Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
|
|
|
- Alban Terry
- 6 years ago
- Views:
Transcription
1 1 Supplementary text and data for: Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A. Davies
2 Supplementary Figure 1. Considerable vascularisation of the kidney occurs between E11.5 and E11.75 (as the cross- stroke of the T elongates). Scale bars: 100 µm
3 Supplementary Figure 2. Autofluorescence by erythroid cells in bleached tissue. (A) In bleached E16.5 kidneys, cells autofluoresce under visible light and co-localise with the erythroid cell marker, Ter119. No antibodies were used to produce fluorescence in the blue or red channels. (B) Shows the same as A, but without anti-ter119. Images from A and B were taken using identical microscope settings. (C-C ) Cropped image of two cells that are highlighted by the white box in A. Note the different fluorescence profile of the cells in the far-red channel (Ter119) compared to the blue and red channels. (D-D ) Gray value profiles of the cell in C that is marked by the asterisk (*; data plotted using Analyse>Plot Profile in ImageJ). In D and D, the gray value profiles are alike (the result of intracellular heme acting as a chromophore). In D, the gray value profile has two peaks, representing fluorescence at each side of the plasma membrane (Ter119 binds to a molecule that associates with glycophorin A on the erythroid cell membrane). Scale bars: A-B = 100 µm; C-C = 10 µm
4 Supplementary Figure 3. Location of the kidneys in the E11.5 mouse embryo. (A) The E11.5 kidneys sit in the caudalpart of the mouse embryo at the level of the hind limb buds. (B-C) The kidney is positioned in a densely vascularised region of the caudal-part mouse embryo and is surrounding by small capillaries and major arteries. Yellow arrowheads show the vascular ring and peri-ureteral blood vessels (note that these vessels connect to the adjacent major arteries). Scale bars = 200 µm. 4
5 Supplementary Figure 4. Vascular plexuses and erythroid cells are present around cap mesenchymal populations at E14.5. (A-B) At E14.5, endothelia branch from the bifurcation site of the ureteric bud to form a new plexus. (C) Individual z-planes (from the z-stack in A-B) show that the green and red cells in A-B are not overlapping (the green cap mesenchymal cells sit above the blue ureteric bud tip cells). (D-D ) Erythroid cells are present within the peripheral vascular plexuses at E14.5. Scale bars: A and C = 100 µm; B = 20 µm; D-D = 50 µm. 78 5
6 Supplementary Figure 5. The basement membrane of the vascular plexuses differs to that of other blood vessels in the kidney and ureter. (A-A ) At E15.5, the basement membrane of most vascular plexuses have low levels of laminin compared to ureteral blood vessels. (B-B ) Shows the same as A, but at E17.5. Yellow arrowheads show examples of laminin high blood vessels. Scale bars = 100 µm. 84 6
7 Supplementary Figure 6. The endothelial plexus basement membrane is collagen IV + and laminin low in E16.5 kidneys. (A-C) Show all combinations of CD31, Col IV, and laminin staining. Scale bar = 100 µm
8 103 Supplementary Table 1. Antibodies used. Primary antibodies Working dilution Clonality Supplier (Cat. Number) Rat anti-mouse CD31 1 in 100 Monoclonal BD Pharmingen (550274) Rabbit anti-mouse laminin 1 in 100 Polyclonal Sigma (L9393) Mouse anti-mouse calbindin 1 in 100 Monoclonal Abcam (ab9481) Mouse anti-mouse pan-cytokeratin 1 in 100 Monoclonal Sigma (C2562) Rabbit anti-mouse Six2 1 in 200 Polyclonal Proteintech ( AP) Rabbit ant-mouse VEGFR2 1 in 100 Monoclonal Cell signalling technology (55B11) Goat anti-human Gata3 1 in 200 Polyclonal R&Dsystems (AF2605) Rabbit anti-mouse Lyve-1 1 in 100 Polyclonal Abcam (ab33682) Rat anti-mouse Ly76 (TER-119) 1 in 100 Monoclonal Abcam (ab91113) Goat anti-human collagen IV 1 in 100 Polyclonal Merckmillipore (AB769) Goat anti-mouse SCL/Tal1 1 in 100 Polyclonal Santa cruz (ab24870) Conjugated primary antibodies Working dilution Clonality Supplier (Cat. Number) FITC-conjugated mouse anti-mouse actin, α-smooth muscle 1 in 100 Monoclonal Sigma (F3777) Conjugated secondary antibodies Working dilution Supplier (Cat. Number) AlexaFluor 350 donkey anti-mouse 1 in 200 Life Technologies (A10035) AlexaFluor 488 donkey anti-mouse 1 in 200 Life Technologies (A21202) AlexaFluor 488 donkey anti-rabbit 1 in 200 Life Technologies (A21206) AlexaFluor 647 donkey anti-rabbit 1 in 200 Life Technologies (A31573) AlexaFluor 488 donkey anti-goat 1 in 200 Life Technologies (A11055) AlexaFluor 647 donkey anti-goat 1 in 200 Life Technologies (A21447) AlexaFluor 594 chicken anti-rat 1 in 200 Life Technologies (A21471) AMCA Goat anti-rabbit 1 in 100 Abcam (ab123435) AMCA horse anti-mouse 1 in 100 VECTOR (CI-2000)
