XactEdit Cas9 Nuclease with NLS User Manual

Transcription

1 XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE K, CE , CE , CE , CE Table of Contents Product Information and Storage Conditions 1 Overview 2 Product Description 2 Product Specifications 2 Additional Required Materials 3 Protocols 4 Using XactEdit Cas9 Nuclease with NLS for In Vitro DNA digestion 4 Using XactEdit Cas9 Nuclease with NLS for In Vivo DNA digestion 6 Appendix A: Representative Data 7 XactEdit Cas9 Nuclease In Vitro Activity Assay 7 XactEdit Cas9 Nuclease In Vivo Activity Assay 7 Appendix B: Negative Control guide RNA Template 8 Product Information and Storage Conditions XactEdit Cas9 Nuclease with NLS Kit Catalog Number CE K Quantity Component Amount Concentration Storage 1 vial XactEdit Cas9 Nuclease with NLS* 50 µg 1 mg/ml Negative Control grna Template 10 µl** 25 µm 10X XactEdit Digestion Buffer 0.5 ml Nuclease-free water 0.5 ml *Avoid repeated freeze/thaw cycles. Aliquot if necessary. See Appendix B: Negative Control guide RNA Template on page 8 for sequence information. ** Shipped lyophilized. See Prepare In Vitro Transcription Template on page 4 for resuspension instructions. XactEdit Cas9 Nuclease with NLS Recombinant Protein 20 C Catalog Number Quantity Component Amount Concentration Storage CE CE vial 5 vials (50 µg each) XactEdit Cas9 Nuclease with NLS 50 µg 250 µg CE vial 250 µg CE vial 1000 µg 1 mg/ml 20 C 10 mg/ml Avoid repeated freeze/thaw cycles. Aliquot if necessary. Synthetic Genomics, Inc. syntheticgenomics.com REV PN CE1000-M

2 Overview Product Description Product Specifications XactEdit Cas9 Nuclease with NLS is a purified recombinant Streptococcus pyogenes Cas9 protein containing a nuclear localization signal (NLS) for targeting into the nucleus. XactEdit Cas9 Nuclease with NLS has been formulated to perform highly efficient RNA-guided DNA digestion in vitro. This recombinant Cas9 protein complexes with guide RNA to form an RNA-protein complex (RNP). Introducing RNPs into cells creates double-stranded DNA breaks (DSBs) which have been used for a variety of precise genome-editing studies, such as homologous knock-in and gene knock-out. RNP delivery is non-replicative in the cell and therefore has minimal off-target effects, an advantage over other delivery methods. XactEdit Cas9 Nuclease with NLS is suitable for use with immortalized cell lines and primary cells. XactEdit Cas9 Nuclease with NLS Presentation Concentration Purity Endotoxin level RNase activity DNase activity In vitro activity Recombinant Streptococcus pyogenes Cas9 nuclease with N terminal modification of 8X His tag and SV40 NLS 25 mm Tris-HCl, ph 7.4, 300 mm NaCl, 0.1 mm EDTA, 1 mm DTT, 50% glycerol 1 mg/ml for Catalog Number series CE mg/ml for Catalog Number series CE1001 Values based on absorbance at 280 nm with extinction coefficient at 0.76 (mg/ml) -1 cm -1 > 90%, RP-HPLC > 90%, SDS-PAGE < 10 EU/mg, by LAL assay < LOD by fluorescence-based RNase assay (detection limit < U of RNase) < 0.01 unit DNase I per 100 µg of Cas9, by fluorescence-based DNase Assay > 80% of target DNA at 5.4 nm is digested with 50 µg of Cas9 with equal molar ratio of guide RNA at 37 C for 1 hour. 2

3 Additional Required Materials For In Vitro DNA Digestion The following materials are not included with the XactEdit Cas9 Nuclease with NLS Kit, but are required for in vitro DNA digestion. User Supplied Materials Item Linearized DNA template containing T7 promoter and target grna coding sequence grna synthesis kit RNA clean-up kit Materials for RNA quantitation Recommended Kit and Supplier User defined MEGAScript T7 Transcription Kit (Thermo Fisher Cat No. AM1334) or equivalent kit or components RNA Clean & Concentrator -25 (Zymo Cat No. R1017) or equivalent Qubit RNA BR Assay Kit (Thermo Fisher Cat. No. Q10210) or equivalent 2% agarose or 10% TBE-urea gels Any reliable supplier of high-quality RNAse-free pipet tips materials for molecular biology applications High-fidelity DNA polymerase Phusion polymerase (Thermo Fisher Cat No. F530) or equivalent For In Vivo DNA Targeting and Cleavage The following materials are not included with the XactEdit Cas9 Nuclease with NLS Kit, but are required for in vivo DNA targeting and cleavage. User Supplied Materials Item Cell type of interest Electroporation apparatus Recommended Item User defined Neon Transfection System or equivalent Transfection reagent Neon Transfection Kit, 10 µl or 100 µl grna Custom designed to target DNA sequence-of-interest 3

