Supplementary Figure 1

Size: px

Start display at page:

Download "Supplementary Figure 1"

Timothy George
6 years ago
Views:

Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested.

1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use TRMPV- Neo (Genbank HQ456315), which is selectable with G418. TRMPV-ns (no selection, Genbank HQ456316) is a simplified backbone that lacks a drug-selectable marker. TRMPV-Hygro (Genbank HQ456314) is Hygromycin-selectable. TtTMPV-Neo (Genbank HQ456319) features a TurboRFP reporter (Evrogen) and an optimized TRE promoter (TREtight) 1,2, which reduces leakiness in the absence of dox resulting from basal TRE activity by ~40-fold 3, while retaining strong expression levels comparable to conventional TRE in the induced state. This vector variant is particularly recommended whenever leaky shrna expression presents a concern, or when cells are transduced at high MOI - a setting that is generally associated with increased leaky expression levels (data not shown). TRMPVIR (Genbank HQ456317) enforces rtta expression in a single vector as described in Fig. 1e-g, and TtRMPVIR (Genbank HQ456318) is the TREtight version of TRMPVIR. All vectors are constructed in the pqcxix self-inactivating (SIN) retroviral backbone. Unique restriction sites for shrna cloning and reporter exchange are indicated.

Supplementary Figure 2 Supplementary Figure 2: Quantification of Renilla Luciferase and Rpa3 shrna potency; testing of reversibility and re-inducibility of

2 Supplementary Figure 2 Supplementary Figure 2: Quantification of Renilla Luciferase and Rpa3 shrna potency; testing of reversibility and re-inducibility of TRMPV-based shrna expression. (a) Luciferase activity in NIH3T3 cells that stably express Renilla Luciferase (parental) and different shrnas targeting Renilla or a

3 control shrna (Trp ). Stable NIH3T3-Renilla luciferase cells were transduced with LMP retroviruses containing each shrna, selected for one week and luminescence measured in whole cell protein extract. (b) Relative luciferase activity in shren.713 transgenic embryonic stem (ES) cells. ES cell clones containing dox-inducible shren.713 were transduced with a retrovirus that expresses Renilla luciferase and treated with or without dox for 4 days. Dox-dependent shrna induction caused a 10-fold reduction in Renilla luciferase activity. Error bars represent the s.e.m., n=5. (c) Quantification of Rpa3 immunoblot (see Fig. 1b). Rpa3 band intensities were quantified using ImageJ software according to method 1 outlined at (gray bars), and normalized to β-actin bands from the same gel (black bars). (d) Uncropped images of immunoblots shown in Fig. 1b. (e) Representative flow cytometry plots of immortalized Rosa26-rtTA- M2 MEFs transduced with TRMPV. Cells were maintained under selection, and cultured in dox for 3 days, then in the absence of dox for 6 days, then again in dox for 3 days. shren cultures show that dsred expression can be quickly reversed and subsequently re-induced when a neutral shrna is expressed. shrpa3 cultures show reversibility in a subset of cells, though a rapid selection for cells that fail to induce the TRE (Venus + dsred - ) or both reporters (Venus - dsred - ) also occurs.

4 Supplementary Figure 3 Supplementary Figure 3: Characterization of Tet-On MLL-AF9;Nras G12D induced leukemia. (a) Schematic of retroviral vectors and experimental strategies used to generate a Tet-On competent, bioluminescent mouse model of AML. (b) Bioluminescence imaging of recipient mice 15 days after transplantation of HSPCs transduced with MSCV-Luciferase-IRES-Nras G12D alone or in combination with MSCV-rtTA3-IRES-MLL-AF9. (c) Kaplan-Meier survival curve of syngeneic recipient mice of HSPC transduced with MSCV-rtTA3-IRES-MLL-AF9 and/or MSCV-Luciferase-IRES-Nras G12D. (d) May- Grünwald-Giemsa-stained peripheral blood smears showing typical morphology of MLL-AF9;Nras G12D AML at an advanced stage. Original magnification 100x (top) and 500x (bottom). (e) Representative immunophenotyping of MLL-AF9;Nras G12D AML. Overall, disease generated with rtta-linked vectors showed no difference in disease penetrance, latency or phenotype compared to similar AML models driven by vectors lacking rtta3 4, suggesting that expression of rtta3 does not influence disease biology.

