gene Mapping of Complex Traits Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:

More information

Windfalls and pitfalls

Windfalls and pitfalls 254 review Evolution, Medicine, and Public Health [2013] pp. 254 272 doi:10.1093/emph/eot021 Windfalls and pitfalls Applications of population genetics to the search for disease genes Michael D. Edge 1,

More information

Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573

Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain

More information

Linkage Disequilibrium

Linkage Disequilibrium Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level

More information

Supplementary File: In search of the Goldilocks zone for hybrid speciation

Supplementary File: In search of the Goldilocks zone for hybrid speciation Supplementary File: In search of the Goldilocks zone for hybrid speciation Alexandre Blanckaert 1 and Claudia Bank 1 1 Instituto Gulbenkian de Ciencia, 2780-156 Oeiras, Portugal August 17, 2018 Extra figures

More information

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011 EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS

More information

POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping

POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping - from Darwin's time onward, it has been widely recognized that natural populations harbor a considerably degree of genetic

More information

Introduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill

Introduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research

More information

Haplotypes, linkage disequilibrium, and the HapMap

Haplotypes, linkage disequilibrium, and the HapMap Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,

More information

Lecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013

Lecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013 Lecture 19: Hitchhiking and selective sweeps Bruce Walsh lecture notes Synbreed course version 8 July 2013 1 Hitchhiking When an allele is linked to a site under selection, its dynamics are considerably

More information

CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes

CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual

More information

Association studies (Linkage disequilibrium)

Association studies (Linkage disequilibrium) Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a

More information

Mapping and Mapping Populations

Mapping and Mapping Populations Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)

More information

Linkage Disequilibrium. Biostatistics 666

Linkage Disequilibrium. Biostatistics 666 Linkage Disequilibrium iostatistics 666 Logistics: Office Hours Office hours on Mondays at 4 m. Room 4614 School of Public Health Tower Previously asic roerties of a locus llele Frequencies Genotye Frequencies

More information

I See Dead People: Gene Mapping Via Ancestral Inference

I See Dead People: Gene Mapping Via Ancestral Inference I See Dead People: Gene Mapping Via Ancestral Inference Paul Marjoram, 1 Lada Markovtsova 2 and Simon Tavaré 1,2,3 1 Department of Preventive Medicine, University of Southern California, 1540 Alcazar Street,

More information

Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs

Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs Luis Hurtado, Isabel Caballero, Danielle Macedo, Mariana Mateos It is important

More information

CMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics

CMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated

More information

Quantitative Genetics for Using Genetic Diversity

Quantitative Genetics for Using Genetic Diversity Footprints of Diversity in the Agricultural Landscape: Understanding and Creating Spatial Patterns of Diversity Quantitative Genetics for Using Genetic Diversity Bruce Walsh Depts of Ecology & Evol. Biology,

More information

Detecting ancient admixture using DNA sequence data

Detecting ancient admixture using DNA sequence data Detecting ancient admixture using DNA sequence data October 10, 2008 Jeff Wall Institute for Human Genetics UCSF Background Origin of genus Homo 2 2.5 Mya Out of Africa (part I)?? 1.6 1.8 Mya Further spread

More information

On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study

On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study J.M. Comeron, M. Kreitman, F.M. De La Vega Pacific Symposium on Biocomputing 8:478-489(23)

More information

Chapter 25 Population Genetics

Chapter 25 Population Genetics Chapter 25 Population Genetics Population Genetics -- the discipline within evolutionary biology that studies changes in allele frequencies. Population -- a group of individuals from the same species that

More information

Genomics assisted Genetic enhancement Applications and potential in tree improvement

Genomics assisted Genetic enhancement Applications and potential in tree improvement Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore

More information

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs (3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable

More information

The Evolution of Populations

The Evolution of Populations Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Park /12. Yudin /19. Li /26. Song /9

Park /12. Yudin /19. Li /26. Song /9 Each student is responsible for (1) preparing the slides and (2) leading the discussion (from problems) related to his/her assigned sections. For uniformity, we will use a single Powerpoint template throughout.