4 Protocols Using XactEdit Cas9 Nuclease with NLS for In Vitro DNA digestion Materials DNA template ( ng) XactEdit Cas9 Nuclease with NLS Target-specific guide RNA 10X XactEdit Digestion Buffer Nuclease-free water (Optional) Negative Control grna template Design and Generate a Template for grna Production 1. Define a target site by screening your targeted DNA for an nt protospacer sequence followed by a protospacer adjacent motif (PAM), 5 -NGG-3. The intended cleavage site will be 3 4 nucleotides upstream of NGG. Note: The nt target protospacer sequence in the genomic DNA must be followed by a PAM sequence of NGG. This motif is essential for DNA cleavage, but is not included in the grna sequence. The immediate 12 nt located 5 of the PAM is the seed sequence and is necessary for efficient cleavage. A perfect match between your seed sequence and non-target loci should be avoided when designing grnas as mismatches close to the PAM site tend to abolish DNA cleavage. 2. Synthesize complementary oligonucleotides that contain a T7 promoter sequence, the targetspecific spacer sequence, and a guide RNA scaffold. These oligonucleotides will be annealed (see the protocol in the following section) to form a double-stranded oligonucleotide that will serve as a template for in vitro transcription for generating your grna. A double-stranded template example is shown below: T7 Promoter Spacer Sequence Scaffold 5 -TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3 3 -ATTATGCTGAGTGATATCCNNNNNNNNNNNNNNNNNNCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAAAAA-5 NN = Potential Cleavage Site Prepare In Vitro Transcription Template The ds oligonucleotide described above will be the template for grna production with in vitro transcription. Use the following procedure to denature and anneal your complementary oligonucleotides. 1. Bring each oligonucleotide to a concentration of 50 µm using 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl. 2. Combine the oligonucleotides in a 1:1 molar ratio. 3. For the Negative Control grna Template (provided with XactEdit Cas9 Nuclease Kit only), resuspend the contents of the tube with 10 µl of 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl. (Using a negative control is optional but highly recommended.) 4. Transfer 10 ul of the combined oligonucleotides to a PCR tube. 5. Denature oligonucleotides (including Negative Control grna Template, if applicable) at 95 C for 5 minutes. Slowly cool ( 0.1 C /second) to 25 C. 6. Add 240 µl nuclease-free water to the annealed oligonucleotides create a 2 μm stock grna template. The annealed ds oligonucleotide template is now ready for in vitro transcription. We recommend storing aliquots of the ds oligonucleotide template at 20 C for 6 months. 4

5 In Vitro Transcription to produce grna Although individual components may be used for in vitro transcription, we recommend using an in vitro transcription kit (e.g. MEGAScript T7 Transcription Kit, Thermo Fisher Cat No. AM1334) to simplify the reaction and reduce the potential for RNase contamination. 1. Combine the following components on ice: Component Volume 10X T7 Reaction Buffer 1 µl NTP Mixture (75 mm each) (1 µl ATP, 1 µl CTP, 1 µl GTP, 1 µl UTP) 4 µl 2 µm grna template from Prepare In Vitro Transcription Template 4 µl T7 RNA Polymerase 1 µl Total* 10 µl *The total reaction volume may be scaled up to 20 µl for increased yield. 2. Gently mix and incubate the reaction at 37 C for 2 hours. 3. Recover the grna using a silica spin column procedure (e.g. the RNA Clean & Concentrator, Zymo Cat. No. R1017). 4. Quantify grna by absorbance or fluorescent quantification. 5. Aliquot grna and store at 80 C. Note: To prevent RNA damage or the introduction of nuclease to the sample due to handing, avoid multiple freeze/thaw cycles. Prepare an In Vitro Digestion Template In Vitro Digestion Design a template to screen for the specificity and effectiveness of your grna. The template should contain the target site for grna and can be a plasmid, PCR-amplified amplicon, restriction-digest fragment, or synthetic DNA. The template will be used for in vitro digestion followed by agarose gel analysis. This target should be of a sufficient length and have the grna target site in a location that will allow you to easily visualize cleavage of the fragment on an agarose gel. 1. Combine the following components: Component Amount 10X XactEdit Digestion Buffer 3 µl grna, from step 5 of In Vitro Transcription to produce grna XactEdit Cas9 Nuclease with NLS DNA template in TE or PCR buffer, from Prepare an In Vitro Digestion Template ng 2. Bring the total volume of the reaction to 30 µl with nuclease-free water and mix by gently pipetting up and down. 3. Incubate reactions at 37 C for 1 hour. 4. Transfer reactions to 80 C for 2 minutes. 5. Evaluate the digestion by running µl of the reaction on a 2% agarose gel. 500 ng 100 ng 5