5 Supplementary Figure 4 Supplementary Figure 4: Competitive proliferation assays in Tet-On MLL-AF9;Nras G12D AML. (a) Quantification of shrna-expressing (Venus + dsred + ) cells in competitive proliferation assays of Tet-On competent MLL-AF9;Nras G12D AML. Leukemia cells were transduced with indicated TRMPV shrnas, drug selected, mixed with untranduced cells, and passaged in media containing dox for 12 days. Venus + dsred + cells were quantified each day starting the first day after dox treatment. Each series of bars represents day 1 to day 12 from left to right. Rpa3 shrna-expressing AML cells are depleted over time. Both the kinetics and the level of depletion correlate with Rpa3 shrna potency (see also Fig. 1b, Supplementary Fig. 2c). (b) Representative flow cytometry plots of competitive proliferation assays in (a) 10 days after dox-induction of indicated shrnas. Note the outgrowth of Venus + dsred - cells that evade expression of Rpa3 shrnas.

6 Supplementary Figure 5 Supplementary Figure 5: TRMPV clones exhibit dramatic differences in TRE induction in response to dox. (a) Representative flow cytometry histograms showing distribution of Venus fluorescence in bulk and clonal MLL-AF9;Nras G12D AML cells transduced with TRMPV.shRpa Clonal populations were derived through expansion after limiting dilution and show homogeneous Venus levels, likely due to expression from the same proviral genomic integration site. (b) Flow cytometry plots of bulk and clonal populations in competitive proliferation assays. The cell populations in (a) were mixed 1:1 with untransduced cells and passaged in the presence/absence of dox for 3 days. On dox (lower panel), the bulk transduced population shows heterogeneous TRE induction and depletion relative to untransduced (double-negative) cells. Clone 1 shows strong homogeneous TRE induction on dox, and rapid depletion, while clone 4 does not respond to dox treatment. (c) Spleen histology of untreated and dox-treated mice 4 days after start of treatment. Mice were transplanted with clonal MLL-AF9;Nras G12D AML harboring TRMPV.shRpa3.455 and treated with/without dox at disease onset. Scale bar: 50 μm.

7 Supplementary Figure 6 Supplementary Figure 6: Estimation of average retroviral integration numbers in MLL-AF9; Nras G12D AML cells. Cells were co-transduced with a green (MSCV-GFP) and a red (MSCV-dsRed) fluorescence-tagged retrovirus to estimate multiplicity of infection (MOI) at different overall infection efficiencies. (a) Representative flow cytometry plots of transduced AML cells. Left panel (high MOI): In conditions where 44% of cells receive at least one retrovirus, a large proportion is GFP + dsred + indicating that they harbor >1 retroviral integration. Right panel (low MOI): In conditions where 5% of cells are transduced, a small proportion is GFP + dsred + double positive. Given percentages indicate frequencies of GFP +, dsred + and GFP + dsred + cells in all transduced cells. (b) Estimation of cells harboring a single retrovirus relative to overall transduction efficiency. We assumed that at least one third of cells harboring multiple integration events are GFP + dsred +, since two integrations of MSCV-GFP or two integrations of MSCV-dsRed can also occur. Therefore, the frequency of cells with a single integration among all infected cells was calculated as 100% - 3*(% GFP + dsred + ).

8 Supplementary Figure 7 Supplementary Figure 7: Pooled negative selection RNAi screening in vivo - library representation in individual mice and comparison of untreated and dox-treated mice. (a) Scatter plots of normalized reads per shrna in T0 (prior to transplantation) compared to individual untreated mice (off dox mouse 1-

9 3), or to the average of untreated mice (off dox mean). Blue dots represent examples of shrnas detected as positively selected in the offdox mean. Typically, such outliers are enriched in only one of the individual mice, suggesting that they represent stochastic clonal events during disease engraftment and progression. Red and green dots represent Rpa3 and Ren control shrnas. r, nonparametric (Spearman) correlation coefficient. (b) Scatter plots of normalized reads per shrna in T0 (prior to transplantation) compared to individual dox-treated mice (ondox mouse 1-3), or the average of dox-treated mice (ondox mean). Red and green dots represent Rpa3 and Ren control shrnas. r, nonparametric (Spearman) correlation coefficient. (c) Relative abundance of all 824 shrnas in Venus + dsred + -sorted leukemia cells from dox-treated mice compared to untreated mice. The means of normalized reads in dox-treated mice (n=3) was divided by the mean in untreated mice (n=3); shrnas are plotted according to the resulting ratios in ascending order. All three shrnas targeting Rpa3 are among the 25 most depleted shrnas, while neutral shren.713 is not altered.

