XactEdit Cas9 Nuclease with NLS User Manual

Size: px
Start display at page:

Download "XactEdit Cas9 Nuclease with NLS User Manual"

Transcription

1 XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE K, CE , CE , CE , CE Table of Contents Product Information and Storage Conditions 1 Overview 2 Product Description 2 Product Specifications 2 Additional Required Materials 3 Protocols 4 Using XactEdit Cas9 Nuclease with NLS for In Vitro DNA digestion 4 Using XactEdit Cas9 Nuclease with NLS for In Vivo DNA digestion 6 Appendix A: Representative Data 7 XactEdit Cas9 Nuclease In Vitro Activity Assay 7 XactEdit Cas9 Nuclease In Vivo Activity Assay 7 Appendix B: Negative Control guide RNA Template 8 Product Information and Storage Conditions XactEdit Cas9 Nuclease with NLS Kit Catalog Number CE K Quantity Component Amount Concentration Storage 1 vial XactEdit Cas9 Nuclease with NLS* 50 µg 1 mg/ml Negative Control grna Template 10 µl** 25 µm 10X XactEdit Digestion Buffer 0.5 ml Nuclease-free water 0.5 ml *Avoid repeated freeze/thaw cycles. Aliquot if necessary. See Appendix B: Negative Control guide RNA Template on page 8 for sequence information. ** Shipped lyophilized. See Prepare In Vitro Transcription Template on page 4 for resuspension instructions. XactEdit Cas9 Nuclease with NLS Recombinant Protein 20 C Catalog Number Quantity Component Amount Concentration Storage CE CE vial 5 vials (50 µg each) XactEdit Cas9 Nuclease with NLS 50 µg 250 µg CE vial 250 µg CE vial 1000 µg 1 mg/ml 20 C 10 mg/ml Avoid repeated freeze/thaw cycles. Aliquot if necessary. Synthetic Genomics, Inc. syntheticgenomics.com REV PN CE1000-M

2 Overview Product Description Product Specifications XactEdit Cas9 Nuclease with NLS is a purified recombinant Streptococcus pyogenes Cas9 protein containing a nuclear localization signal (NLS) for targeting into the nucleus. XactEdit Cas9 Nuclease with NLS has been formulated to perform highly efficient RNA-guided DNA digestion in vitro. This recombinant Cas9 protein complexes with guide RNA to form an RNA-protein complex (RNP). Introducing RNPs into cells creates double-stranded DNA breaks (DSBs) which have been used for a variety of precise genome-editing studies, such as homologous knock-in and gene knock-out. RNP delivery is non-replicative in the cell and therefore has minimal off-target effects, an advantage over other delivery methods. XactEdit Cas9 Nuclease with NLS is suitable for use with immortalized cell lines and primary cells. XactEdit Cas9 Nuclease with NLS Presentation Concentration Purity Endotoxin level RNase activity DNase activity In vitro activity Recombinant Streptococcus pyogenes Cas9 nuclease with N terminal modification of 8X His tag and SV40 NLS 25 mm Tris-HCl, ph 7.4, 300 mm NaCl, 0.1 mm EDTA, 1 mm DTT, 50% glycerol 1 mg/ml for Catalog Number series CE mg/ml for Catalog Number series CE1001 Values based on absorbance at 280 nm with extinction coefficient at 0.76 (mg/ml) -1 cm -1 > 90%, RP-HPLC > 90%, SDS-PAGE < 10 EU/mg, by LAL assay < LOD by fluorescence-based RNase assay (detection limit < U of RNase) < 0.01 unit DNase I per 100 µg of Cas9, by fluorescence-based DNase Assay > 80% of target DNA at 5.4 nm is digested with 50 µg of Cas9 with equal molar ratio of guide RNA at 37 C for 1 hour. 2