More information

Problem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait.

Problem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait. Problem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait. Therefore, No Genotypes Could be Measured, and No Genotypic Means Could Be

More information

A brief introduction to population genetics

A brief introduction to population genetics A brief introduction to population genetics Population genetics Definition studies distributions & changes of allele frequencies in populations over time effects considered: natural selection, genetic

More information

Overview of using molecular markers to detect selection

Overview of using molecular markers to detect selection Overview of using molecular markers to detect selection Bruce Walsh lecture notes Uppsala EQG 2012 course version 5 Feb 2012 Detailed reading: WL Chapters 8, 9 Detecting selection Bottom line: looking

More information

Variation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?

Variation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both? Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies

More information

Lecture 10 : Whole genome sequencing and analysis. Introduction to Computational Biology Teresa Przytycka, PhD

Lecture 10 : Whole genome sequencing and analysis. Introduction to Computational Biology Teresa Przytycka, PhD Lecture 10 : Whole genome sequencing and analysis Introduction to Computational Biology Teresa Przytycka, PhD Sequencing DNA Goal obtain the string of bases that make a given DNA strand. Problem Typically

More information

Drupal.behaviors.print = function(context) {window.print();window.close();}>

Drupal.behaviors.print = function(context) {window.print();window.close();}> Page 1 of 7 Drupal.behaviors.print = function(context) {window.print();window.close();}> All the Variation October 03, 2011 All the Variation By Ciara Curtin People are very different from one another

More information

Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15

Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15 Introduction to Population Genetics Spezielle Statistik in der Biomedizin WS 2014/15 What is population genetics? Describes the genetic structure and variation of populations. Causes Maintenance Changes

More information

Random Allelic Variation

Random Allelic Variation Random Allelic Variation AKA Genetic Drift Genetic Drift a non-adaptive mechanism of evolution (therefore, a theory of evolution) that sometimes operates simultaneously with others, such as natural selection

More information

Statistical Tests for Admixture Mapping with Case-Control and Cases-Only Data

Statistical Tests for Admixture Mapping with Case-Control and Cases-Only Data Am. J. Hum. Genet. 75:771 789, 2004 Statistical Tests for Admixture Mapping with Case-Control and Cases-Only Data Giovanni Montana and Jonathan K. Pritchard Department of Human Genetics, University of

More information

Structure, Measurement & Analysis of Genetic Variation

Structure, Measurement & Analysis of Genetic Variation Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine

More information

Genetic data concepts and tests

Genetic data concepts and tests Genetic data concepts and tests Cavan Reilly September 21, 2018 Table of contents Overview Linkage disequilibrium Quantifying LD Heatmap for LD Hardy-Weinberg equilibrium Genotyping errors Population substructure

More information

Genome-wide association studies (GWAS) Part 1

Genome-wide association studies (GWAS) Part 1 Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations

More information

Take Home Message. Molecular Imaging Genomics. How to do Genetics. Questions for the Study of. Two Common Methods for Gene Localization

Take Home Message. Molecular Imaging Genomics. How to do Genetics. Questions for the Study of. Two Common Methods for Gene Localization Take Home Message Molecular Imaging Genomics David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University This may be the most important thing I say in this lecture.

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

Human Genetics and Gene Mapping of Complex Traits

Human Genetics and Gene Mapping of Complex Traits Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2017 Human Genetics Series Tuesday 4/10/17 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:

More information

Familial Breast Cancer

Familial Breast Cancer Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management

More information

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get

More information

http://genemapping.org/ Epistasis in Association Studies David Evans Law of Independent Assortment Biological Epistasis Bateson (99) a masking effect whereby a variant or allele at one locus prevents

More information

The Evolution of Populations

The Evolution of Populations Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics!1 Housekeeping HW1 will be posted on course website tonight 1st lab will be on Wednesday TA office hours have

More information

It s not a fundamental force like mutation, selection, and drift.

