Programming cell adhesion for on-chip sequential Boolean logic
|
|
- Dora Simmons
- 6 years ago
- Views:
Transcription
1 Supporting Information Programming cell adhesion for on-chip sequential Boolean logic functions Xiangmeng Qu,, Shaopeng Wang,, Zhilei Ge,, Jianbang Wang, Guangbao Yao, Jiang Li, Xiaolei Zuo, Jiye Shi, Shiping Song, Lihua Wang, Li Li,, Hao Pei*, and Chunhai Fan,*, 1 Shanghai Key Laboratory of Green Chemistry and Chemical Processes, School of Chemistry and Molecular Engineering, East China Normal University, 500 Dongchuan Road, Shanghai, , P. R. China 2 Division of Physical Biology & Bioimaging Center, Shanghai Synchrotron Radiation Facility, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai , P. R. China 3 Kellogg College, University of Oxford, Oxford, OX2 6PN, UK S1
2 Experimental Procedures Materials and methods DNA oligonucleotides were purchased from Takara (purified by HPLC). SMCC and (3-Aminopropyl)-triethoxysilane (APTES) were purchased from Sigma. Cyclic peptide RGDfK-NH 2 was purchased from Peptides International, Inc. Biotin-PEG-SVA (MW 5,000) and mpeg- SVA (MW 5,000) were purchased from Laysan Bio, Inc. PBS was prepared from NaCl 137 mm,kcl 2.7 mm,na 2 HPO 4 10 mm,kh 2 PO 4 2 mm (ph=7.4). All solutions were prepared with deionized water. Hela cells were cultured in MEM medium supplemented with 10% fetal bovine serum, penicillin/streptomycin (100 units/ml) and L-glutamine (2 mm) at 37 O C in humidified environment containing 5% CO 2. Preparation of pegylated coverslip Glass coverslip was modified with PEG as previously described with a little modification. Briefly, glass coverslip was first cleaned with piranha solution (5% NH 3 H 2 O and 14% H 2 O 2 ), and followed by aminosilanization with 5% APTES. Then N-hydroxysuccinimide (NHS) ester modified PEG (a mixture contain 95% mpeg-sva and 5% biotin-peg-sva) was coupled with amines on the coverslip in 10 mm NaHCO 3. After extensive washing with PBS, 200 µg/ml streptavidin was incubated on biotin coated coverslip for 30 min at room temperature. S2
3 RGD-DNA assemble on coverslip RGDfK-NH2 and thiol modified DNA (release-rgd)were coupled through SMCC (a hetero-bifunctional crosslinker). After hybridization with 5' biotin labeled complementary DNA strands (OR-biotin, AND-biotin, XOR-biotin) in PBS buffer at 37 O C 30 min, 3 µl 1 µm solution was added on streptavidin modified coverslip for assembly. Cell experiment For cell adhesion, coverslips were placed into a 24 well plate, and cells per well were seeded. After an hour, cell culture medium was changed to remove non-adhesive cells. Cells were allowed to spread for another hour, and images were captured by microscope. Different DNA trigger strands were then added at a concentration of 1 µm. After 20 min, cells were gently washed and bright-field and fluorescence images were recorded. For FACS analysis of released cell number, after the addition of corresponding DNA strands for 20 min, the suspension was collected together with the washing buffer after washing the coverslip twice. Cells were then collected by centrifugation and resuspended into 100 µl medium for FACS analysis. Ca 2+ imaging Cells were loaded with 5 µm Fluo-4 AM in the dark at 37 o C in PBS. After incubation for 0.5 h, cells were washed three times with PBS. Before recording, cells were kept S3
4 in the dark for 20 min to allow de-esterification of the dye. Ca 2+ imaging was conducted at 37 o C on an inverted fluorescence microscope (Nikon Eclipse Ti), and the fluorescence signals were quantitatively analyzed with the MaxIm DL software. Table S1. DNA sequences used in this paper are as following. R-RGD OR-biotin SH-TTTTTTTTTTTTTTTGGGAGTATTGCGGAGGAAGGTATATC TCTC Biotin-TTTTTTTTTTTTTTTGTCCTCCAGAGAGATATACCTTCCT CCGCAATACTCCCCAAAGTTG OR- IN1 OR- IN2 AND-biotin Cy3-GGGAGTATTGCGGAGGAAGGTATATCTCTCTGGAGGAC FITC-CAACTTTAGGGAGTATTGCGGAGGAAGGTATATCTCTC Biotin-TTTTTTTTTTTTTTTGTCCTCCAGAGAGATATACCTTCGT GTCTCCGCAATACTCCCCAAAGTTG AND-IN1 AND- IN2 XOR-biotin XOR- IN1 XOR- IN2 AND-OR-1 AND-OR-IN1 Cy3-ACGAAGGTATATCTCTCTGGAGGAC FITC-CAACTTTAGGGAGTATTGCGGAGAC Biotin-TTTTTTTTTTTTTTTCCTTCCTCCGCAATACTCCCGTCCTC CA Cy3-GAGATATACCTTCCTCCGCAATACTCCCGTCCTCCA FITC-TGGAGGACGGGAGTATTGCGGAGGAAGGTATATCTC ATCGATCG CATGAAGGCTCGACTCGCCG CGGCGAGTCGAGCCTTCATGCGATCGAT AND-OR-2 AND-OR-IN2 CCTTCCTCCGCAATACTCCCCGGCGAGTCGAGCCTTCATG CGACTCGCCGGGGAGTATTGCGGAGGAAGG S4
