COMPARATIVE STUDIES ON SENSITIVITY OF DIGOXIGENIN LABELLED PROBES AND DETECTION SYSTEMS CONFIRMING REPLICATION OF CDV IN VERO CELLS

Transcription

1 Bull. Vet. Inst. Pulawy 47, 3-8, 2003 COMPARATIVE STUDIES ON SENSITIVITY OF DIGOXIGENIN LABELLED PROBES AND DETECTION SYSTEMS CONFIRMING REPLICATION OF CDV IN VERO CELLS ARTUR RZEŻUTKA AND BEATA MIZAK Department of Carnivores and Fur Animal Diseases, National Veterinary Research Institute, Pulawy, Poland Received for publication November 20, Comparison of sensitivity of digoxigenin-labelled molecular probes and the selection of the best method of detection systems of canine distemper virus (CDV) in tissue culture was the aim of the presented studies. The following probes were used: PCR (polymerase chain reaction) product of 429 bp labelled with digoxigenin by random priming method; PCR product of 429 bp labelled with digoxigenin dutp by PCR and oligonucleotide probe of 35 bp labelled with digoxigenin at 3 end. The most efficient method of preparation of molecular probes was PCR, enabling to obtain 15 ng of the probe/µl of the reaction mixture. Sensitivity of hybridization reaction in connection with colorimetric detection of genetic material of Onderstepoort strain of CDV (CDV-OND), replicated in Vero cells was estimated as 1 TCID 50 (50% tissue culture infectious dose) for oligonucleotide probe and 0.01 TCID 50 for DNA probe. The obtained results confirm the fact that described, non radioactive method of labelling the probes may be an alternative to the hot probes, application of which is limited by various factors. Key words: distemper virus, probes, hybridization, chemiluminescence. A variety of clinical symptoms of distemper in dogs makes its clinical diagnosis difficult. Other infectious viral diseases of dogs also manifest clinical signs of upper respiratory and gastro-intestinal tract or central nervous system unabling the proper diagnosis of distemper. In such cases clinical diagnosis should be confirmed by virological examinations. First attempts to apply the molecular probe in dot blot and in situ hybridization and for detection of nucleocapsid protein gene of canine distemper virus (CDV) in infected African green monkey kidney cells (Vero) and mink lung cells were described in 1986 (8). These techniques confirming the presence of viral RNA in dog tissues have been previously used (6). Hybridization was more commonly applied in studies on morbilliviruses in 90s. DNA and RNA radiolabeled probes were frequently used on account of their higher sensitivity than probes labelled with digoxigenin or biotin, but they required special laboratory conditions.

2 4 Comparison of the sensitivity of digoxigenin-labelled molecular probes and the selection of the best method of detection systems of canine distemper virus in tissue culture was the aim of the presented studies. Material and Methods Reference strains of distemper virus. Two reference strains of CDV were used in the studies: Onderstepoort (CDV-OND) and Lederle (CDV-LED) replicated in Vero cells. The TCID 50 of CDV-OND estimated by Reed - Muench s method (4) was equal to 3.0 log and TCID 50 of CDV-LED log. Onderstepoort strain was kindly provided by Prof. Max Appel from James A. Baker Institute for Animal Health, Cornell University, USA while Lederle strain was obtained from the Biowet Pulawy strain collection. Molecular probes used in the studies. The probes were prepared on the basis of the 429 bp PCR product, which was obtained as a result of amplification of the fragment of phosphoprotein gene of CDV-LED (9). The PCR product was purified with the use of Gene Clean II set (BIO 101 Inc., La Jolla, CA). The following probes were used in the studies: 1) PCR product of 429 bp labelled with digoxigenin by random priming method; 2) PCR product of 429 bp labelled with digoxigenin dutp in PCR; 3) oligonucleotide of 35 bp with the following sequence: 5 -TTCTTGCGAAGATTA TTCCGAAGGAAATGCTTCAT (Dig)-3 elaborated on the basis of the nucleotide sequence of P gene of Onderstepoort strain (Gene Bank X 51869) labelled with digoxigenin at 3 end (GenSet S.A., France). For labelling the probe by random priming method 2 µg of DNA (purified PCR product) was used. Labelling the nucleotide mixture containing digoxigenin dutp was done with the use of DIG DNA Labelling Kit (Boehringer Mannheim, GmbH, Germany). The method of labelling the probe in PCR was described earlier (9). Evaluation of the concentration of the probes in hybridization. Evaluation of the concentration of DNA labelled with Dig-dUTP by random priming method and PCR technique was done on the basis of intensity of the signal on the nylon membrane after immunoenzymatic detection with the use of control DNA contained in the Kit (Boehringer Mannheim, GmbH, Germany). Optimalization of hybridization conditions. Ten - fold dilutions (from 1000 TCID 50 to TCI D 50 ) of Vero cells infected with CDV-OND were digested with proteinase K (Sigma-Aldrich Chemie, GmbH, Germany) in presence of PK buffer. After extraction of viral RNA, RT-PCR and Southern transfer was done according to the method described earlier by Rzeżutka and Mizak (9). Nylon membrane (Hybond TM - N, Amersham International plc, UK) was prehybridized in the hybridization oven Compact Line OV 4 (Biometra a Whatman company, Germany) in a volume of 10 ml of a buffer containing: 6x SSC, 5x Denhardt s, 1 per cent SDS, 20 mm NaPO 4 ph 7.0, 5 mm EDTA, for 1.5 h at 60 C for oligonucleotide probe and at 68 C for DNA probe. The buffer was replaced by a fresh one containing the denatured probe at the concentration ranging from 10 to 50 ng/ml of the buffer for oligonucleotide probe and ng/ml for the probe labeled in PCR. The hybridization buffer was used in a volume of 6 ml for 50 cm 2 of the membrane. Hybridization was carried out overnight at the temperature of prehybridization adequate for each probe. After hybridization the membrane was washed in the 2x SSC solution at room temperature for 5 min and then

