Genetics Lecture 16 Forensics
|
|
- Lora Tate
- 6 years ago
- Views:
Transcription
1 Genetics Lecture 16 Forensics DNA Forensics Genetics is arguably the most influential science today dramatically affecting technologies in fields as diverse as agriculture, archaeology, medical diagnosis, and disease treatment. One of the areas that has been the most profoundly altered by modern genetics is forensic science. Forensic science (or forensics) uses technological and scientific approaches to answer questions about the facts of criminal or civil cases. Pi Prior to 1986, forensic scientists t hd had a limited it array of tools with which to link evidence to specific individuals or suspects. These included some reliable methods such as blood typing and fingerprint analysis, but also many unreliable methods such as bite mark comparisons and hair microscopy. 2 Since the first forensic use of DNA profiling in 1986, DNA forensics (also called forensic DNA fingerprinting or DNA typing) has become an important method for police to identify sources of biological materials. DNA profiles can now be obtained from saliva left on cigarette butts or postage stamps, pet hairs found at crime scenes, or bloodspots the size of pinheads. Even biological samples that are degraded by fire or time are yielding DNA profiles that help the legal system determine identity, innocence, or guilt. Investigators now scan large databases of stored DNA profiles in order to match profiles generated from crime scene evidence. DNA profiling has proven the innocence of hundreds of people who were convicted of serious crimes and even sentenced to death. Forensic scientists have used DNA profiling to identify victims of mass disasters such as the Asian Tsunami of 2004 and the September 11, 2001 terrorist attacks in New York. They have also used forensic DNA analysis to identify endangered species and animals trafficked in the illegal wildlife trade. The power of DNA forensic analysis has captured the public imagination, and DNA forensics is featured in several popular television series. 3 1
2 The applications of DNA profiling extend beyond forensic investigations. These include paternity and family relationship testing, identification of plant materials, verification of military casualties, and evolutionary studies. It is important for all of us to understand the basics of forensic DNA analysis. As informed citizens, we need to monitor its uses and potential abuses. 4 DNA Profiling Methods VNTR Based DNA Fingerprinting The era of DNA based human identification began in 1984, with Dr. Alec Jeffreys s publication on DNA loci known as minisatellites, or variable number of tandem repeats (VNTRs). VNTRs are located in noncoding regions of the genome and are made up of DNA sequences of between 15 and 100 bp long, with each unit repeated a number of times. The number of repeats found at each VNTR locus varies from person to person, and hence VNTRs can be from 1 to 20 kilobases (kb) in length, depending on the person. For example, the VNTR 5 GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTA AGAT 3 is comprised of three tandem repeats of a 16 nucleotide sequence. 5 VNTRs VNTRs are useful for DNA profiling because there are as many as 30 different possible alleles (repeat lengths) at any VNTR in a population. This creates a large number of possible genotypes. For example, if one examined four different VNTR loci within a population, and each locus had 20 possible alleles, there would be more than 2 billion (4 20 )possible genotypes in this four locus profile. 6 2
3 To create a VNTR profile (also known as a DNA fingerprint), scientists extract DNA from a tissue sample and digest it with a restriction enzyme that cleaves on either side of the VNTR repeat region. Separated DNA is transferred from the gel to a membrane and hybridized with a radioactive probe that recognizes DNA sequences within the VNTR region. After exposing the membrane to X ray film, the pattern of bands is measured, with larger VNTR repeat alleles remaining near the top of the gel and smaller VNTRs, which migrate more rapidly through the gel, being closer to the bottom. The pattern of bands is the same for a given individual, no matter what tissue is used as the source of the DNA. If enough VNTRs are analyze, each person s DNA profile will be unique because of the huge number of possible VNTRs and alleles. In practice, scientists analyze about five or six loci to create a DNA profile. 7 8 A significant limitation of VNTR profiling is that it requires a relatively large sample of DNA (10,000 cells or about 50 pg of DNA) more than is usually found at a typical crime scene. In addition, the DNA must be relatively intact (nondegraded). As a result, VNTR profiling has been used most frequently when large tissue samples are available such as in paternity testing. 9 3