3 Additional Required Materials For In Vitro DNA Digestion The following materials are not included with the XactEdit Cas9 Nuclease with NLS Kit, but are required for in vitro DNA digestion. User Supplied Materials Item Linearized DNA template containing T7 promoter and target grna coding sequence grna synthesis kit RNA clean-up kit Materials for RNA quantitation Recommended Kit and Supplier User defined MEGAScript T7 Transcription Kit (Thermo Fisher Cat No. AM1334) or equivalent kit or components RNA Clean & Concentrator -25 (Zymo Cat No. R1017) or equivalent Qubit RNA BR Assay Kit (Thermo Fisher Cat. No. Q10210) or equivalent 2% agarose or 10% TBE-urea gels Any reliable supplier of high-quality RNAse-free pipet tips materials for molecular biology applications High-fidelity DNA polymerase Phusion polymerase (Thermo Fisher Cat No. F530) or equivalent For In Vivo DNA Targeting and Cleavage The following materials are not included with the XactEdit Cas9 Nuclease with NLS Kit, but are required for in vivo DNA targeting and cleavage. User Supplied Materials Item Cell type of interest Electroporation apparatus Recommended Item User defined Neon Transfection System or equivalent Transfection reagent Neon Transfection Kit, 10 µl or 100 µl grna Custom designed to target DNA sequence-of-interest 3

4 Protocols Using XactEdit Cas9 Nuclease with NLS for In Vitro DNA digestion Materials DNA template ( ng) XactEdit Cas9 Nuclease with NLS Target-specific guide RNA 10X XactEdit Digestion Buffer Nuclease-free water (Optional) Negative Control grna template Design and Generate a Template for grna Production 1. Define a target site by screening your targeted DNA for an nt protospacer sequence followed by a protospacer adjacent motif (PAM), 5 -NGG-3. The intended cleavage site will be 3 4 nucleotides upstream of NGG. Note: The nt target protospacer sequence in the genomic DNA must be followed by a PAM sequence of NGG. This motif is essential for DNA cleavage, but is not included in the grna sequence. The immediate 12 nt located 5 of the PAM is the seed sequence and is necessary for efficient cleavage. A perfect match between your seed sequence and non-target loci should be avoided when designing grnas as mismatches close to the PAM site tend to abolish DNA cleavage. 2. Synthesize complementary oligonucleotides that contain a T7 promoter sequence, the targetspecific spacer sequence, and a guide RNA scaffold. These oligonucleotides will be annealed (see the protocol in the following section) to form a double-stranded oligonucleotide that will serve as a template for in vitro transcription for generating your grna. A double-stranded template example is shown below: T7 Promoter Spacer Sequence Scaffold 5 -TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3 3 -ATTATGCTGAGTGATATCCNNNNNNNNNNNNNNNNNNCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAAAAA-5 NN = Potential Cleavage Site Prepare In Vitro Transcription Template The ds oligonucleotide described above will be the template for grna production with in vitro transcription. Use the following procedure to denature and anneal your complementary oligonucleotides. 1. Bring each oligonucleotide to a concentration of 50 µm using 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl. 2. Combine the oligonucleotides in a 1:1 molar ratio. 3. For the Negative Control grna Template (provided with XactEdit Cas9 Nuclease Kit only), resuspend the contents of the tube with 10 µl of 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl. (Using a negative control is optional but highly recommended.) 4. Transfer 10 ul of the combined oligonucleotides to a PCR tube. 5. Denature oligonucleotides (including Negative Control grna Template, if applicable) at 95 C for 5 minutes. Slowly cool ( 0.1 C /second) to 25 C. 6. Add 240 µl nuclease-free water to the annealed oligonucleotides create a 2 μm stock grna template. The annealed ds oligonucleotide template is now ready for in vitro transcription. We recommend storing aliquots of the ds oligonucleotide template at 20 C for 6 months. 4