5 Figure S1. Induction of a transient Ca 2+ concentration increase by RGD-coated coverslip surfaces binding to HeLa cells. a) Fluorescence images of Hela-cells loaded with the Ca 2+ indicator Fluo-4 AM, with white circle designating the single cell that was monitored. b) Single-cell Ca 2+ response at indicated times after application of the RGD-coated coverslip surfaces. A key for the heatmap is on the bottom. c) Time course of Fluo-4 fluorescence changes revealing a biphasic, transient Ca 2+ concentration increase in a single cell. F 0 is referred to the fluorescence at initial state, representing the basal Ca 2+ concentration. S5
6 Figure S2. The kinetics of on-chip cell release was drastically accelerated as the toehold length was varied from 4-base to 6-base. Figure S3. An AND operation via toehold-mediated SDR for programmably regulating on-chip cell adhesion and detachment. Specifically, an AND logic gate uses strand a b (IN1) and strand c d (IN2) as inputs. Upon the addition of 1 µm Cy3-labeled IN1 (input=1/0) into the cell culture medium for 20 min followed by the intensive washing with PBS, the IN1 hybridized to the toehold on the 3 -end of the base strand and partially displaced only one duplex region (b ) via a three-way branch migration mechanism, leaving the RGD-coupled ssdna anchored to the base strand. Likewise, the addition of 1 µm FAM-labeled IN2 (input=0/1) bound to the d toehold on the 5 -end of the base strand and proceeded to invade backwards, as a result the RGD-coupled ssdna remained wired to the base strand. In these two operations (input=1/0 and 0/1), the cells remained adherent to coverslip surfaces with only few released into the solution (output=0), similar to the result in which neither input was applied (input=0/0). However, when both IN1 and IN2 were added to the system (input=1/1), the cooperative hybridization of two partially complementary strands (IN1 and IN2) with the base strand displaces the RGD-coupled ssdna by three-way branch migration and triggered the cell detachment (output=1). S6
7 Figure S4. The overall AND operation could be verified using polyacrylamide gel electrophoresis (PAGE) image. Lane 1: 20bp marker; Lane 2: C strand; Lane 3: D strand; Lane 4: input strand a b (IN1); Lane 5: input strand c d (IN2); Lane 6: double strands (DS) formed by R-RGD (b c ) and AND-biotin (abcd); Lane 7: DS and AND-IN1 mixture with equal molar ratio for 2 hours; Lane 8: DS and AND AND-IN1 mixture with equal molar ratio for 2 hours; Lane 9: mixture of DS, AND-IN1 and AND-IN2 with equal molar ratio for 2 hours. Figure S5. An OR operation via toehold-mediated SDR for programmably regulating on-chip cell adhesion and detachment. Specifically, an OR logic gate uses strand a b c (IN1) and strand b c d (IN2) as inputs. The addition of IN1 (or IN2) binds to base strand via invading a toehold on the 3 -end (or the d toehold on the 5 -end) and displaces the RGD-coupled ssdna by branch migration, thus triggering the cell detachment from coverslip surfaces (input=1/0 or 0/1; output=1). When both inputs were present (input=1/1), the output of our DNA-based OR gate was similar to a single equivalent even in the presence of excess inputs (output=1). S7
8 Figure S6. The overall OR operation could be verified using PAGE image. Lane 1: 20bp marker; Lane 2: R-RGD (b c ) strand; Lane 3: OR-biotin (abcd) strand; Lane 4: input strand OR-IN1; Lane 5: input strand OR-IN2; Lane 6: double strands (DS) formed by R-RGD (b c ) and OR-biotin (abcd); Lane 7: DS and OR-IN1 mixture with equal molar ratio for 2 hours; Lane 8: DS and OR-IN2 mixture with equal molar ratio for 2 hours; Lane 9: mixture of DS, OR-IN1 and OR-IN2 with equal molar ratio for 2 hours. Figure S7. An XOR operation via toehold-mediated SDR for programmably regulating on-chip cell adhesion and detachment. Specifically, an XOR logic gate uses strand a b c (IN1) and strand abc (IN2) as inputs. Here, the length of the base strand (strand ab) is shorter than that was used in AND and OR gate (strand abcd). The addition of IN1 bound to base strand via invading the a toehold on the 3 -end and displaced the RGD-coupled ssdna by branch migration, thus inducing the cell detachment from coverslip surfaces (input=1/0, output=1). Whereas, the addition of IN2 bound to the RGD-coupled ssdna via invading the c toehold on the 3 -end and then dissociated the RGD-coupled ssdna from coverslip surfaces, resulting in the cell detachment (input=0/1, output=1). S8