4 Autosomal STR DNA Profiling The development of the polymerase chain reaction (PCR) revolutionized DNA profiling. Using PCR amplified DNA samples, scientists are able to generate DNA profiles from trace samples (e.g., the bulb of single hairs or a few cells from a blood stain) and from samples that are old or degraded (such as a bone found in a field or an ancient Egyptian mummy). 10 The majority of human forensic DNA profiling is now done using commercial kits that amplify and analyze regions of the genome known as microsatellites, or short tandem repeats (STRS). STRs are similar to VNTRs, but the repeated motif is shorter between two and nine base pairs, repeated from 7 to 40 times. Although hundreds of STR loci are present in the human genome, only a subset is used for DNA profiling. The FBI and other law enforcement agencies have selected 13 STR loci to be used as a core set for forensic analysis
5 After DNA profiling, the profile can be directly compared to a profile from another person, from crime scene evidence, or from other profiles stored in DNA profile databases. The STR profile genotype of an individual is expressedasthe number of timesthethe STR sequence is repeated
6 Y Chromosome STR Profiling In many forensic applications, it is important to differentiate the DNA profiles of two or more people in a mixed sample. For example, vaginal swabs from rape cases usually contain a mixture of female cells and male sperm cells. In addition, some crime samples contain evidence material from a number of male suspects. In these types of cases, STR profiling of Y chromosome DNA is useful. There are more than 200 STR loci on the Y chromosome that are useful for DNA profiling; however, fewer than 20 of these are used routinely for forensic analysis. PCR amplification of Y chromosome STRs uses specific primers that do not amplify DNA on the X chromosome. 16 One limitation of Y chromosome DNA profiling is that it cannot differentiate between the DNA from fathers and sons, or from male siblings,. This is because the Y chromosome is directly inherited from the father to his sons, as a single unit. The Y chromosome does not undergo recombination, meaning that less genetic variability exists on the Y chromosome than on autosomal chromosomes. Therefore, all patrilineal relatives share the same Y chromosome profile. Even two apparently unrelated males may share the same Y profile, if they also shared a distant male ancestor. 17 Mitochondrial DNA Profiling Another important addition to DNA profiling methods is mitochondrial DNA (mtdna) analysis. Between 200 and 1700 mitochondria are present in each human somatic cell. Each mitochondrion contains one or more 16 kb circular DNA chromosomes. Mitochondria divide within cells and are distributed to daughter cells after cell division. Mitochondria are passed from the human egg cell to the zygote during fertilization; however, as sperm cells contribute few if any mitochondria to the zygote, they do not contribute these organelles to the next generation. Therefore, all cells in an individual contain multiple copies of identical mitochondria derived from the mother. 18 6
7 The fact that mtdna is present in high copy numbers in cells makes its analysis useful in cases where crime samples are small, old, or degraded. mtdna profiling is particularly useful for identifying victims of mass murders or disasters, such as the Srebrenica massacre of 1995 and the World Trade Center attacks of 2001, where reference samples from relatives are available. The main disadvantage of mtdna profiling is that it is not possible to differentiate between the mtdna from maternal relatives or from siblings. Like Y chromosome profiles, mtdna profiles may be shared by two apparently unrelated individuals who also share a distant ancestor in this case a maternal ancestor. Researchers use mtdna profiles in scientific studies of genealogy, evolution, and human population migrations. 19 Single Nucleotide Polymorphism Profiling They may be base pair changes or small insertions or deletions. SNPs occur randomly throughout the genome and on mtdna, every 500 to 1000 nucleotides. This means that there are potentially millions of loci in the human genome that can be used for profiling. However, as SNPs usually have only two alleles, many SNPs (50 or more) must be used to create a DNA profile that can distinguish between two individuals as efficiently as STRs
8 Forensic SNP profiling has one major advantage over STR profiling. Because a SNP involves only one nucleotide of a DNA molecule, the theoretical size of DNA required for a PCR reaction is the size of the two primers and one more nucleotide (i.e., about 50 nucleotides). This feature makes SNP analysis suitable for analyzing DNA samples that are severely degraded. Despite this advantage, SNP profiling has not yet become routine in forensic applications. More frequently, researchers use SNP profiling of Y chromosome and mtdna loci for lineage and evolution studies. 22 Interpreting DNA Profiles After a DNA profile is generated, its significance must be determined. In a typical forensic investigation, a profile derived from a suspect is compared to a profile from an evidence sample or to profiles already present in a DNA database. lf the suspect s profile fl does not match that of the evidence profile or database entries, investigators can conclude that the suspect is not the source of the sample(s) that generated the other profile(s). However, if the suspect s profile matches the evidence profile or a database entry, the interpretation becomes more complicated. 23 In this case, one could conclude that the two profiles either came from the same person or they came from two different people who share the same DNA profile by chance. To determine the significance of any DNA profile match, it is necessary to estimate the probability that thetwo two profiles are a random match. The profile probability, or random match probability method gives a numerical probability that a person chosen at random from a population would share the same DNA profile as the evidence or suspect profiles. The following example demonstrates how to arrive at a profile probability. 24 8