6 Using XactEdit Cas9 Nuclease with NLS for In Vivo DNA digestion Deliver Cas9 to cells Electroporation is the most effective means of delivering XactEdit Cas9 Nuclease with NLS to cells. Although lipid-based transfection methods can be used, we highly recommend electroporation for best results. Use the following guidelines as a starting point for optimizing in vivo digestion. For high efficiency delivery, optimize conditions (e.g., voltage and pulse duration) based on your selected cell type and electroporation apparatus. 1. Combine XactEdit Cas9 Nuclease and grna. We recommend using a molar ratio between 1:1 and 1:2 (Cas9:gRNA) as a starting point. Note: You will need to empirically determine the optimal amount of XactEdit Cas9 and grna for a given cell type and your particular experimental design. Beginning optimization with 1 µg of XactEdit Cas9 and 200 ng of grna is a typical starting point. To minimize the total volume delivered, use XactEdit Cas9 Nuclease at a concentration of 10 mg/ml (Catalog Numbers CE and CE ). 2. Mix the RNP complex by gentle pipetting and incubate at room temperature for minutes. Note: The RNP complex is stable at room temperature for up to 2 hours. 3. Mix the RNP complex with your cell suspension of choice. 4. Perform electroporation according to the recommendations and parameters for your cell line and electroporator. 5. Plate cells under appropriate growth conditions and allow hours of recovery. 6. To evaluate off-target activity, use a T7 endonuclease I (T7E1) assay or sequence analysis (optional). 6

7 Appendix A: Representative Data XactEdit Cas9 Nuclease In Vitro Activity Assay MW XactEdit Cas9 / grna bp Emx1 amplicon 487 bp cleaved fragment 283 bp cleaved fragment grna (ng) XactEdit Cas9 (ng) Figure 1. XactEdit Cas9 Nuclease (NLS) In Vitro Activity Assay. The gel image above shows RNA-guided Cas9 endonuclease activity targeting a 770 bp homeobox transcription factor Emx1 amplicon. Specific cleavage by the XactEdit Cas9: grna complex generates two fragments (283 bp and 487 bp). In each lane, 100 ng of Emx1 amplicon was incubated with indicated amount of guide RNA (grna) and XactEdit Cas9 protein. The data indicate that XactEdit Cas9 protein effectively and specifically cleaves the substrate at the target site. The molecular weight (MW) marker shown in lane 1 is 1 kb ladder. XactEdit Cas9 Nuclease In Vivo Activity Assay A B 770 bp Emx1 amplicon 487 bp cleaved fragment 283 bp cleaved fragment MW XactEdit Cas9 Neg Cas9 Supplier Neg MW % Cleavage SGI-DNA Lot 1 SGI-DNA Lot 2 Supplier T Supplier N Figure 2. XactEdit Cas9 Nuclease (NLS) In Vivo Activity Assay. The in vivo nuclease activity of two different lots of XactEdit Cas9 nuclease were compared to that of Cas9 nuclease from supplier T and N. For each assay, Emx1 gene Cas9:gRNA complexes were formed using 1 µg of Cas9 and 200 ng of in vitro transcribed guide RNA. Complexes were introduced into HEK 293T cells by electroporation. Cas9 double strand break (DSB) frequency was examined by a mutation detection assay (A) and MiSeq analysis (B). (A) Mutated sequences created by DSB are shown as cleaved products in agarose gel electrophoresis indicating Cas9 induced DSB sites. Lanes 1 and 8 are molecular weight (MW) marker Quick-Load 2-Log DNA ladder. (B) MiSeq sequencing at the target site provides a quantitative analysis on the percentage of cleavage. Data are presented as the mean with standard deviation of three replicates. 7

8 Appendix B: Negative Control guide RNA Template Sequences Oligonucleotide 1: 5 -TAATACGACTCACTATAGGTAGCGAACGTGTCCGGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3 Oligonucleotide 2: 5 -AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACACGCCGGACACGTTCGCTACCTATAGTGAGTCGTATTA-3 Presentation Concentration Lyophilized 25 µm per oligonucleotide upon reconstitution with 10 µl of 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl, ph 8. Technical Services Trademark Information Label License Research Use Only Intended Use For technical assistance, please contact technical services at techservices@sgidna.com. XactEdit is a trademark and Synthetic Genomics is a registered trademarks of Synthetic Genomics Inc. MEGAscript, Qubit, and Neon are registered trademarks of Thermo Fisher Scientific. RNA Clean & Concentrator is a trademark of Zymo Research Corporation. Quick-Load is a registered trademark of New England Biolabs, Inc. MiSeq is a trademark of Illumina, Inc. Except as otherwise agreed in writing by our authorized representative, this product is for INTERNAL RESEARCH USE ONLY AND NOT FOR HUMAN, ANIMAL, THERAPEUTIC OR DIAGNOSTIC USE. For additional information about your rights under this research license, please see our website at sgidna.com. Research use only. Not for diagnostic and/or human use. Product information and additional resources are available at sgidna.com 2016 Synthetic Genomics Inc. All rights reserved. Synthetic Genomics, Inc.