5 In Vitro Transcription to produce grna Although individual components may be used for in vitro transcription, we recommend using an in vitro transcription kit (e.g. MEGAScript T7 Transcription Kit, Thermo Fisher Cat No. AM1334) to simplify the reaction and reduce the potential for RNase contamination. 1. Combine the following components on ice: Component Volume 10X T7 Reaction Buffer 1 µl NTP Mixture (75 mm each) (1 µl ATP, 1 µl CTP, 1 µl GTP, 1 µl UTP) 4 µl 2 µm grna template from Prepare In Vitro Transcription Template 4 µl T7 RNA Polymerase 1 µl Total* 10 µl *The total reaction volume may be scaled up to 20 µl for increased yield. 2. Gently mix and incubate the reaction at 37 C for 2 hours. 3. Recover the grna using a silica spin column procedure (e.g. the RNA Clean & Concentrator, Zymo Cat. No. R1017). 4. Quantify grna by absorbance or fluorescent quantification. 5. Aliquot grna and store at 80 C. Note: To prevent RNA damage or the introduction of nuclease to the sample due to handing, avoid multiple freeze/thaw cycles. Prepare an In Vitro Digestion Template In Vitro Digestion Design a template to screen for the specificity and effectiveness of your grna. The template should contain the target site for grna and can be a plasmid, PCR-amplified amplicon, restriction-digest fragment, or synthetic DNA. The template will be used for in vitro digestion followed by agarose gel analysis. This target should be of a sufficient length and have the grna target site in a location that will allow you to easily visualize cleavage of the fragment on an agarose gel. 1. Combine the following components: Component Amount 10X XactEdit Digestion Buffer 3 µl grna, from step 5 of In Vitro Transcription to produce grna XactEdit Cas9 Nuclease with NLS DNA template in TE or PCR buffer, from Prepare an In Vitro Digestion Template ng 2. Bring the total volume of the reaction to 30 µl with nuclease-free water and mix by gently pipetting up and down. 3. Incubate reactions at 37 C for 1 hour. 4. Transfer reactions to 80 C for 2 minutes. 5. Evaluate the digestion by running µl of the reaction on a 2% agarose gel. 500 ng 100 ng 5

6 Using XactEdit Cas9 Nuclease with NLS for In Vivo DNA digestion Deliver Cas9 to cells Electroporation is the most effective means of delivering XactEdit Cas9 Nuclease with NLS to cells. Although lipid-based transfection methods can be used, we highly recommend electroporation for best results. Use the following guidelines as a starting point for optimizing in vivo digestion. For high efficiency delivery, optimize conditions (e.g., voltage and pulse duration) based on your selected cell type and electroporation apparatus. 1. Combine XactEdit Cas9 Nuclease and grna. We recommend using a molar ratio between 1:1 and 1:2 (Cas9:gRNA) as a starting point. Note: You will need to empirically determine the optimal amount of XactEdit Cas9 and grna for a given cell type and your particular experimental design. Beginning optimization with 1 µg of XactEdit Cas9 and 200 ng of grna is a typical starting point. To minimize the total volume delivered, use XactEdit Cas9 Nuclease at a concentration of 10 mg/ml (Catalog Numbers CE and CE ). 2. Mix the RNP complex by gentle pipetting and incubate at room temperature for minutes. Note: The RNP complex is stable at room temperature for up to 2 hours. 3. Mix the RNP complex with your cell suspension of choice. 4. Perform electroporation according to the recommendations and parameters for your cell line and electroporator. 5. Plate cells under appropriate growth conditions and allow hours of recovery. 6. To evaluate off-target activity, use a T7 endonuclease I (T7E1) assay or sequence analysis (optional). 6