9 25 The Uniqueness of DNA Profiles Theoretically if a sufficient number of loci were analyzed, we could be almost certain that the DNA profile was unique. At the present time, law enforcement agencies in North America use a core set of 13 STR loci to generate DNA profiles. A hypothetical genotype comprised of the most common alleles of each STR locus in the core STR profile would be expected to occur only once in a population of 10 billion people. Hence, the frequency of this profile would be 1 in 10 billion. 26 Although this would suggest that most DNA profiles generated by analysis of the 13 core STR loci would be unique on the planet, several situations can alter this interpretation. For example, identical twins share the same DNA, and their DNA profiles will be identical. Identical twins occur at a frequency of about 1 in 250 births. In addition, siblings can share one allele at any DNA locus in about 50 percent of cases and can share both alleles at a locus in about 25 percent of cases. Parents and children also share alleles, but are less likely than siblings to share both alleles at a locus. When DNA profiles come from two people who are closely related, the profile probabilities must be adjusted to take this into account. The allele frequencies and calculations that we describe here are based on assumptions that the population is large and has little relatedness or inbreeding. lf a DNA profile is analyzed from a person in a small interrelated group, allele frequency tables and calculations may not apply 27 9
10 The Prosecutor s Fallacy It is sometimes stated, by both the legal profession and the public, that the suspect must be guilty given that the chance of a random match to the crime scene sample is 1 in 10 billion greater than the population of the planet, This type of statement is known as the prosecutor s fallacy because it equates guilt with a numerical probability derived from one piece of evidence, in the absence of other evidence. A match between a suspect s DNA profile and crime scene evidence does not necessarily prove guilt, for many reasons such as human error or contamination of samples, or even deliberate tampering. In addition, a DNA profile that does not match the evidence does not necessarily mean that the suspect is innocent. For example, a suspect s profile may not match that from a semen sample at a rape scene, but the suspect could still have been involved in the crime, perhaps by restraining the victim. 28 DNA Profile Databases Many countries throughout the world maintain national DNA profile databases. The first of these databases was established in the UK in 1995 and now contains more than 5 million profiles representing almost 10 percent of the population. In the UK, DNA samples can be taken from anyone arrested for an offense that could lead to a prison sentence. 29 In the United States, both state and federal governments have DNA profile databases. The entire system of databases along with tools to analyze the data is known as the Combined DNA Index System (CODIS) and is maintained by the FBI. At the beginning of 2010, there were more than 8 million DNA profiles stored within the CODIS system. The two main databases in CODIS are the convicted offender database, which contains DNA profiles from individuals convicted of certain crimes, and the forensic database, which contains profiles generated from crime scene evidence. In addition, some states have DNA profile databases containing profiles from suspects and from unidentified human remains and missing persons. Suspects who are not convicted can request that their profiles be removed from the databases
11 DNA profile databases have proven their value in many different situations. As of January 2010, use of CODIS data bases resulted in more than 100,000 profile matches that assisted criminal investigations and missing persons searches. Despite the value of DNA profile databases, they remain a concern for many people who question the privacy and civil liberties of individuals versus the needs of the state 31 Technical and Ethical Issues Surrounding DNA Profiling Although DNA profiling is sensitive, accurate, and powerful, it is important to be aware of its limitations. Onelimitation is thatmost criminal cases have either no DNA evidence for analysis, or DNA evidence that would not be informative to the case. In some cases, potentially valuable DNA evidence exists but remains unprocessed and backlogged. 32 Another serious problem is that of human error. There are cases in which innocent people have been convicted of violent crimes based on DNA samples that had been inadvertently switched during processing. DNAevidence samples from crime scenes are often mixtures derived from any number of people present at the crime scene or even from people who were not present, but whose biological material (such as hair or saliva) was indirectly introduced to the site
