Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050

Transcription

1 Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050 Greg Gocal, Ph.D., Senior Vice President, Research and Development CRISPR Precision Gene Editing Congress Boston, MA February 24,

2 Mission To be leaders in the development of a sustainable global non-transgenic food supply 2.

3 Cibus Corporate Overview Cibus is a privately owned biotechnology company with ~100 employees located in San Diego and Minneapolis (US) and Kapelle (The Netherlands) Cibus is primarily focused on the development of improved characteristics for crop plants through the application of non-transgenic precision gene editing technology Nucelis, an independent operating unit of Cibus, applies the same technology to develop improved fermentation and bio-based products. Cibus activities are funded through a combination of equity contributions and project partnerships Cibus Laboratories, San Diego, California 3.

4 Converging Technologies Creating a New Era in Agriculture Genomics, Gene Editing & Cell Culture Transgenic Era Started in 1980 s Transgenic Insertions (GMO Technology) New Era Started in 2000 s Advanced Breeding (Non-transgenic) Hectares (Million) In Agriculture Total Addressable Market (TAM) is estimated at 4B Acres (1.6B Hectares) Transgenic technologies valued at $40B yet have reached only 11% of the global TAM ~ 430M Acres /175M Hectares Source: ISAAA 4.

5 Converging Technologies Have Enabled a New Non-Transgenic Industry Cell Culture 5. Non-Transgenic Technology Path

6 RTDS GRON Explained Creating a Change GRON DNA Strand 1 A Gene Repair Oligonucleotide (GRON) is paired with the plant DNA sequence. The pairing only occurs at the gene target region. 2 The GRON creates a mismatch with the plant DNA sequence. Enzyme 3 The plant s native DNA repair enzymes recognize the mismatch and repair the plant s DNA using the GRON as a template. 4 Following the repair, the GRON is removed and the cell digests the GRON. This is all part of the natural process of cell division and multiplication. 5 RTDS is complete and the targeted gene has been repaired. 6.

7 What is the Rapid Trait Development System? RTDS (Rapid Trait Development System) is a precision gene editing platform Non-transgenic gene conversion platform Highly precise, site-specific gene editing Only the targeted base pair is changed Does not leave behind foreign DNA Works with the cell s natural DNA repair Oligonucleotide-directed mutagenesis Successfully applied to multiple organisms Recent technical advances have seen a 70-fold increases in efficiency. 7.

8 Gene Editing with Nucleases Types of Nucleases with Varying Precision Meganuclease Zinc-Finger TALEN CRISPR-Cas9 *Adapted from: The Boston Consulting Group Sep

9 DNA Double-Strand Break (DSB) Repair DNA DOUBLE STRAND BREAKER (Antibiotics, Meganucleases, ZFNs, TALENs and CRISPRs) DSB GENE DISRUPTION NHEJ GRON NO GENE CORRECTION Conversion GRON YES GENE ADDITION Transgene Sister Chromatid GRONs enable precise sequence changes 9.

10 Precision Genome Editing in Flax GRONs and CRISPR/Cas9 were used to develop an herbicide tolerance trait in Linum usitatissimun (flax) by precisely editing the 5 -enolpyruvylshikimate-3- phosphate synthase (EPSPS) genes. 10.

11 Glyphosate Tolerance Utilizing EPSPS Gene EPSPS 11.

12 Cell Biology in Flax Protoplasts Microcalli Calli Shoots Stage 1 (Single cell) Stage 2 ( cells) Stage 3 Stage 4 Delivery Division Calli Growth Regeneration 12.

13 Gene Editing Frequency Determined by NGS Frequency of precise edits and indel scars as determined by deep sequencing in three independent flax EPSPS editing experiments Stage 2 Stage 3 Exp # Targeted Mutation Frequency (%) Indel Mutations (%) # of Calli Screened # of Calli with Targeted Mutations (0.15%) (0.08%) NA NA 13.

14 Sequence Confirmation of Targeted Mutations Callus with precise edits Regenerated plant in soil Sequence confirmation 14.

15 Targeted EPSPS Edits Provide Glyphosate Tolerance 15.

16 Segregation Analysis of C1 Plants Targeted mutations show the expected 1:2:1 Mendelian inheritance in the C1 generation Genotype EPSPS Gene 2 Plant ID wt Heterozygous Homozygous

17 No Mutations Detected at Potential Off Target Sites Off-target ID Sequence # of mismatches Mutations Detected Off 1 ccggttacagcagcagtcggcgg 5 Off 2 ccggttacagcagcagtcggcgg 5 Off 3 tcaaaagctgcagctatcagtgg 9 Off 4 tcaaaatctgcagctgtcagtgg 8 Off 5 tcaaaatctgcggctgtcagtgg 9 Off 6 tcaaaatctgcggctgtcagtgg 9 Off 7 aaggacacagcagctgtcggtgg 7 Off 8 accaaacgagcagctgtcagagg 8 On GCTGTTACAGCAGCTGTCAGCGG 0 + Bases in red are mismatches with the On-target sequence Analysis performed by amplicon deep sequencing 17.

18 No Integration of Plasmid in Converted Flax Plants C 0 plants derived from callus A23 were analyzed for plasmid integration by PCR Four sets of primer pairs each amplifying a different region of the plasmid were used A23 Plant 1 Plant 2 Plant 3 Plant 4 Plant 5 wt plant Plasmid Plasmid integration was not detected in any of the regenerated plants 18.

19 Conclusions Precise targeted mutations were made in each flax EPSPS locus Isolated calli, with targeted mutations, were identified using molecular screening alone Plants were regenerated from calli with the targeted mutations No unintended effects were observed The flax RTDS platform is primed for developing additional traits 19.

20 Thank you. More information about RTDS and the Cibus Team are presented at 20.