7 Appendix A: Representative Data XactEdit Cas9 Nuclease In Vitro Activity Assay MW XactEdit Cas9 / grna bp Emx1 amplicon 487 bp cleaved fragment 283 bp cleaved fragment grna (ng) XactEdit Cas9 (ng) Figure 1. XactEdit Cas9 Nuclease (NLS) In Vitro Activity Assay. The gel image above shows RNA-guided Cas9 endonuclease activity targeting a 770 bp homeobox transcription factor Emx1 amplicon. Specific cleavage by the XactEdit Cas9: grna complex generates two fragments (283 bp and 487 bp). In each lane, 100 ng of Emx1 amplicon was incubated with indicated amount of guide RNA (grna) and XactEdit Cas9 protein. The data indicate that XactEdit Cas9 protein effectively and specifically cleaves the substrate at the target site. The molecular weight (MW) marker shown in lane 1 is 1 kb ladder. XactEdit Cas9 Nuclease In Vivo Activity Assay A B 770 bp Emx1 amplicon 487 bp cleaved fragment 283 bp cleaved fragment MW XactEdit Cas9 Neg Cas9 Supplier Neg MW % Cleavage SGI-DNA Lot 1 SGI-DNA Lot 2 Supplier T Supplier N Figure 2. XactEdit Cas9 Nuclease (NLS) In Vivo Activity Assay. The in vivo nuclease activity of two different lots of XactEdit Cas9 nuclease were compared to that of Cas9 nuclease from supplier T and N. For each assay, Emx1 gene Cas9:gRNA complexes were formed using 1 µg of Cas9 and 200 ng of in vitro transcribed guide RNA. Complexes were introduced into HEK 293T cells by electroporation. Cas9 double strand break (DSB) frequency was examined by a mutation detection assay (A) and MiSeq analysis (B). (A) Mutated sequences created by DSB are shown as cleaved products in agarose gel electrophoresis indicating Cas9 induced DSB sites. Lanes 1 and 8 are molecular weight (MW) marker Quick-Load 2-Log DNA ladder. (B) MiSeq sequencing at the target site provides a quantitative analysis on the percentage of cleavage. Data are presented as the mean with standard deviation of three replicates. 7

8 Appendix B: Negative Control guide RNA Template Sequences Oligonucleotide 1: 5 -TAATACGACTCACTATAGGTAGCGAACGTGTCCGGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3 Oligonucleotide 2: 5 -AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACACGCCGGACACGTTCGCTACCTATAGTGAGTCGTATTA-3 Presentation Concentration Lyophilized 25 µm per oligonucleotide upon reconstitution with 10 µl of 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl, ph 8. Technical Services Trademark Information Label License Research Use Only Intended Use For technical assistance, please contact technical services at XactEdit is a trademark and Synthetic Genomics is a registered trademarks of Synthetic Genomics Inc. MEGAscript, Qubit, and Neon are registered trademarks of Thermo Fisher Scientific. RNA Clean & Concentrator is a trademark of Zymo Research Corporation. Quick-Load is a registered trademark of New England Biolabs, Inc. MiSeq is a trademark of Illumina, Inc. Except as otherwise agreed in writing by our authorized representative, this product is for INTERNAL RESEARCH USE ONLY AND NOT FOR HUMAN, ANIMAL, THERAPEUTIC OR DIAGNOSTIC USE. For additional information about your rights under this research license, please see our website at sgidna.com. Research use only. Not for diagnostic and/or human use. Product information and additional resources are available at sgidna.com 2016 Synthetic Genomics Inc. All rights reserved. Synthetic Genomics, Inc.

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

CRISPR Ribonucleoprotein (RNP) User Manual

CRISPR Ribonucleoprotein (RNP) User Manual CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised

More information

DuraScribe T7 Transcription Kit

DuraScribe T7 Transcription Kit DuraScribe T7 Transcription Kit Cat. Nos. DS010910 and DS010925 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA170E DuraScribe T7 Transcription Kit 7/2017 1 1. Introduction The

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,

More information

DuraScribe T7 Transcription Kit

DuraScribe T7 Transcription Kit DuraScribe T7 Transcription Kit 10 Reactions Cat. No. DS010910 25 Reactions Cat. No. DS010925 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

AmpliScribe T7-Flash Biotin-RNA Transcription Kit

AmpliScribe T7-Flash Biotin-RNA Transcription Kit AmpliScribe T7-Flash Biotin-RNA Transcription Kit Cat. No. ASB71110 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA276E AmpliScribe T7-Flash Biotin-RNA Transcription Kit 12/2016

More information

TECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli

TECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli Catalog Number FNCAS9PROT Storage Temperature 20 C TECHNICAL BULLETIN Product Description FnCas9 protein is a recombinant

More information

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

For Research Use Only Ver

For Research Use Only Ver Page 0 INSTRUCTION MANUAL RNA Clean & Concentrator -5 Catalog Nos. R1013 & R1014 (supplied with DNase I) R1015 & R1016 Highlights Quick, 5 minute recovery of ultra pure RNA ( 17 nt) from enzymatic reactions,