9 Figure S8. The overall XOR operation could be verified using PAGE image. Lane 1: 20bp marker; Lane 2: R-RGD (b c ) strand; Lane 3: XOR-biotin strand; Lane 4: input strand XOR-IN1; Lane 5: input strand XOR-IN2; Lane 6: double strands (DS) formed by R-RGD (b c ) and XOR-biotin (ab); Lane 7: DS and XOR-IN1 mixture with equal molar ratio for 2 hours; Lane 8: DS and XOR-IN2 mixture with equal molar ratio for 2 hours; Lane 9: mixture of DS, XOR-IN1 and XOR-IN2 with equal molar ratio for 2 hours; Lane 10: 20bp marker. Figure S9. An AND-OR operation via toehold-mediated SDR for programmably regulating on-chip cell adhesion and detachment. A two-layer logic circuit with the first layer composed of an AND logic gate using strand 1 2 (IN1) and strand 23 (IN2) as inputs, and the second layer composed of an OR logic gate using the output from the first layer and strand b c (IN3) as inputs. The addition of single-stranded inputs (IN1: strand 1 2, IN2: strand 23) to a solution containing the AND gate initiates a computation. The upstream AND gate was designed such that the addition of IN1 displaces only one duplex region (2), leaving the output strand a b sequestering; whereas the addition of IN2 could not invade the toehold region of strand 23 because strand 12 occupies the toehold and prevents input B from displacing the output strand a b. S9
10 Figure S10. The overall AND-OR operation could be verified using PAGE image. Lane 1: 20bp marker; Lane 2: R-RGD strand; Lane 3: OR-IN1 strand; Lane 4:OR-IN2 strand; Lane 5:double strands formed by AND-OR-1, AND-OR-2 and OR-IN1 (E); Lane 6: E mixed with equal molar ratio of AND-OR-1 for 2 hours; Lane 7: E mixed with equal molar ratio of AND-OR-IN1 and AND-OR-IN2 for 2 hours; Lane 8: double strands formed by R-RGD and OR-biotin (DS); Lane 9: mixture of DS and OR-IN2 with equal molar ratio for 2 hours; Lane 10: mixture of DS and E with equal molar ratio for 2 hours; Lane 11: mixture of DS and E+ AND-OR-IN1 with equal molar ratio for 2 hours; Lane 12: mixture of DS and E+ AND-OR-IN1 + AND-OR-IN2 with equal molar ratio for 2 hours; Lane 13: mixture of DS and E+ AND-OR-IN1 + AND-OR-IN2+ OR-IN2 with equal molar ratio for 2 hours. S10
3-Input Majority Logic Gate and Multiple Input Logic Circuit Based on DNA Strand Displacement
Supporting Information for 3-Input Majority Logic Gate and Multiple Input Logic Circuit Based on DNA Strand Displacement Wei Li, Yang Yang, Hao Yan, Yan Liu Department of Chemistry and Biochemistry and
More informationSupporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions
Supporting Information DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Wei Tang, Huaming Wang, Dingzhong Wang, Yan Zhao, Na Li, and Feng Liu* Beijing National
More informationDNA hydrogel with aptamer-toehold based recognition, cloaking. and decloaking of circulating tumor cells for live cell analysis
Supplementary Information(SI) DNA hydrogel with aptamer-toehold based recognition, cloaking and decloaking of circulating tumor cells for live cell analysis Ping Song 1,2,, Dekai Ye 2,, Xiaolei Zuo 1,2,
More informationSupplementary Information. Binding-responsive catalysis of Taq DNA polymerase for sensitive. and selective detection of cell-surface proteins
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Information Binding-responsive catalysis of Taq DNA polymerase for sensitive and
More informationSupplementary Table 1. Oligonucleotide sequences used in the study