12 deliberate tampering One of the most disturbing problems with DNA profiling is its potential for deliberate tampering. DNA profile technologies are so sensitive that profiles can be generated from only a few cells or even from fragments of synthetic DNA. There have been cases in which criminals have introduced biological material to crime scenes, in an attempt to affect forensic DNA profiles. It is also possible to manufacture artificial DNA fragments that match STR loci of a person s DNA profile. 34 In 2010, a research paper reported methods for synthesizing DNA of a known STR profile, mixing the DNA with body fluids, and depositing the sample on crime scene items. When subjected to routine forensic analysis, these artificial i samples generated tdperfect tstr profiles. In the future, it may be necessary to develop methods to detect the presence of synthetic or cloned DNA in crime scene samples. It has been suggested that such detections could be done, based on the fact that natural DNA contains epigenetic markers such as methylation. 35 Many of the ethical questions related to DNA profiling involve the collection and storage of biological samples and DNA profiles. Should police be able to collect DNA samples without a suspect s knowledge or consent? Who should have their DNA profiles stored on a database? Should law enforcement agencies reveal the identities of people whose DNA profiles partially match those of a suspect, on the chance that the two individuals are related? Should researchers have access to DNA databases for research purposes? Could DNA profiles be associated with regions of the genome that might reveal information about a person s health, racial background, or appearance and if so, should that be admissible evidence? 36 12
Genetic Identity. Steve Harris SPASH - Biotechnology
Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)
More informationSouthern hybridization technique
Southern hybridization technique DNA fingerprint analysis is based on the "Southern" hybridization technique. In this method: DNA fingerprinting, also termed DNA profile analysis is based on the use of
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationDNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the
DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the exact same DNA. DNA patterns from four sets of twins which are identical? DNA fingerprinting
More informationAnalysis in Forensic Science
Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More informationDNA Analysis Students will learn:
DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How
More informationName Date Class CHAPTER 13. DNA Fingerprinting
Real-World Biology: Analysis DNA Fingerprinting Genetic Prints Help Solve Mystery of Girls Switched at Birth. Murder Conviction Overturned by DNA Testing: Prisoner Released. Headlines such as these have
More informationDNA: THE INDISPENSIBLE FORENSIC SCIENCE TOOL
Chapter 9 DNA: THE INDISPENSIBLE TOOL By Richard Saferstein Upper Saddle River, NJ 07458 1 Chapter 9 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
More informationDNA Profiling. (DNA fingerprinting)
DNA Profiling (DNA fingerprinting) Background Information: Restriction Enzymes Restriction Enzymes Evolved by bacteria to protect against viral DNA infection. Also called Endonucleases. They cleave DNA
More informationDNA. Evidence. How is DNA be used to solve crimes?
DNA Evidence How is DNA be used to solve crimes? How is DNA used as evidence? Each person s DNA is different from other people (except identical twins). DNA collected from a crime scene can either link
More informationJanuary 07, (adenine, guanine, cytosine, thymine)
(adenine, guanine, cytosine, thymine) DNA at Work - DNA is used to make proteins - proteins are made by linking amino acids (there are 20 possible amino acids) - sequence of amino acids determines shape/function
More informationRFLP s with VNTR analysis
RFLP s with VNTR analysis The most powerful and awesome tool acquired by humans since the splitting of atoms The Time Magazine (U.S.A) INTRODUCTION DNA profiling (also called DNA testing, DNA typing, or
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationMolecular Probes. Mitesh Shrestha
Molecular Probes Mitesh Shrestha Molecular Probes Small DNA segments (genomic DNA, cdna or synthetic oligonucleotides) or RNA segments (often synthesized on DNA template) that recognize complementary sequences
More informationGeneral DNA Information
1 Use of this PPT This PPT has lots of information. I may or may not discuss each slide. Use the information to answer questions in your Question Packets. The packets are the study guide for the tests
More informationThe Real CSI: Using DNA to Identify Criminals and Missing Persons
The Real CSI: Using DNA to Identify Criminals and Missing Persons San Jose State University May 2, 2012 Overview Forensic DNA in the media perceptions and reality The power and limitations of nuclear (STR)
More informationDNA FINGERPRINTING.