More information

CELLSCRIPT RNA for Translation in Cells

CELLSCRIPT RNA for Translation in Cells TM RNA for Translation in Cells Cat. No. C-ACM04037 INTRODUCTION The AmpliCap-Max T7 High Yield Message Maker Kit produces capped RNA by in vitro transcription using T7 RNA polymerase and the standard

More information

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

Nextera DNA Sample Prep Kit (Roche FLX-compatible)

Nextera DNA Sample Prep Kit (Roche FLX-compatible) Cat. Nos. FL09115, FL091120, and FLBC0950 The is designed to prepare genomic DNA libraries compatible with the Roche 454 Genome Sequencer FLX System, with standard FLX chemistry. Nextera technology* employs

More information

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

DNase I Treatment Kit

DNase I Treatment Kit DNase I Treatment Kit (version A1) Catalog No. 25502 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax: 760

More information

Alt-R CRISPR-Cpf1 System:

Alt-R CRISPR-Cpf1 System: user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Alt-R CRISPR-Cas9 system:

Alt-R CRISPR-Cas9 system: Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research

More information

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2.

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2. RNA ENZYMES & GENE ANALYSIS HiScribe T7 Quick High Yield RNA Synthesis Kit Instruction Manual NEB #E2050S 50 reactions Version 2.1 1/17 NEB #S1560S be INSPIRED drive DISCOVERY stay GENUINE This product

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Nextera DNA Sample Prep Kit

Nextera DNA Sample Prep Kit Nextera DNA Sample Prep Kit (Roche FLX-compatible) Cat. Nos. FL09115, FL091120, and FLBC0950 * Covered by patents issued and pending. Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

EnGen sgrna Synthesis Kit, S. pyogenes

EnGen sgrna Synthesis Kit, S. pyogenes RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research

More information

Preparing Samples for Analysis of Small RNA

Preparing Samples for Analysis of Small RNA Preparing Samples for Analysis of Small RNA Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE Gel 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA Adapters 15

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

NxGen phi29 DNA Polymerase

NxGen phi29 DNA Polymerase NxGen phi29 DNA Polymerase Please read carefully and thoroughly before beginning FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll

More information

NEBNext RNase III RNA Fragmentation Module

NEBNext RNase III RNA Fragmentation Module SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)

More information

Preparing Samples for Analysis of Small RNA Using the Oligo Only Kit

Preparing Samples for Analysis of Small RNA Using the Oligo Only Kit Preparing Samples for Analysis of Small RNA Using the Oligo Only Kit FOR RESEARCH ONLY Topics 3 Introduction 4 Kit Contents, User-Supplied Consumables, and Equipment Checklist 6 Isolate Small RNA by Denaturing

More information

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John

More information

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 PAGE: 1 of 13 SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 AUTHOR: Nicholas Marko PRIMARY REVIEWERS: Renee Rubio, Bryan Frank 1. PURPOSE This protocol describes the procedure for amplifying RNA

More information

Cat. Nos. NT09115, NT091120, NT , NT , and NTBC0950 DISCONTINUED

Cat. Nos. NT09115, NT091120, NT , NT , and NTBC0950 DISCONTINUED Nextera DNA Sample Prep Kit (Roche Titanium-compatible) Cat. Nos. NT09115, NT091120, NT0911-50, NT0911-96, and NTBC0950 DISCONTINUED The Nextera DNA Sample Prep Kit is designed to prepare genomic DNA libraries

More information

ChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205

ChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205 Page 0 INSTRUCTION MANUAL ChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205 Highlights Quick (2 minute) recovery of ultra-pure DNA from chromatin immunoprecipitation (ChIP) assays, cell lysates,

More information

Labeling Protocol for mytags Immortal Libraries

Labeling Protocol for mytags Immortal Libraries 5840 Interface Drive, Suite 101 Ann Arbor MI 48103 1 (734) 998 0751 techsupport@arborbiosci.com Labeling Protocol for mytags Immortal Libraries March 2018 Version 1.5 Contents Reagents and Equipment...