Supplementary Table 1. Oligonucleotide sequences used in the study Oligonucleotides Sequences (5 3 ) Substrate strand Lock -4 Lock -5 Lock -6 Lock -7 Free control DNAzyme DNAzyme strand linked to AuNP
More informationA Cell-Surface-Anchored Ratiometric I-Motif Sensor for. Extracellular ph Detection
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 216 Electronic Supplementary Information (ESI) A Cell-Surface-Anchored Ratiometric I-Motif Sensor for
More informationSupplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates
Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization
More informationElectronic supplementary information (ESI) Kinetic Study of DNA Hybridization on DNA-modified Gold Nanoparticles. with Engineered Nano-Interfaces
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic supplementary information (ESI) Kinetic Study of DNA Hybridization on DNA-modified
More informationStudy Small Molecule-Membrane Protein Binding Kinetics with. Nanodisc and Charge Sensitive Optical Detection
Support Information Study Small Molecule-Membrane Protein Binding Kinetics with Nanodisc and Charge Sensitive Optical Detection Guangzhong Ma 1,2, Yan Guan 1,3, Shaopeng Wang 1*, Han Xu 4*, Nongjian Tao
More informationSupplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationSupplementary Information Temperature-responsive Gene Silencing by a Smart Polymer
Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Mingming Wang, Yiyun Cheng * Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East China Normal
More informationSensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay
Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay Shuyan Cheng a, Feng Shi a, Xuecheng Jiang a, Luming Wang a, Weiqing Chen b, Chenggang Zhu a * a College of
More informationProgrammable and Multiparameter DNA-based Logic Platform For Cancer Recognition and Targeted Therapy
Programmable and Multiparameter DNA-based Logic Platform For Cancer Recognition and Targeted Therapy Mingxu You,, Guizhi Zhu,, Tao Chen,, Michael J. Donovan and Weihong Tan, * Department of Chemistry and
More informationcatalytic hairpin DNA assembly for dual-signal amplification toward homogenous analysis of protein and
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Programmable Mg 2+ -dependent DNAzyme switch by the catalytic hairpin DNA
More informationSupplementary Information. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling. System
Supplementary Information High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System Lanhui Li 1,2, Mingliang Jin 1,2, Chenglong Sun 3, Xiaoxue Wang 3, Shuting Xie 1,2, Guofu Zhou 1,2, Albert
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Multiplexed Detection of Lung Cancer Cells at the Single-Molecule
More informationSupplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible.
Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Because SYBR Gold is less sensitive to single stranded
More informationA self-assembled DNA nanostructure-amplified quartz crystal microbalance with dissipation biosensing platform for nucleic acids
Electronic Supplementary Information A self-assembled DNA nanostructure-amplified quartz crystal microbalance with dissipation biosensing platform for nucleic acids Wei Tang, Dingzhong Wang, Yi Xu, Na
More informationPage 1 of 5. Product Name Label Quantity Product No. Cy 3 10 µg (~0.75 nmol) MIR Cy µg (~7.5 nmol) MIR 7901
Page 1 of 5 Label IT RNAi Delivery Control Product Name Label Quantity Product No. Cy 3 10 µg (~0.75 nmol) MIR 7900 Label IT RNAi Delivery Control Cy 3 100 µg (~7.5 nmol) MIR 7901 Fluorescein 10 µg (~0.75
More informationSupporting Information. Programming Enzyme-Initiated Autonomous DNAzyme
Supporting Information Programming Enzyme-Initiated Autonomous DNAzyme Nanodevices in Living Cells Feng Chen, a Min Bai, a Ke Cao, a Yue Zhao, a Xiaowen Cao, a Jing Wei, a Na Wu, a Jiang Li, b Lihua Wang,
More informationOligonucleotide Loading Determines Cellular Uptake of DNA- Modified Gold Nanoparticles
Supporting Information for: Oligonucleotide Loading Determines Cellular Uptake of DNA- Modified Gold Nanoparticles David A. Giljohann, Dwight S. Seferos, Pinal C. Patel, Jill E. Millstone, Nathaniel L.