DNA FINGERPRINTING http://news.bbc.co.uk/media/images/38250000/gif/_38250230_dna_generic300.gif DNA: Deoxyribonucleic Acid - biological equivalent of fingerprints - < 1% of nonviolent crimes yield DNA
More informationMore often heard about on television dramas than on the news, DNA is the key to solving crimes the scientific way. Although it has only been
DNA Matching More often heard about on television dramas than on the news, DNA is the key to solving crimes the scientific way. Although it has only been relatively recent (compared the course of forensic
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More informationRestriction Fragment Length Polymorphism (RFLP)
Restriction Fragment Length Polymorphism (RFLP) Polymorphism is any difference in the DNA sequence between individuals. Since we are all genetically different from each other, we are all polymorphic. This
More informationFurther Reading - DNA
Further Reading - DNA DNA BACKGROUND What is DNA? DNA (short for deoxyribonucleic acid ) is a complex molecule found in the cells of all living things. The blueprint for life, DNA contains all the information
More informationDNA. Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins
DNA DNA Deoxyribo- Nucleic Acid Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins Parts = nucleotide 1. Sugar (deoxyribose) 2.
More informationUnit 4-DNA Analysis Review Guide
Name: KEY Match the term on the right with the definition on the left. Unit 4-DNA Analysis Review Guide 1. A procedure used to determine the order of the base pairs that make up a DNA molecule E 2. These
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationWhat is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are
DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationUnit 2- DNA Analysis
Unit 2- DNA Analysis Discovery of DNA structure 1950 s Rosalind Franklin & Maurice Wilkins photograph DNA using x-ray diffraction 1 Discovery of DNA structure 1953 James Watson & Francis Crick develop
More informationCHAPTER 13: DNA TYPING NOW AND BEFORE
CHAPTER 13: DNA TYPING NOW AND BEFORE EVIDENCE Each of us is genetically unique, and there are many cases in which it is convenient to make use of our genetic individuality: for parentage analysis, identification
More informationPart I: Predicting Genetic Outcomes
Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because
More informationDNA analysis. Anja Bye Post doktor. K.G. Jebsen Senter for Hjertetrening. Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU
DNA analysis Anja Bye Post doktor K.G. Jebsen Senter for Hjertetrening Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU Focus of this lecture What is DNA? Comparing DNA from different
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationDNA is contained in the nucleus of every cell in your body. Cell Nucleus
DNA is contained in the nucleus of every cell in your body Cell Nucleus 1 DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with
More informationCSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION
CSI TEST Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE This practice introduces students to using DNA and PCR to simulate how DNA obtained from a hair or saliva sample from a crime scene can
More information..C C C T C A T T C A T T C A T T C A T T C A..
Polymerase Chain Reaction Lab: a Forensic Application INTRODUCTION PCR (polymerase chain reaction) is a technique that scientists use to amplify particular segments of DNA. This process can produce large
More informationHuman Genomics. 1 P a g e
Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationReview Instructions:
How is DNA used to solve crimes? Review Instructions: Get out a separate sheet of notebook paper Put your name on it Write your partner s name under yours Title the paper- DNA Lecture Review Both people
More informationBiology 445K Winter 2007 DNA Fingerprinting
Biology 445K Winter 2007 DNA Fingerprinting For Friday 3/9 lab: in your lab notebook write out (in bullet style NOT paragraph style) the steps for BOTH the check cell DNA prep and the hair follicle DNA
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationVideo Tutor Sessions: DNA Profiling
Video Tutor Sessions: DNA Profiling Narration 0:00 Hey there. I m Eric Simon, and welcome to another Video Tutor Session. In this videocast, I m going to walk you through the process of creating a DNA
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More informationMutations, Genetic Testing and Engineering
Mutations, Genetic Testing and Engineering Objectives Describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study the genomes of organisms (TEKS
More informationThe state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.)
Biology 321 May 20, 2011 DNA fingerprinting The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.) 1 2 Innocence Project http://www.innocenceproject.org/know/
More informationMitochondrial analysis in Forensic Scienses
Mitochondrial analysis in Forensic Scienses 2011 Classification of human genome Genome 3.2 Gb Genic and related (25 %) Coding and regulatory (1.5 %) Non-coding (23.5% - introns, pseudogenes) Extragenic
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationChapter 12. DNA Technology. Lectures by Edward J. Zalisko
Chapter 12 DNA Technology PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and Jane B. Reece
More informationRevision Based on Chapter 15 Grade 10
Revision Based on Chapter 15 Grade 10 Biology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which of the following has the disadvantage of possibly bringing
More informationDNA Technology. Dr. Saleh Alaifan
DNA Technology Dr. Saleh Alaifan Watson and Crick discovered the double helix In April 1953, James Watson and Francis Crick shook the scientific world with an elegant double-helical model for the structure
More informationThe Sad But True Case of Earl Washington DNA Analysis and the Criminal Justice System
The Sad But True Case of Earl Washington DNA Analysis and the Criminal Justice System by Justin F. Shaffer Department of Developmental and Cell Biology University of California, Irvine Learning Objectives
More informationPCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase?