More information

Duplex-specific nuclease

Duplex-specific nuclease Innovative Biotechnology Company www.evrogen.com Duplex-specific nuclease Product Cat.# Size Duplex-specific nuclease, lyophilized EA1 5 units* Duplex-specific nuclease, lyophilized EA2 units* Duplex-specific

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Oligo Clean & Concentrator Catalog Nos. D4060 & D4061 Highlights Quick (2 minute) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes, salts, enzymes, nucleotides,

More information

AccuScript High Fidelity 1 st Strand cdna Synthesis Kit

AccuScript High Fidelity 1 st Strand cdna Synthesis Kit AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

EnGen Mutation Detection Kit

EnGen Mutation Detection Kit DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.

More information

Alt-Ring the genome with CRISPR- Cas9

Alt-Ring the genome with CRISPR- Cas9 Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist

More information

BIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01

BIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01 BIOO LIFE SCIENCE PRODUCTS NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) Catalog #: 4201-01 (16 reactions) BIOO Scientific Corp. 2013 V13.01 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product

More information

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using a spin-column.

Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using a spin-column. INSTRUCTION MANUAL ZymoPURE Plasmid Miniprep Kit Catalog Nos. D4209, D4210, D4211 & D4212 (Patent Pending) Highlights Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using

More information

INCOGNITO T7 Ψ-RNA Transcription Kit

INCOGNITO T7 Ψ-RNA Transcription Kit INTRODUCTION Cat. No. C-ICTY110510 The * is optimized for high-yield synthesis of pseudouridinecontaining RNA (Ψ-RNA) by in vitro transcription (IVT) of a DNA template that has a properly-oriented phage

More information

A Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences

A Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences Page 1 of 7 Overview Purpose & Scope This procedure describes an event-specific real-time TaqMan PCR method for determination of the relative content of Roundup Ready canola RT73 (hereafter referred to

More information

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Cat. # 9760 For Research Use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Shipping and Storage... 4 IV. Preparation

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

CRISPR 101: Optimizing Your Gene Editing Experiments

CRISPR 101: Optimizing Your Gene Editing Experiments CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

Zymoclean Large Fragment DNA Recovery Kit

Zymoclean Large Fragment DNA Recovery Kit INSTRUCTION MANUAL Zymoclean Large Fragment DNA Recovery Kit Catalog Nos. D4045 & D4046 Highlights Quick (15 minute) spin column recovery of large-sized DNA (e.g., genomic, plasmid (BAC/PAC), viral, phage,

More information

I-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only.

I-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only. Instruction Manual Ver. 05.11.17 For Research Use Only I-Blue Midi Plasmid Kit & I-Blue Midi Plasmid Kit (Endotoxin Free) IB47180, IB47190 (2 Preparation Sample Kit) IB47181, IB47191 (25 Preparation Kit)

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5090 SingleShot Probes Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot Probes Kit prepares genomic DNA (gdna) free RNA directly from cell culture

More information

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection INSTRUCTION MANUAL Select-a-Size DNA Clean & Concentrator Catalog No. D4080 Highlights Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double

More information

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection

Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection INSTRUCTION MANUAL Select-a-Size DNA Clean & Concentrator Catalog No. D4080 Highlights Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double

More information

ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063

ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 INSTRUCTION MANUAL ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 Highlights Quick, high-throughput (96-well) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes,

More information

Torsional Constraints of DNA Substrates Impact Cas9 Cleavage

Torsional Constraints of DNA Substrates Impact Cas9 Cleavage Supporting Information Torsional Constraints of DNA Substrates Impact Cas9 Cleavage Michael H. Räz, Kumi Hidaka, Shana J. Sturla, Hiroshi Sugiyama, *,, and Masayuki Endo *, Institute for Integrated Cell-Material

More information

Fast-Link DNA Ligation Kits

Fast-Link DNA Ligation Kits Fast-Link DNA Ligation Kits Cat. Nos. LK0750H and LK6201H Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA086E Fast-Link DNA Ligation Kits 6/2017 1 1. Introduction The Fast-Link

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

CELLSCRIPT RNA for Translation in Cells

CELLSCRIPT RNA for Translation in Cells TM CELLSCRIPT RNA for Translation in Cells INCOGNITO T7 -RNA Transcription Kit Cat. No. C-ICTY110510 INTRODUCTION The INCOGNITO T7 -RNA Transcription Kit* is optimized for high-yield synthesis of pseudouridinecontaining

More information

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen

More information

NEXTflex Cystic Fibrosis Amplicon Panel. (For Illumina Platforms) Catalog # (Kit contains 8 reactions) Bioo Scientific Corp V17.