3 5 twice, first at 60 C and then at 65 C in a buffer containing: 2 x SSC, 1 per cent SDS and x SSC, 0.5 per cent SDS for 15 min. For DNA probe labelled in PCR the washing step was done with the use of the same buffers, at 68 C, increasing the time of washing up to 20 min. Colorimetric detection and chemiluminescence. Colorimetric detection of DNA hybrids was done with the use of DIG DNA Labeling and Detection Kit (Boehringer Mannheim, GmbH, Germany). Detection of DNA hybrids by chemiluminescence method was performed with the substrate CDP-Star (Roche Diagnostics GmbH, Mannheim, Germany). All test procedures and buffer preparations were carried out according to the instructions of the manufacturer. The light with the wave lenght of 422 nm emitted as a result of desintegration of the substrate was registered on the X-ray film XS-1 (Foton, Poland), during 1-10 min exposition. Results The positive signal for DNA labelling by random priming method was obtained in dilution containing 0.25 pg of labelled probe in 1 µl of reaction mixture. PCR proved to be the most efficient method of preparation of molecular probes, enabling to obtain 15 ng of the probe/µl of the reaction mixture. The concentration of elaborated oligonucleotide probe was equal to 100 ng/µl (concentration estimated by the Producer). Considering the low concentration of the probe labelled by random priming method (5 pg/20 µl of reaction mixture), it was not used for the further studies in which two other probes were tested. The optimal concentration of the probes estimated in hybridization reaction was equal to ng/ml of the buffer for the probe labelled in PCR and 30 ng/ml of the buffer for oligonucleotide probe. Specificity of the probes was tested in hybridization reaction with the change of membrane washing conditions enabling to obtain optimal parameters of the reaction and high homology of formed hybrid molecules. In case of oligonucleotide probe, the strongest and specific signal after the colorimetric detection was demonstrated when the final washing step of the membrane was done in a buffer containing: 0.5 x SSC, 0.5% SDS at 63 C for 15 min. For DNA probe the final washing step was carried out under different conditions than in case of oligonucleotide probe - the washing buffer contained 0.1 x SSC and 0.5% SDS. As demonstrated on Figs 1A and 1B, the sensitivity of hybridization reaction in connection with colorimetric detection of genetic material of CDV-OND strain was estimated as 1 TCID 50 for oligonucleotide probe and 0.01 TCID 50 for DNA probe. Application of the DNA probe and a more efficient chemiluminescence based detection system allowed us to achieve the level of sensitivity of TCID 50 (Fig 2).

4 TCID TCID 50 A B 6 Fig. 1. Evaluation of the sensitivity of hybridization. A - colorimetric detection of genetic material of CDV-OND strain replicated in Vero cells with the use of oligonucleotide probe, B - colorimetric detection of genetic material of CDV-OND with the use of the probe labelled in PCR.