More informationSUPPLEMENTARY MATERIALS. Materials and Methods. TGT synthesis. Hydrogel preparation and characterization.
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2016 SUPPLEMENTARY MATERIALS Materials and Methods TGT synthesis. TGTs were used with rupture
More informationDYNAMICBIOSENSORS. Chip functionalization DNA-encoded addressing and chip configuration. Technology Information #120
Technology Information #120 Chip functionalization DNA-encoded addressing and chip configuration The switchsense biochip features 24 detection spots, which are arranged in 2 or 4 seperate flow channels.
More informationElectronic Supporting Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supporting Information Highly Sensitive and Multiplexed Quantification of mrna
More informationEnzyme-mediated preparation of hydrogels composed of poly(ethylene glycol) and gelatin as cell culture platforms
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supplementary Material (ESI) for RSC Advances Enzyme-mediated preparation of hydrogels composed
More informationSupporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez
Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG
More informationGuiding Protein Delivery into Live Cells using DNA-Programmed Membrane Fusion
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information Guiding Protein Delivery into Live Cells using DNA-Programmed Membrane
More informationElectronic Supplementary Information for. High-throughput imaging assay of multiple proteins via targetinduced
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information for High-throughput imaging assay of multiple proteins
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationElectric Supplement Information
Electric Supplement Information Preparation of DNA-AuNPs Thiol-modified oligonucleotide (5 -Cy5- ATCTCGGCTCTGCTAGCGAAAAAAAAAA-(C3H6)-SH-3, 5 15.5 OD) was added to 13 nm citrate-stabilized AuNPs (~3 nmol
More informationSupporting Information
Supporting Information One-step, Multiplexed Fluorescence Detection of micrornas Based on Duplex-Specific Nuclease Signal Amplification Bin-Cheng Yin, Yu-Qiang Liu, and Bang-Ce Ye* Lab of Biosystems and
More informationA Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
More informationA protein-polymer hybrid gene carrier based on thermophilic histone. and polyethylenimine
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2015 A protein-polymer hybrid gene
More informationStreptavidin Particles Technical Information
Streptavidin Particles Technical Information Streptavidin Streptavidin is a protein (MW of approx. 66,000) made up of four identical subunits, each containing a high affinity binding site for biotin (KD
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic
More informationSupporting Information for
Supporting Information for Building Electromagnetic Hot Spots in Living Cells via Target-Triggered Nanoparticle Dimerization Wen Zhou, 1,2 Qiang Li, 1 Huiqiao Liu, 1 Jie Yang, 1 Dingbin Liu 1,2 * 1. College
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) Ultra-pH-responsive split i-motif based aptamer anchoring
More informationTable S1. Sequences of the DNA used in this study. Sequence (5' 3')
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information Portable and Quantitative Monitoring of Mercury Ions Using DNA-capped
More informationElectronic Supplementary Information. Target-induced Intermolecular Hybridization
Electronic Supplementary Information The Real-time PCR for Sensitive Protein Detection by Target-induced Intermolecular Hybridization Cuiping Ma a, Lijie Cao a, Chao Shi a *and Naihao Ye b * a State Key
More informationLab Module 7: Cell Adhesion
Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix
More informationThe Development of an Indirect Competitive. Immunomagnetic-Proximity Ligation Assay for Small-Molecule. Detection
The Development of an Indirect Competitive Immunomagnetic-Proximity Ligation Assay for Small-Molecule Detection Xuecheng Jiang, a Zhenhong Zhu, ab Zhihao Sun, a Luming Wang, a Lixiao Zhou, a Hanqiang Miao,
More informationSUPPLEMENTARY INFORMATION
A biomimetic DNA-based channel for the ligand-controlled transport of charged molecular cargo across a biological membrane Jonathan R. Burns, Astrid Seifert, Niels Fertig, Stefan Howorka NATURE NANOTECHNOLOGY
More informationElectronic Supporting information (ESI)
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supporting information (ESI) Hairpin DNA Probes Based on Target-induced in situ Generation