What is PCR? PCR the swiss army knife Claudia Stäubert, Institute for biochemistry PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by
More informationMaking sense of DNA For the genealogist
Making sense of DNA For the genealogist Barry Sieger November 7, 2017 Jewish Genealogy Society of Greater Orlando OUTLINE Basic DNA concepts Testing What do the tests tell us? Newer techniques NGS Presentation
More informationDNA & CRIME VICTIMS: WHAT VICTIM ASSISTANCE PROFESSIONALS NEED TO KNOW
DNA & CRIME VICTIMS: WHAT VICTIM ASSISTANCE PROFESSIONALS NEED TO KNOW What Victim Assistance Professionals Need to Know 1 DNA & CRIME VICTIMS: What Victim Assistance Professionals Need to Know As the
More informationDNA Profiling with PCR
Name: DNA Profiling with PCR OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes, thermocycler,
More information"Wrongful Convictions - Innocent People in Jail" Barb Brink, Board President The Alaska Innocence Project
"Wrongful Convictions - Innocent People in Jail" Barb Brink, Board President The Alaska Innocence Project P.O. BOX 201656 ANCHORAGE, ALASKA 99520 (907) 279-0454 Bill Oberly, Executive Director The United
More informationBiotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
More informationDNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each
1 DNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each nucleotide is made up of a sugar called deoxyribose
More informationHow is DNA used to solve crimes? 8 th Grade Forensic Science T. Trimpe
How is DNA used to solve crimes? 8 th Grade Forensic Science T. Trimpe http://sciencespot.net/ #1. How is DNA used as evidence? Each person s DNA is different from other people (except identical twins).
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationKEY CONCEPTS AND PROCESS SKILLS. 1. Blood types can be used as evidence about identity and about family relationships.
Evidence from DNA 40- to 1 2 50-minute sessions 69 M O D E L I N G ACTIVITY OVERVIEW SUMMARY Students learn how DNA fingerprinting is done by performing a simulation of the process used to generate different
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationCentre of Forensic Sciences
Centre of Forensic Sciences Technical Information Sheets DNA Information Introduction DNA is the genetic blueprint of life and is packaged into paired structures known as chromosomes. One from each pair
More informationForensic DNA analysis
FORENSIC DNA ANALYSIS: A PRIMER FOR COURTS 1 Forensic DNA analysis A PRIMER FOR COURTS 2 FORENSIC DNA ANALYSIS: A PRIMER FOR COURTS Forensic DNA analysis: a primer for courts Issued: November 2017 DES4928
More informationFrom Forensic Genetics to Genomics Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations
From Forensic Genetics to Genomics Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations Peter M. Schneider Institute of Legal Medicine University of Cologne
More informationA Rape on a Minor Victim Under POCSO Act 2012 Investigation Through DNA Analysis Technique A Case Study
A Rape on a Minor Victim Under POCSO Act 2012 Investigation Through DNA Analysis Technique A Case Study Rohidas K. Mundhe, Rajendra S. Mali, Sangeeta V. Ghumatkar and Madhukar K. Malve Abstract DNA profiling
More informationAllele: Chromosome DNA fingerprint: Electrophoresis: Gene:
Essential Vocabulary Allele: an alternate form of a gene; for example, a gene for human hair color may have alleles that cause red or brown hair Chromosome: a cell structure that contains genetic information
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationGenetic Technologies
Genetic Technologies Distinguish the terms biotechnology, recombinant DNA technology, transgenic organisms, genetic engineering Understand the two basic techniques to obtain selective fragments of DNA
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationDNA Technology Outline
I) Tools of DNA technology A. PCR (Polymerase Chain Reaction): method of copying DNA sequences 1. DNA is copied in a similar way to natural replication in our cells, but much faster. 2.PCR consists of
More informationChapter 11: Applications of Biotechnology
Chapter 11: Applications of Biotechnology Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 11-1 Why Biotechnology Works 11-2 Biotechnology
More informationAn Introduction to Forensic DNA Analysis
2/7/2013 HC70A: Genetic Engineering in Medicine, Agriculture & Law 1 UCLA Dr. Bob Goldberg HC70A: Genetic Engineering in Medicine, Agriculture & Law An Introduction to Forensic DNA Analysis Presented by
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationSELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS
SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery
More informationSTUDY OF VNTR HUMAN POLYMORPHISMS BY PCR
STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)
More informationExam 3 4/25/07. Total of 7 questions, 100 points.