It s not a fundamental force like mutation, selection, and drift. What is Genetic Draft? It s not a fundamental force like mutation, selection, and drift. It s an effect of mutation at a selected locus, that reduces variation at nearby (linked) loci, thereby reducing

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

More information

Population stratification. Background & PLINK practical

Population stratification. Background & PLINK practical Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major

More information

Pop Gen meets Quant Gen and other open questions

Pop Gen meets Quant Gen and other open questions Pop Gen meets Quant Gen and other open questions Ryan D. Hernandez Tim O Connor ryan.hernandez@ucsf.edu 1 Modern Human Genomics 2 http://www.finca.org Human Colonization of the World Kennewick 9,500 years

More information

The role of genomic islands of divergence during speciation. Connor Morgan-Lang November 18th

The role of genomic islands of divergence during speciation. Connor Morgan-Lang November 18th The role of genomic islands of divergence during speciation Connor Morgan-Lang November 18th Outline 1) Review of speciation 2) Genomic architectures 3) Genomic islands of divergence 4) Methods for identification

More information

16.2 Evolution as Genetic Change

16.2 Evolution as Genetic Change 16.2 Evolution as Genetic Change 1 of 40 16-2 Evolution as Genetic Change 16-2 Evolution as Genetic Change If an individual dies without reproducing, it does not contribute to the gene pool. If an individual

More information

Chromosome inversions in human populations Maria Bellet Coll

Chromosome inversions in human populations Maria Bellet Coll Chromosome inversions in human populations Maria Bellet Coll Universitat Autònoma de Barcelona - Genomics Table of contents Structural variation Inversions Methods for inversions analysis Pair-end mapping

More information

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics

BST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics 1 Housekeeping HW1 due on Wednesday TA office hours today at 5:20 - FXB G11 What have we studied Background Structure

More information

Lecture 5: Inbreeding and Allozymes. Sept 1, 2006

Lecture 5: Inbreeding and Allozymes. Sept 1, 2006 Lecture 5: Inbreeding and Allozymes Sept 1, 2006 Last Time Tandem repeats and recombination Organellar DNA Introduction to DNA in populations Organelle Inheritance Organelles can be excluded from one parent's

More information

Lecture 2: Height in Plants, Animals, and Humans. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013

Lecture 2: Height in Plants, Animals, and Humans. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Lecture 2: Height in Plants, Animals, and Humans Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Is height a polygenic trait? http://en.wikipedia.org/wiki/gregor_mendel Case Study

More information

The Theory of Evolution

The Theory of Evolution The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

Introduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies

Introduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies Introduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies Lisa J. Strug, PhD Guest Lecturer Biosta)s)cs Laboratory Course (CHL5207/8) March 5, 2015 Gene Mapping in the News Study Finds Gene

More information

SNPpattern: A Genetic Tool to Derive Haplotype Blocks and Measure Genomic Diversity in Populations Using SNP Genotypes

SNPpattern: A Genetic Tool to Derive Haplotype Blocks and Measure Genomic Diversity in Populations Using SNP Genotypes 20 SNPpattern: A Genetic Tool to Derive Haplotype Blocks and Measure Genomic Diversity in Populations Using SNP Genotypes Stephen J Goodswen 1,2 and Haja N Kadarmideen 3 1 University of Technology Sydney,

More information

Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat

Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,

More information

Association Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work

Association Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common

More information

Let s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are:

Let s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are: Problem Set 8 Genetics 371 Winter 2010 1. In a population exhibiting Hardy-Weinberg equilibrium, 23% of the individuals are homozygous for a recessive character. What will the genotypic, phenotypic and

More information

The Evolution of Populations

The Evolution of Populations Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY

HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université

More information