9 123 Movie titles and captions Movie 1. Dorsal view of the blood vessels in the E11.75 kidney. Note the vascular ring that had formed around the top of the ureteric bud stalk. Scale bar: 100 µm Movie 2. Position of the E11 kidney in the caudal portion of the mouse embryo. 3-D rendering was performed using IMARIS. Scale and labels are provided in the Movie Movie 3. Stack of z-plane images of the E11 kidney in the caudal portion of the mouse embyro. Scale bar: 100 µm Movie 4. Primitive erythroblasts in the E11.5 kidney. Scale and labels provided in the Movie Movie 5. Position of the E11.5 kidney in the caudal portion of the mouse embryo. 3-D rendering was performed using IMARIS. Scale and labels are provided in the Movie Movie 6. Stack of z-plane images of the E11.5 kidney in the caudal portion of the mouse embyro. Scale bar: 100 µm Movie 7. Tracing endothelia from the vascular plexuses to the renal arteries, and tracing from renal arteries to plexus endothelia, in the E17.5 kidney. The coloured stars represent different examples of vessels that were traced. 9
Supplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
Supplemental material and methods
Supplemental material and methods Antibodies: Primary antibodies used for these stainings were 174/2 1 (migg1 against PV-1), PAL-E 2 (migg2a; Abcam, Cambridge, UK), anti-nrp-1 (monoclonal migg2a or polyclonal
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Monteiro et al., http://www.jcb.org/cgi/content/full/jcb.201306162/dc1 Figure S1. 3D deconvolution microscopy analysis of WASH and exocyst
Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin
Supplementary Information 1 Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin and ribosomal protein L19 (RPL19) mrna in cleft and bud epithelial cells of embryonic salivary
Title. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
A Simple Method for 3D Analysis of Immunolabeled Axonal Tracts in a Transparent Nervous System
Cell Reports, Volume 9 Supplemental Information A Simple Method for 3D Analysis of Immunolabeled Axonal Tracts in a Transparent Nervous System Morgane Belle, David Godefroy, Chloé Dominici, Céline Heitz-Marchaland,
Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells
Supplementary Figures and Tables Figure S1. Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells were treated with donkey-anti rabbit antibody conjugated with Dylight488 or
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
Table S1. List of antibodies used including isotype controls, biotinylated. secondaries, and fluorophore conjugated tertiary antibodies.
Table S1. List of antibodies used including isotype controls, biotinylated secondaries, and fluorophore conjugated tertiary antibodies. Antibody Description Distributor Catalogue number Working Concentration
Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.
kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis
Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
Staining Techniques. Staining Techniques. There are many dyes. Histochemical Stains: chemical reactions. Feulgen reaction -DNA
Staining Techniques There are many dyes. http://medinfo.ufl.edu/~dental/denhisto/stains.html Examples: Sudan black -Lipids Myelinated axons- blue ihcworld.com/imagegallery/displayimage.php?al... Weigert
CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
Description of supplementary material file
Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7 Ivar Noordstra, Qingyang Liu, Wilco Nijenhuis, Shasha Hua,
Supplementary Methods
Supplementary Methods Antibodies Rabbit polyclonal VEGFR-1, VEGFR-2, Angiopoietin-1, Angiopoietin- 2 and GAPDH specific antibodies were from Santa Cruz Biotechnology. Rabbit polyclonal Akt1, Akt2, ps473
Application Protocol: CD45 CK Immunostaining for patient blood
REPRODUCTION AND USE This document is protected by copyright and it cannot be used or shared without permission from Vortex Biosciences, Inc. Such permission is given on condition that Vortex Biosciences
Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
Superresolution Pattern Recognition Reveals the Architectural Map of the
Supplementary Information Superresolution Pattern Recognition Reveals the Architectural Map of the Ciliary Transition Zone T. Tony Yang a, Jimmy Su b, Won-Jing Wang c, Branch Craige d, George B. Witman
Supplementary Figure 1. Botrocetin induces binding of human VWF to human
Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.
Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer
Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer Lei Miao 1, Jingjing Li 2, Qi Liu 1,4, Richard Feng 2, Manisit Das 1, C.
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
Figure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning.
Supplemental Information Inventory of Supplemental Information Figure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning. Figure S2. Related to Figure 4, to validate Npn-1 signaling
Supplemental Tables Supplemental Table 1. Phenotypic profile of different HSC lines. Marker d0 mhsc d7 mhsc 8B LX2 CD11b 3.61% 2.21% 2.16% 3.77% F4/80 4.54% 2.05% 0.127% 1.44% Elastin 3.90% 2.95% 4.23%
Purification Kits. Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET
 Montage Antibody Purification Kits Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET Available with immobilized Protein A or Protein G Easy-to-use Antibody
Supplementary Figure 1
DOI: 1.138/ncb273 Supplementary Figure 1 a 1x DAPI field images 4x contoured cells 2µm 5µm b Tissue map Dot plot Histogram Y X antigen X DAPI antigen X Figure S1 Laser Scanning Cytometry of bone marrow
Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy
Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein
Supplementary Methods
Supplementary Methods Antibodies For immunocytochemistry, the following antibodies were used: mouse anti-γ-h2ax (Upstate), rabbit anti-γ-h2ax (Abcam), rabbit anti-53bp1 (Novus), mouse anti-atm-phosphoserine1981
Supplementary Figure S1
Supplementary Figure S1 Figure S1. CENP- FP constructs target to centromeres irrespective of site of tagging. FP- CENP and CENP- FP constructs were transfected into U2OS cells and counterstained with anti-
Nature Biotechnology: doi: /nbt.4086
Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3
Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,
Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude
Mice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2
Antibodies Chicken IgY polyclonal α-gfp antibodies were purchased from Abcam (Cambridge, MA) and were detected using α-chicken IgY-FITC or α-chicken-hrp (also purchased from Abcam). The CD31-PE, CD11b-PE,
Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice
ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus
Fluorochrome-conjugated Anti Collagen IV cocktail for Alport's syndrome
Product manual Fluorochrome-conjugated Anti Collagen IV cocktail for Alport's syndrome FITC-Anti Collagen IV α5(iv) Chain, Human (Mono) + Texas Red-Anti Collagen IV α2(iv) Chain, Human (Mono) Cat. No.SGE-CFT45325
supplementary information
DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,
Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
Stefanie C Hummler, Min Rong, Shaoyi Chen, Dorothy Hehre, Deepthi Alapati, Shu Wu. Online Data Supplement
Targeting GSK-3 to Prevent Hyperoxia-induced Lung Injury in Neonatal Rats Stefanie C Hummler, Min Rong, Shaoyi Chen, Dorothy Hehre, Deepthi Alapati, Shu Wu Online Data Supplement Human Lung Specimens Paraffin
0.9 5 H M L E R -C tr l in T w is t1 C M
a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
Immunofluorescence microscopy for Lyme borreliosis
Vector-Borne-Infection Research, Analysis, Strategy Immunofluorescence microscopy for Lyme borreliosis At present, UK NHS testing fails to detect Lyme in an unknown number of patients which could amount
Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
Supplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting
Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1
64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
SUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.
Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
Engineering tumors with 3D scaffolds
Engineering tumors with 3D scaffolds Claudia Fischbach, Ruth Chen, Takuya Matsumoto, Tobias Schmelzle, Joan S Brugge, Peter J Polverini & David J Mooney Supplementary figures and text: Supplementary Figure
SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases
SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh
Supplemental Material
Supplemental Material Supplemental Methods Hepatocyte ploidy analysis Kidney immunostaining Plasma and urine chemistry analysis Plasma and urine amino acid analysis Supplemental Figures Supplemental Figure
AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis
SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,
Supplementary Information
Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated
Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect
Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening
The best and brightest
Labeling and Detection The best and brightest Alexa Fluor 488 dye Labeling and Detection A superior alternative to FITC Brighter conjugate fluorescence Unequalled photostability Perfect spectral match
Therapeutic angiogenesis via solar cell facilitated electrical
Supporting information Therapeutic angiogenesis via solar cell facilitated electrical stimulation Gun-Jae Jeong 1,, Jin Young Oh 2,, Yeon-Ju Kim 3,, Suk Ho Bhang 4, Hyeon-Ki Jang 5, Jin Han 1, Jeong-Kee
Product Datasheet. CD31/PECAM-1 Antibody (C31.7) NBP mg. Unit Size: 0.1 mg. Store at 4C. Publications: 1
Product Datasheet CD31/PECAM-1 Antibody (C31.7) NBP2-15188-0.1mg Unit Size: 0.1 mg Store at 4C. Publications: 1 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nbp2-15188
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%
Endothelium conference
Endothelium conference Epithelium FUNCTIONS: COVER ORGANS, LINE VISCERA AND BLOOD VESSELS, SECRETORY CELLS OF GLANDS DISTINGUISHING FEATURES AND DISTRIBUTION: ALWAYS SIT ON A BASEMENT MEMBRANE, BUT COME
Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size
Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6.
GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP
Supplemental Materials & Methods Patients and patient samples. A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP requiring splenectomy and 36 splenic specimens obtained
SUPPLEMENTARY INFORMATION
SUPPLEMENTAY INOMATION igure S1 Knockdown of endogenous HI-1α by short-interference NA (sina) reverts EMT and metastatic phenotypes in H1299 cells and in ADU or MC-7 cells undergoing hypoxia. a. Western
Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined
FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and
Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.
Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
Supplementary Figures and supplementary figure legends
Supplementary Figures and supplementary figure legends Figure S1. Effect of different percentage of FGF signaling knockdown on TGF signaling and EndMT marker gene expression. HUVECs were subjected to different
F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
SUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
Supplemental Figures Figure S1: Lymphatic vessel growth into the intestine is normal in Clec2 -/- embryos
Supplemental Figures Figure S1: Lymphatic vessel growth into the intestine is normal in Clec2 -/- embryos Staining of lymphatic vessels in E18.5 embryonic gut. Sections stained for lymphatic EC markers
Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).
Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., http://www.jcb.org/cgi/content/full/jcb.201408079/dc1 Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore
Supplementary Methods. Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to. graft disease propagation
1 Supplementary Methods Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to graft disease propagation Neural transplantation and clinical assessment Detailed information
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
ELISPOT and FLUOROSPOT kits
ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess
Product datasheet. ARG30119 Pro-B Cell Marker Antibody panel (CD19, CD34, CD38, CD40, CD45)(FACS)
Product datasheet info@arigobio.com Package: 1 kit ARG30119 Pro-B Cell Marker Antibody panel (CD19, CD34, CD38, CD40, CD45)(FACS) Component Cat. No. Component Name ARG62820 anti-cd34 antibody [4H11(APG)]
Immunofluorescence Confocal Microscopy of 3D Cultures Grown on Alvetex
Immunofluorescence Confocal Microscopy of 3D Cultures Grown on Alvetex 1.0. Introduction Immunofluorescence uses the recognition of cellular targets by fluorescent dyes or antigen-specific antibodies coupled
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
Supplementary Data. Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486
Supplementary Data Materials and Methods Generation and Genotyping of Transgenic Mice Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486 to +24) was a gift from P. Huber.
Supplementary Figure Legends
Supplementary Figure Legends Supplementary Fig. 1. The third PDZ domain of PAR-3 and the C-terminal PDZ domain binding motif of VE-cadherin mediate the recruitment of PAR-3 to cell-cell contacts in cells.
Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 )
Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) homologous recombination arm (left) and of the right (3 )
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
Day 7 Day 21 MNC CD14 + CD14- Depleted
Day 7 Day 21 A B MNC C D CD14 + E F CD14- Depleted Supplemental Figure 1. DUOC-01 cell product develops from CD14 + monocytes in cord blood. Cultures were established with cord blood mononuclear cells
Supplemental Online Data
1 Supplemental Online Data Wt1 and epicardial fate mapping Carsten Rudat and Andreas Kispert * Institut für Molekularbiologie, OE5250, Medizinische Hochschule Hannover, Carl-Neuberg- Str.1, D-30625 Hannover,
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,
Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico
Supplementary Information
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2018 Supplementary Information Additional Methods The HYPER pad fabrication The HYPER pad has a
High Sensitive Rat Leptin ELISA
High Sensitive Rat Leptin ELISA For the high sensitive quantitative determination of Leptin in rat serum or plasma. Cat. No. KT-379 For Research Use Only. 1 Rev. 091707 PRODUCT INFORMATION High Sensitive