MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING

Size: px
Start display at page:

Download "MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING"

Transcription

1 BME MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING SKKU BME 3 RD GRADE, 2 ND SEMESTER

2 FOR FUN

3 PCR & SEEDING PCR: polymerase chain reaction Electrophoresis Seeding These are for amplifying DNA and cell

4 PCR WHAT DO YOU NEED? Template Primers Polymerase dntp Mg What s the function of this? Buffer

5 PCR WHAT SHOULD YOU KNOW? Temperature Step-by-step temperature! 1. Denaturation 2. Annealing 3. Polymerization

6 PCR CYCLE

7 PHASE OF PCR IDEA! How can we use the linear phase!!!

8 MAKING PRIMERS What should you consider for making the primers? 1. Sequence 2. Length 3. Annealing temperature

9 FIND THE DNA SEQUENCE!

10 EGFP DNA SEQUENCE 5 -ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAA ACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAG TGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACG TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC AAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGG TGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAA GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA TGGACGAGCTGTACAAGTAA-3 What can you see in the sequence??? 1. Start codon 2. Stop codon 3. Correct frame for the Translation?

11 PCR PRIMERS 5 Template 3

12 EGFP DNA SEQUENCE 5 -ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAA ACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAG TGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACG TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC AAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGG TGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAA GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA TGGACGAGCTGTACAAGTAA-3 What can you see in the sequence??? 1. Start codon 2. Stop codon 3. Correct frame for the Translation?

13 ANNEALING TEMPERATURE

14 POLYMERASES Taq polymerase Pfu Taq polymerase is a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Chien et al. in Its name is often abbreviated to Taq Pol or simply Taq. It is frequently used in the polymerase chain reaction (PCR), a method for greatly amplifying the quantity of short segments of DNA.

15 MAKING PRIMERS What should you consider for making the primers? 1. Sequence 2. Length 3. Annealing temperature Question> How to ligase the insert to vector? Hint> Endonuclease reaction and sticky end

16 ENDONUCLEASE AND STICKY ENDS PCR product

17 EGFP DNA SEQUENCE ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAA ACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAG TGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACG TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC AAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGG TGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAA GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA TGGACGAGCTGTACAAGTAA What can you see in the sequence??? 1. Start codon 2. Stop codon 3. Correct frame for the Translation?

18 VECTOR WHICH ENZYME SITES? What is your final purpose? =>Protein expression! What should you consider?

19 PRIMER CONSIDERATION WHICH ENZYME SITES? What is the MCB? What should you consider for using the restriction enzyme sites?

20 WHICH ENZYME DO YOU CHOOSE? Making your own primers for GST-EGFP expression What should you consider? summary Template sequence and annealing temperature Start and stop codons Restriction enzyme Extra sequence for enzyme reaction 5 3 a Template Is it working?

21 DNA ELECTROPHORESIS

22 MAKING AGAROSE GEL 1% agarose gel in TAE buffer Making 1XTAE buffer (500 ml) 25 ml 1xTAE buffer + g agarose? Microwave for 3 min Add SYBR Safe dye intercalating cheminal

23 BE CAREFUL SYBR Green I is marketed as a replacement for the potential human mutagen ethidium bromide, as both safer to work with and free from the complex waste disposal issues of ethidium. However any small molecule capable of binding DNA with high affinity is a possible carcinogen, including SYBR Green.

24 SEEDING

25 E.COLI SEEDING FOR DNA PREP. E. coli growth curve (You already saw the growth pattern of the E.coli on plate!) Anaerobic and aerobic respirations amount of air? Protection from contamination - antibiotics

26 E. COLI GROWTH CURVE Please how the E.coli grows in the plate and LB broth.

27 SEEDING BY LOOP Prepare 5 ml LB broth + antibiotics (amp for pgex vector) Choose one colony and mark by a pen Sanitization by flare Scoop one colony Seed in the LB broth

28 HOMEWORK Please find what is the pfu polymerase and difference from Taq polymerase What is the function of Mg2+ in PCR reaction? What are the blunt and sticky ends of DNA? Please find the differences of anaerobic and aerobic respirations of E. coli. What s the coil and supercoil structures of plasmid? What is the Quantitative PCR, or real-time PCR? (hint, linear phase of PCR) Please find intercalating chemicals, especially EtBr and CYBR green. Please go to the web site, and find and paste the CMV promoter sequence.