NEXTflex Cystic Fibrosis Amplicon Panel. (For Illumina Platforms) Catalog # (Kit contains 8 reactions) Bioo Scientific Corp V17. NEXTflex Cystic Fibrosis Amplicon Panel (For Illumina Platforms) Catalog #4231-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2017 V17.02 This product is for research use only. Not for use in diagnostic

More information

CELLSCRIPT RNA for Translation in Cells

CELLSCRIPT RNA for Translation in Cells TM CELLSCRIPT RNA for Translation in Cells Cat. No. C-PAP5104H INTRODUCTION The uses ATP as a substrate for template-independent addition of adenosine monophosphates to the 3'-hydroxyl termini of RNA.

More information

Alt-R CRISPR-Cas9 System:

Alt-R CRISPR-Cas9 System: genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03

Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03 Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-RNA Fecal/Soil Microbe Microprep Kit Catalog No. R2040 Highlights Quick, 10 minute isolation of total RNA (~10 µg) from various soil and fecal samples using ultra-high density

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-RNA Whole Blood Catalog Nos. R1201 Highlights Purify high-quality total RNA (including small/micro RNAs) from whole and partitioned blood samples. Compatible with commonly used

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

YeaStar Genomic DNA Kit Catalog No. D2002

YeaStar Genomic DNA Kit Catalog No. D2002 Instructions YeaStar Genomic DNA Kit Catalog No. D2002 Table of Contents General Information...... 1 Package Contents Ordering Information General Description...... 2 Protocol I.......... 2 Protocol II.

More information

CircLigase II ssdna Ligase

CircLigase II ssdna Ligase Cat. Nos. CL9021K and CL9025K www.lucigen.com MA298E-CircLigase II ssdna Ligase 2/2018 1 1. Introduction CircLigase II ssdna Ligase is a thermostable ligase that catalyzes iintramolecular ligation (i.e.,

More information

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see

More information

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products

More information

Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)

Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit

More information

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University

More information

NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V15.

NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V15. NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA-5143-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2015-2018 V15.07 This product is for research use only. Not for use in diagnostic procedures.

More information

Supplementary Protocol: CIRCLE-seq Library Preparation

Supplementary Protocol: CIRCLE-seq Library Preparation Supplementary Protocol: CIRCLE-seq Library Preparation Reagent Gentra Puregene Tissue Kit Qubit dsdna BR Assay Kit Agencourt AMPure XP magnetic beads High throughput, with bead, PCR-free Library Preparation

More information

Zymo-Spin Technology. The microcentrifuge column that revolutionized nucleic acid clean-up

Zymo-Spin Technology. The microcentrifuge column that revolutionized nucleic acid clean-up Zymo-Spin Technology The microcentrifuge column that revolutionized nucleic acid clean-up Overview A Comprehensive Solution for DNA and RNA Clean-Up High-quality, inhibitor-free DNA and RNA is crucial

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

TB Green Premix Ex Taq II (Tli RNaseH Plus)

TB Green Premix Ex Taq II (Tli RNaseH Plus) Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.

More information

Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog # reactions

Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog # reactions Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog #8928 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect chromosomes

More information

SunScript One Step RT-PCR Kit

SunScript One Step RT-PCR Kit SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...

More information

SunScript TM Reverse Transcriptase RNaseH+

SunScript TM Reverse Transcriptase RNaseH+ Reverse Transcriptase RNaseH+ INDEX Ordering Information...3 Kit Contents...3 Source...3 Activity Unit Definition...3 Inactivation...3 Shipping and Storage...3 Handling...3 Quality Control Assays...4 Reagents

More information