10 Supplementary Figure 8 Supplementary Figure 8: FACS purification of shrna expressing cells in TRMPV-based pooled shrna screening. Representative flow cytometry profiles of bone marrow and spleen cells (1:1 mix) from moribund untreated (off dox) and dox-treated (on dox) recipient mice of MLL-AF9;Nras G12D AML transduced with a complex TRMPV-shRNA library (824 shrnas). Gates for quantifying Venus + dsred - and Venus + dsred + cells are shown; the Venus + dsred + gate was used for sorting. Both axes are on a biexponential log scale.

11 Supplementary Table 2 Rpa3.53 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCGCCAGCATGTTACCACAGTATAGTGAAGCCACAGATGTA TACTGTGGTAACATGCTGGCGTTGCCTACTGCCTCGGAATTC Rpa3.276 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCAAGGAAGATACTAATCGCTTTTAGTGAAGCCACAGATGTAA AAGCGATTAGTATCTTCCTTATGCCTACTGCCTCGGAATTC Rpa3.429 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCAAGGAAGACTCCTGCAGTTTATAGTGAAGCCACAGATGTAT AAACTGCAGGAGTCTTCCTTATGCCTACTGCCTCGGAATTC Rpa3.455 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCGCGACTCCTATAATTTCTAATTAGTGAAGCCACAGATGTAA TTAGAAATTATAGGAGTCGCTTGCCTACTGCCTCGGAATTC Rpa3.561 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCAAAAGTGATACTTCAATATATTAGTGAAGCCACAGATGTAA TATATTGAAGTATCACTTTTATGCCTACTGCCTCGGAATTC Ren.27 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGAAACAAAGGAAACGGATGATAATAGTGAAGCCACAGATGTA TTATCATCCGTTTCCTTTGTTCTGCCTACTGCCTCGGAATTC Ren.660 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGACTCGTGAAATCCCGTTAGTAATAGTGAAGCCACAGATGTAT TACTAACGGGATTTCACGAGGTGCCTACTGCCTCGGAATTC Ren.702 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGATACAAATTGTTAGGAATTATATAGTGAAGCCACAGATGTAT ATAATTCCTAACAATTTGTACTGCCTACTGCCTCGGAATTC Ren.713 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTAT AGATAAGCATTATAATTCCTATGCCTACTGCCTCGGAATTC Ren.826 CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCTACTGAATTTGTCAAAGTAAATAGTGAAGCCACAGATGTAT TTACTTTGACAAATTCAGTATTGCCTACTGCCTCGGAATTC Supplementary Table 2: Sequences of shrnas. 116 nt XhoI/EcoRI mir30-shrna fragments are provided. shrnas were designated by the number of the first nucleotide of the 22-nt target site in the mrna transcript at the time of design.

12 Supplementary references 1. Sipo, I. et al. An improved Tet-On regulatable FasL-adenovirus vector system for lung cancer therapy. J Mol Med 84, (2006). 2. Agha-Mohammadi, S. et al. Second-generation tetracycline-regulatable promoter: repositioned tet operator elements optimize transactivator synergy while shorter minimal promoter offers tight basal leakiness. J Gene Med 6, (2004). 3. Clontech Gene Expression Systems. Clontechniques XVIII, 1 (2003). 4. Zuber, J. et al. Mouse models of human AML accurately predict chemotherapy response. Genes Dev 23, (2009).

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Negative selection analysis of sgrnas targeting all Brd4 exons comparing day 2 to day 10 time points. Systematic evaluation of 64 Brd4 sgrnas in negative selection experiments, targeting