29 NEXT WEEK Mini prep Endonuclease reaction

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d. BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key

7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key

More information

Computational Biology 2. Pawan Dhar BII

Computational Biology 2. Pawan Dhar BII Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

PART 1 LAB ESSENTIALS BACK TO LAB PROMOTION. Buy 2 Get 3rd Free. Get started in the lab with these great offers on lab essentials!

PART 1 LAB ESSENTIALS BACK TO LAB PROMOTION. Buy 2 Get 3rd Free. Get started in the lab with these great offers on lab essentials! BACK TO LAB PROMOTION LAB ESSENTIALS PART 1 Get started in the lab with these great offers on lab essentials! DNA Markers and Protein Laddders DNA Polymerases and Agarose Buy 2 Get 3rd Free Plasmid Purification

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids

More information

Fun with DNA polymerase

Fun with DNA polymerase Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase

More information

Hetero-Stagger PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer

More information

HE Swift Cloning Kit

HE Swift Cloning Kit HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100

More information

Downloaded from

Downloaded from 11.BIOTECHNOLOGY - PRINCIPLES AND PROCESSES Multiple Choice Questions Single Correct Answer Type 1. Rising of dough is due to (a) Multiplication of yeast (b) Production of CO (c) Emulsification (d) Hydrolysis

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Application of Molecular Biology tools for cloning of a foreign gene

Application of Molecular Biology tools for cloning of a foreign gene IFM/Kemi Linköpings Universitet September 2013/LGM Labmanual Project course Application of Molecular Biology tools for cloning of a foreign gene Table of contents Introduction... 3 Amplification of a gene

More information

Chapter 10 (Part II) Gene Isolation and Manipulation

Chapter 10 (Part II) Gene Isolation and Manipulation Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the

More information

Taq + dntps #EZ U

Taq + dntps #EZ U #EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Molecular cloning: 6 RBS+ arac/ laci

Molecular cloning: 6 RBS+ arac/ laci Molecular cloning: 6 RBS+ arac/ laci Resource: 6 RBS: from the parts: B0030, B0032, B0034, J61100, J61107, J61127; renamed as RBS1 RBS2 RBS6; arac: C0080 laci: C0012 July 6 th Plasmid mini prep: 6 RBS;

More information

PCR OPTIMIZATION AND TROUBLESHOOTING

PCR OPTIMIZATION AND TROUBLESHOOTING PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab Week 5 Analysis of pgem recombinant clones using PCR Clonecheck to determine size of insert; select clones for

More information

Lecture 1 Sunday, 4 March :24 pm

Lecture 1 Sunday, 4 March :24 pm Lecture 1 Sunday, 4 March 2018 10:24 pm Amino acid side chains can be Hydrophobic, hydrophilic Positive, negatively charged Movement of information OH removed from 2' carbon to make the end more stable

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

Lab Book igem Stockholm Lysostaphin. Week 8

Lab Book igem Stockholm Lysostaphin. Week 8 Lysostaphin Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2017 Laboratory Safety: Lab coat, long pants, closed-toe shoes, safety goggles, and nitrile or latex gloves are required. Learning

More information

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within

More information

Amplification Products for PCR and RT-PCR

Amplification Products for PCR and RT-PCR Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format

More information

Methods in virus diagnosis PCR techniques

Methods in virus diagnosis PCR techniques Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Site-directed mutagenesis of proteins

Site-directed mutagenesis of proteins IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction

More information

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and

More information

EZ Vision DNA Dye as Loading Buffer

EZ Vision DNA Dye as Loading Buffer EZ Vision DNA Dye as Loading Buffer Code Description Size N472-1ML N472-KIT N650-1ML N650-KIT N313-1ML N313-KIT N473-2PK N473-3PK EZ Vision One DNA Dye as Loading Buffer, 6X EZ Vision Two, DNA Dye as Loading

More information

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+ Hy-Taq 500U + dntps #EZ1012 500U Concentration: 5U/μl Contents: Hy-Taq DNA Polymerase 100μl 10xPCR Buffer(Mg 2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C For research only

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2016 The Techniques of Molecular Biology: Forensic DNA Fingerprinting **Lab coat, eye goggles and gloves (nitrile or latex) are required for this lab. You will not be allowed to participate

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges.

Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. Dr. Angela Cicatelli acicatelli@unisa.it Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. 1st Workshop on "Risk prognosis of environmental

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

Development of Positive Control for Hepatitis B Virus

Development of Positive Control for Hepatitis B Virus Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

DNA Enzymes. Ligation enzymes Restriction enzymes Polymerizase enzyme Strand-displacing polymerases Helicase enzymes

DNA Enzymes. Ligation enzymes Restriction enzymes Polymerizase enzyme Strand-displacing polymerases Helicase enzymes DNA Enzymes Ligation enzymes Restriction enzymes Polymerizase enzyme Strand-displacing polymerases Helicase enzymes Typically these enzymes are Proteins discovered in cells. Obtainable from Scientific

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14)

AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14) AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14) - RECOMBINANT DNA TECHNOLOGY is the use of in vitro molecular techniques to isolate

More information

Conversion of plasmids into Gateway compatible cloning

Conversion of plasmids into Gateway compatible cloning Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from

More information

Fundamentals of Real Time PCR

Fundamentals of Real Time PCR Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

PCR KIT/REAGENTS/BUFFERS/PRIMERS

PCR KIT/REAGENTS/BUFFERS/PRIMERS PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Lab Book igem Stockholm Lysostaphin. Week 9

Lab Book igem Stockholm Lysostaphin. Week 9 Lysostaphin Week 9 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND

More information

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture... Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 Lab Exercise 7 Drosophila crosses, three weeks Vocabulary: phenotype, genotype, gene, allele, locus (loci), sex chromosomes, autosomes, homozygous,

More information

The Polymerase Chain Reaction

The Polymerase Chain Reaction The Polymerase Chain Reaction B3 Summer Science Camp at Olympic High School Dr. Jennifer Weller PCR 2 Topic: the Polymerase Chain Reaction (PCR) In 1988 Saiki, Mullis et al. proposed using a heat stable

More information

Experiment (5): Polymerase Chain Reaction (PCR)

Experiment (5): Polymerase Chain Reaction (PCR) BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency

More information

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for

More information

Biotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.

Biotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled

More information

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003 PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed

More information

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2 9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI

More information

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v201712da_2

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v201712da_2 Cat. # R100A For Research Use EpiScope MSP Kit Product Manual Table of Contents I. Description... 3 II. MSP Principle... 3 III. Components... 4 IV. Storage... 4 V. Materials Required but not Provided...

More information

Enzymatic assembly of DNA molecules up to several hundred kilobases

Enzymatic assembly of DNA molecules up to several hundred kilobases nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures

More information

Covalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.

Covalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence. Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested

More information

NxGen phi29 DNA Polymerase

NxGen phi29 DNA Polymerase NxGen phi29 DNA Polymerase Please read carefully and thoroughly before beginning FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll

More information

Plasmids. BIL 333 Lecture I. Plasmids. Useful Plasmids. Useful Plasmids. Useful Plasmids. ( Transfection ) v Small, circular, double-stranded DNA

Plasmids. BIL 333 Lecture I. Plasmids. Useful Plasmids. Useful Plasmids. Useful Plasmids. ( Transfection ) v Small, circular, double-stranded DNA BIL 333 Lecture I Plasmids v Small, circular, double-stranded DNA v Exogenous to genome! v Origin of Replication v Marker Gene v ( Reporter Gene ) Plasmids v Marker Gene Changes Phenotype Of Host v (Antibiotic

More information

Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4)

Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) TSSM 2017 Page 1 of 7 Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2017

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v1103da

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v1103da Cat. # R100A For Research Use EpiScope MSP Kit Product Manual Table of Contents I. Description... 3 II. Principle of MSP... 3 III. Kit Components... 4 IV. Materials Required but not Provided... 4 V. Storage...

More information

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl

More information

Instructions for Use Life Science Kits & Assays

Instructions for Use Life Science Kits & Assays Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number... I 2 Storage conditions... I 3 Description... II 3.1 Quality data... II 3.2 Unit definition... II 4 Delivered

More information

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to

More information

I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:

I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme: I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

RTS 100 E. coli LinTempGenSet, Histag

RTS 100 E. coli LinTempGenSet, Histag RTS 100 E. coli LinTempGenSet, Histag Manual For rapid production of linear expression templates using PCR RTS 100 E. coli LinTempGenSet, His-tag Manual, October, 2009 2009 5 PRIME, all rights reserved.

More information

DiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit

DiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit DiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit Description: Tuberculosis (TB) is caused by the acid-fast bacterium Mycobacterium tuberculosis. Although Mycobacterium tuberculosis most commonly

More information

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One

More information

Ah, Lou! There really are differences between us!

Ah, Lou! There really are differences between us! Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.

More information

Practical 4: PCR in Molecular Diagnosis

Practical 4: PCR in Molecular Diagnosis PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by

More information