More informationA novel label-free cascade amplification strategy based dumbbell. probe-mediated rolling circle amplification-responsive
A novel label-free cascade amplification strategy based dumbbell probe-mediated rolling circle amplification-responsive G-quadruplex formation for highly sensitive and selective detection of NAD + or ATP
More informationSupplementary Information for. Fast Analysis of Intracellular Glucose at Single Cells using Electrochemiluminescence Imaging
Supplementary Information for Fast Analysis of Intracellular Glucose at Single Cells using Electrochemiluminescence Imaging Jingjing Xu, Peiyuan Huang, Yu Qin, Dechen Jiang*, Hong-yuan Chen State Key Laboratory
More informationIndividual Au-nanocube based Plasmonic nanoprobe for cancer relevant microrna biomarker detection
Supporting Information Individual Au-nanocube based Plasmonic nanoprobe for cancer relevant microrna biomarker detection Lei Zhang, Jinghui Wang, Junxia Zhang, Yuqi Liu, Lingzhi Wu,,* Jingjing Shen, Ying
More informationNanoparticle-Based Bio-Bar Codes for the Ultrasensitive Detection of Proteins. Jwa-Min Nam, C. Shad Thaxton, and Chad A. Mirkin
1 Nanoparticle-Based Bio-Bar Codes for the Ultrasensitive Detection of Proteins Jwa-Min Nam, C. Shad Thaxton, and Chad A. Mirkin Department of Chemistry and Institute for Nanotechnology, Northwestern University,
More informationNonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2.
Supplementary Figure 1 Nonspecific binding of 10 nm Cy5-labeled DinB on nine different surfaces, measured by the number of DinB spots over an imaging area of 2,500 µm 2. Free DinB was washed out using
More informationSupporting Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Supporting Information Rolling Circle Amplification, Enzyme-catalyzed Polymerization,
More informationElectronic Supplementary Information
Electronic Supplementary Information Fluorescence Turn-On Detection of a Protein through the Displaced Single-Stranded DNA Binding Protein Binding to a Molecular Beacon Dan Tang, abc Dongli Liao, ab Qiankun
More informationGlycoprotein Assay Kit. Green Fluorescence)
Version 1 Last updated 15 June 2018 ab235629 O-GalNAc Modified Glycoprotein Assay Kit (FACS/Microscopy, Green Fluorescence) For the measurement of O-GalNAc-glycosylated proteins in suspension or adherent
More informationFluorescent In Situ Hybridization (FISH) Assay
Fluorescent In Situ Hybridization (FISH) Assay 1 What is FISH 2 Probes 3 FISH Procedure 4 Application Definition, Principle and Sample Types The core of FISH technology A quick and simple FISH protocol
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/317/5837/513/dc1 Supporting Online Material for Spring-Loaded Mechanism of DNA Unwinding by Hepatitis C Virus NS3 Helicase Sua Myong,* Michael M. Bruno, Anna M. Pyle,
More informationPropidium Iodide Solution
G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Propidium Iodide Solution (1mg/ml in deionized water) (Cat. # 786 1272, 786 1273) think proteins!
More informationSupplemental material
Supplemental material Self-assembly of Small Gold Colloids on Functionalized Gold Nanorods Sebastien Pierrat, Inga Zins, Aaron Breivogel, Carsten Sönnichsen* Institute for Physical Chemistry, University
More informationSupporting Information for. Localized DNA Hybridization Chain Reactions. on DNA Origami
Supporting Information for Localized DNA Hybridization Chain Reactions on DNA Origami Hieu Bui 1,3*, Shalin Shah 2*, Reem Mokhtar 1, Tianqi Song 1, Sudhanshu Garg 1, John Reif 1,2 1 Department of Computer
More informationSupporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 215 Supporting Information Quantitative Description of Thermodynamic and Kinetic Properties of the
More informationSupporting Information. A Real-Time Surface Enhanced Raman Spectroscopy Study of Plasmonic Photothermal Cell Death Using Targeted Gold Nanoparticles
Supporting Information A Real-Time Surface Enhanced Raman Spectroscopy Study of Plasmonic Photothermal Cell Death Using Targeted Gold Nanoparticles Mena Aioub and Mostafa A. El-Sayed* Laser Dynamics Laboratory,
More informationElectronic Supplementary Information. Evolved polymerases facilitate selection of fully 2 - OMe- modified aptamers
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Evolved polymerases facilitate selection of fully
More informationLive and Dead Cell Assay
ab115347 Live and Dead Cell Assay Instructions for Use Differential fluorescent labeling of live and dead cells This product is for research use only and is not intended for diagnostic use. Last Updated