Exam 3 4/25/07 BISC 4A P. Sengupta Total of 7 questions, 100 points. QUESTION 1. Circle the correct answer. Total of 40 points 4 points each. 1. Which of the following is typically attacked by the antibody-mediated
More informationL. GORGAN. However, even in sexually reproducing species, not all DNA is inherited from both parents. There are two important exceptions, the uniparen
International Journal of Criminal Investigation Volume 1 Issue 2 103-107 DNA SOURCE OF FORENSIC EVIDENCE Lucian GORGAN * 1) Al.I. Cuza University of Iasi, Faculty of Biology, 22, Blvd. Carol I, 700506,
More informationPopulation Genetics. If we closely examine the individuals of a population, there is almost always PHENOTYPIC
1 Population Genetics How Much Genetic Variation exists in Natural Populations? Phenotypic Variation If we closely examine the individuals of a population, there is almost always PHENOTYPIC VARIATION -
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More information3. Replication of DNA a. When a cell divides, the DNA must be doubled so that each daughter cell gets a complete copy. It is important for this
DNA 1. Evidence for DNA as the genetic material. a. Until the 1940s, proteins were believed to be the genetic material. b. In 1944, Oswald Avery, Maclyn McCarty, and Colin MacLeod announced that the transforming
More informationReport of Analyzing Short Tandem Repeats for Parentage Testing
1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationMoayyad Al-shafei. Mohammad Tarabeih. Dr Ma'mon Ahram. 1 P a g e
3 Moayyad Al-shafei Mohammad Tarabeih Dr Ma'mon Ahram 1 P a g e In this sheet, we are going to discuss 2 main topics: 1- The advantages of restriction endonucleases. 2- DNA replication. Before we start
More informationForensic DNA Evidence: Collection, Mixtures, and Degradation
Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 10-28-2004 Forensic DNA Evidence: Collection, Mixtures, and Degradation Dan E. Krane Wright State University
More information-Is the process of manipulating genes and genomes
Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes
More informationSTR Interpretation Guidelines
Introduction: STR Interpretation Guidelines The interpretation of results in casework is necessarily a matter of professional judgment and expertise. Not every situation can or should be covered by a pre-set
More informationGAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME. LIFE SCIENCE Grade 12 SESSION 10 (LEARNER NOTES)
PROTEIN SYNTHESIS AND DNA FINGERPRINTING Learner Note: Please revise the structure of DNA and the functions of the 3 types of RNA before proceeding with Protein Synthesis. You must know that the resulting
More informationName Instructor Lab Section
Biotechnology - Electrophoresis & DNA Profiling Biology 100 - Concepts of Biology 8.1 Name Instructor Lab Section B Objectives: To gain a better understanding of: Fundamental Biotechnology Techniques DNA
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationBIOTECHNOLOGY. Understanding the Application
BELLRINGER-5/4/15 1. What method would you guess forensic scientists use to identify criminals at crime scenes? 2. What do you think we mean by the term biotechnology? BIOTECHNOLOGY Understanding the Application
More information! Polymerase Chain. AP Biology. ! The primers are critical! "
Let s return to the idea of making lots of copies of DNA Copy DNA without plasmids? PCR Polymerase Chain Reaction Yes, we can use bacteria method for making many, many copies of a specific segment of DNA
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationDNA: Biology & the Basics of DNA Typing
DNA: Biology & the Basics of DNA Typing Mary Dayton Assistant Public Defender Law Office of the DeKalb County Public Defender Stone Mountain Judicial Circuit 404.371.2222 mfdayton@dekalbcountyga.gov The
More informationB) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
More informationMohammed Sanaullah Qaseem, Syed Abdul Wahab Asif, Zeeshan Fatima Armeen, Israr Ahmed Qureshi
.Advancement In DNA As Source Of Biometric Authentication Mohammed Sanaullah Qaseem, Syed Abdul Wahab Asif, Zeeshan Fatima Armeen, Israr Ahmed Qureshi Associate Professor, Nizam Institute of Engineering
More information