5 TCID 50 Fig. 2. Evaluation of the sensitivity of hybridization with the use of the probe labelled in PCR and chemiluminescence detection of genetic material of CDV-OND strain. Discussion Slot blot hybridization for detection of nucleic acids of distemper virus in biological samples collected from seals applied earlier proved to be rapid and simple method but not sensitive enough to be used for routine diagnosis (2). These findings were also confirmed by other authors (6, 8) who used in situ hybridization and dot blot for the detection of distemper virus in infected tissue cultures. The sensitivity of immunofluorescence test was estimated as 70% in comparison with hybridization (90%). Previous studies described dot blot hybridization with the use of cdna probes labelled with radioactive phosphorus ( 32 P) for diagnosis of morbillivirus infections. They were complementary to N, P and F genes of viruses. Prepared probes reacted only with RNA specific for defined morbillivirus (5). The combination of PCR with hybridization for detection of genetic material of distemper virus in tissues collected from seals after experimental or natural infection proved to be very sensitive diagnostic method. The cdna probe labelled with ( 32 P) prepared on the basis of the nucleotide sequence of P gene was also used in the experiments of Haas et al. (2). Previous studies on the application of different molecular probes: RNA, DNA and oligonucleotide probe labelled with digoxigenin in in situ hybridization for the detection of N gene of distemper virus in infected tissue cultures and tissues of dead animals demonstrated that all probes used enabled to confirm the presence of the virus in infected Vero cells (1). The highest sensitivity was obtained when RNA and DNA probes were used in the studies. The RNA probe labelled with digoxigenin was also used by Nesseler et al. (7) for the detection of N gene of CDV. In our studies three probes labelled with digoxigenin were used for the detection of CDV-OND in inoculated Vero cells. The highest sensitivity of the hybrydization was demonstrated when the probe labelled in PCR was used. The

6 8 optimal concentration of DNA probe was equal to ng/ml of the hybridization buffer. Similar concentrations of DNA probe in hybridization reaction were recommended by Kriegler (3). Minimal detected titre of distemper virus in infected tissue culture evaluated in hybridization reaction was equal to 0.01 TCID 50. This method enabled 100-fold increase in the sensitivity of the detection of genetic material of CDV in comparison with RT-PCR. The TCID 50 value determined by this test was estimated as 1.0. The change of the method of the detection of DNA hybrids immobilized on nylon membrane, from colorimetric to chemiluminescence, enabled additional 10-fold increase in the sensitivity of the method (0.001 TCID 50 ). The obtained results confirm the fact that the described, non radioactive method of labelling the probes may be an alternative to the hot probes, the application of which is limited by various factors. Acknowledgments: We thank Prof. Max Appel (James A. Baker Institute for Animal Health, Cornell University, USA) for providing the reference virus strain. References 1. Gaedke K., Zurbriggen A., Baumgärtner W.: In vivo and in vitro detection of canine distemper virus nucleoprotein gene with digoxigenin-labeled RNA, doublestranded DNA probes and oligonucleotides by in situ hybridization. J. Vet. Med. B, 1997, 44, Haas L., Subbarao S.M., Harder T., Liess B., Barrett T.: Detection of phocid distemper virus RNA in seal tissues using slot hybridization and the polymerase chain reaction amplification assay: genetic evidence that the virus is distinct from canine distemper virus. J. Gen. Virol., 1991, 72, Kriegler M.: Assays for gene transfer and expression. In: Gene transfer and expression: a laboratory manual. Freeman WH and Company, New York, 1990, pp Larski Z.: Ilościowe badania izolowanego wirusa. In: Diagnostyka wirusologiczna chorób zwierząt. PWR i L, Warszawa, 1977, pp Mahy B.W.J., Barrett T., Evans S., Anderson E.C., Bostock C.J.: Characterization of a seal morbillivirus. Nature, 1988, 336, Mitchell W.J., Russell S.E.H., Clark D.K., Rima B.K., Appel M.J.: Identification of negative strand and positive strand RNA of canine distemper virus in animal tissue using single stranded RNA probes. J. Virol. Methods, 1987, 18, Nesseler A., Baumgärtner W., Gaedke K., Zurbriggen A.: Abundant expression of viral nucleoprotein mrna and restricted translation of the corresponding viral protein in inclusion body polioencephalitis of canine distemper. J. Comp. Pathology, 1997, 116, Oglesbee M., Jackwood D., Perrine K., Axthelm M., Krakowka S., Rice J.: In vitro detection of canine distemper virus nucleic acid with a virus specific cdna probe by dot-blot and in situ hybridization. J. Virol. Methods, 1986, 14, Rzeżutka A., Mizak B.: Application of N-PCR for diagnosis of distemper in dogs and fur animals. Vet. Microbiol., 2002, 88,