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Multifunctional PEI-entrapped gold nanoparticles
More informationSCIENTIFIC REPORT. regarding the implementation of the project between December December 2014
SCIENTIFIC REPORT regarding the implementation of the project between December 013 - December 014 Title of the project: DETECTION AND IDENTIFICATION OF BIOMOLECULES OF MEDICAL INTEREST BY USING MAGNETIC
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Direct Detection of Circulating MicroRNA in Cancer Patient
More informationSupplementary Information
Supplementary Information Nonlinear optical dye TSQ1 as an efficiently selective fluorescent probe for G-quadruplex DNA Yuqi Chen a, Shengyong Yan a, Libo Yuan a, Weng* a and Xiang Zhou* a b Yimin Zhou
More informationMERmaid Kit preps preps Filters/Catch Tubes Filters/Catch Tubes Filters/Catch Tubes
BIO 101 Protocol MERmaid Kit w eb With Optional SPIN Procedure Protocol Included Catalog Number Prep Size 1005-000 10 preps 1005-200 200 preps Optional 2080-400 40 Filters/Catch Tubes 2080-600 60 Filters/Catch
More informationAnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit
AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit Revision number: 1.3 Last updated: May 2018 Catalog # AS-72050 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647
More informationSupporting Information
Supporting Information Wiley-VCH 2014 69451 Weinheim, Germany Complex Reconfiguration of DNA Nanostructures** Bryan Wei,* Luvena L. Ong, Jeffrey Chen, Alexander S. Jaffe, and Peng Yin* ange_201402437_sm_miscellaneous_information.pdf
More informationApoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
More informationEffective construction of AuNPs-DNA system for the. implementation of various advanced logic gates
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Effective construction of AuNPs-DNA system for the implementation of various advanced logic
More informationElectronic Supplementary Information
Electronic Supplementary Information FRET-based probing to gain direct information on sirna sustainability in live cells: Asymmetric degradation of sirna strands Seonmi Shin, a Hyun-Mi Kwon, b Kyung-Sik
More informationphab Amine and Thiol Reactive Dyes
TECHNICAL MANUAL phab Amine and Thiol Reactive Dyes Instructions for Use of Products G9831, G9835, G9841 and G9845 4/15 TM451 phab Amine and Thiol Reactive Dyes All technical literature is available at:
More informationAnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit
AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit Revision number: 1.3 Last updated: April 2018 Catalog # AS-72048 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor
More informationAnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit
AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit Catalog # 72044 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 750 SE to proteins (e.g., IgG). It provides ample
More informationSupporting Information
Supporting Information DNA Crystals as Vehicles for Biocatalysis. Chun Geng and Paul J. Paukstelis* *Email: paukstel@umd.edu Recombinant MBP-tagged RNase inhibitor expression and purification. The porcine
More informationKey Laboratory for Material Chemistry of Energy Conversion and Storage, Ministry of Education,
Supporting Information Portable, Self-Powered and Light-Addressable Photoelectrochemical Sensing Platforms using ph Meter Readouts for High-Throughput Screening of Thrombin Inhibitor Drugs Juan Wang, a
More informationElecrtonic Supplementary Information. Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays
Elecrtonic Supplementary Information Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays Sakandar Rauf, Andrew Glidle and Jonathan M Cooper Department
More informationSUPPLEMENTARY INFORMATION
Electronic Supplementary Material (ESI) for ChemComm. Chemical Communications. This journal is The Royal Society of Chemistry 2014 SUPPLEMENTARY INFORMATION Single primer-triggered isothermal amplification
More informationCell Surface-Anchored Fluorescent Aptamer Sensor Enables. Imaging of Chemical Transmitter Dynamics
Supporting Information for Cell Surface-Anchored Fluorescent Aptamer Sensor Enables Imaging of Chemical Transmitter Dynamics Takeshi Tokunaga, Shigeyuki Namiki, Katsuhiro Yamada, Takahiro Imaishi, Hiroshi
More informationGraphene oxide-enhanced cytoskeleton imaging and mitosis tracking
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supplementary information for Graphene oxide-enhanced cytoskeleton imaging and mitosis tracking
More informationCTAB-coated gold nanorods elicit allergic response through degranulation and cell death in human basophils
CTAB-coated gold nanorods elicit allergic response through degranulation and cell death in human basophils Ka Lun Cheung, a Huanjun Chen, b Qiulan Chen, c Jianfang Wang, b Ho Pui Ho, c Chun Kwok Wong,
More informationKinetically Grafting G-quadruplex onto DNA Nanostructure as Structure and. Function Encoding via DNA Machine
Supporting information Kinetically Grafting G-quadruplex onto DNA Nanostructure as Structure and Function Encoding via DNA Machine Jiangtao Ren a, b, Jiahai Wang *a, Lei Han a, b, Erkang Wang *a and Jin
More informationETS-Embryo Medium. In Vitro Culture Media. Version 1.0
ETS-Embryo Medium In Vitro Culture Media Version 1.0 3D Culture Media Product Catalogue No Storage ETS-Embryo Medium, 25 ml (5 x 5 ml) M13-25 -20 C ETS-Embryo Medium, 100 ml M13-100 -20 C Additional Reagents
More informationAnaTag HiLyte Fluor 647 Protein Labeling Kit
AnaTag HiLyte Fluor 647 Protein Labeling Kit Catalog # 72049 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647 SE to proteins (e.g., IgG). It provides ample materials
More informationAnaTag 5-FAM Protein Labeling Kit
AnaTag 5-FAM Protein Labeling Kit Catalog # 72053 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate 5-FAM SE (5-carboxyfluorescein) to proteins (e.g., IgG). It provides ample materials
More informationZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063
INSTRUCTION MANUAL ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 Highlights Quick, high-throughput (96-well) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes,
More informationMultiplex Detection of Cardiac Biomarkers
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2017 Multiplex Detection of Cardiac Biomarkers Mukesh Digambar Sonawane, Satish Balasaheb
More informationab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
More informationab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
More informationSupporting Information. Molecular Threading-Dependent Mass Transport in Paper Origami for
Supporting Information Molecular Threading-Dependent Mass Transport in Paper Origami for Single-Step Electrochemical DNA Sensors Dekai Ye,, Li Li, Zhenhua Li, Yueyue Zhang, Min Li, Jiye Shi, Lihua Wang,,#
More informationIdentification and characterization of DNA aptamers specific for
SUPPLEMENTARY INFORMATION Identification and characterization of DNA aptamers specific for phosphorylation epitopes of tau protein I-Ting Teng 1,, Xiaowei Li 1,, Hamad Ahmad Yadikar #, Zhihui Yang #, Long
More informationVisualizing mechanical tension across membrane receptors with a fluorescent sensor
Nature Methods Visualizing mechanical tension across membrane receptors with a fluorescent sensor Daniel R. Stabley, Carol Jurchenko, Stephen S. Marshall, Khalid S. Salaita Supplementary Figure 1 Fabrication
More informationLumazine synthase protein cage nanoparticles as modular delivery platforms for targeted drug delivery
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information for Lumazine synthase protein cage nanoparticles as modular delivery
More informationCat. # MK600. For Research Use. ApopLadder Ex. Product Manual. v201608da
Cat. # MK600 For Research Use ApopLadder Ex Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Features... 3 IV. Components... 3 V. Storage... 3 VI. Materials Required but not
More informationEdU Cell Proliferation Kit. User Manual
EdU Cell Proliferation Kit User Manual Ordering information: (for detailed kit content see Table 2) EdU Click Kits: Product number EdU Used fluorescent dye BCK-EdU488 BCK-EdU555 BCK-EdU594 BCK-EdU647 5
More informationphab Amine and Thiol Reactive Dyes
TECHNICAL MANUAL phab Amine and Thiol Reactive Dyes Instructions for Use of Products G9831, G9835, G9841 and G9845 Revised 12/17 TM451 phab Amine and Thiol Reactive Dyes All technical literature is available
More informationSupporting Information
Supporting Information Wiley-VCH 2009 69451 Weinheim, Germany Reversible Cell-Specific Delivery of Chemotherapy Drugs Using Aptamer- Functionalized Liposomes Zehui Cao, 1 Rong Tong, 2 Abhijit Mishra, 2
More informationab CFSE Fluorescent Cell Labeling Kit
ab113853 CFSE Fluorescent Cell Labeling Kit Instructions for Use For the durable fluorescent labeling of live cells for fluorescent microscopy and flow cytometry, population growth studies and within sample
More information