CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)

Transcription

1 Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression of grna for mammalian gene modification studies using CRISPR/Cas9 technology in vivo or in vitro. A user-defined sgrna is cloned to downstream of a human U6 promoter. To construct the vector, you must construct pgl3-u6 sgrna-puro with your guide sequence. The U6-gRMA sequence is obtained by PCR, and the PCR production is cloned into the prelinearized vector using the included high-efficiency ligation mix and competent cells. In the presence of the Cas9 endonuclease, sgrna can recognize the targeted DNA sequence and guide Cas9 nuclease during genome editing for gene knockout, knockin, mutagenesis, and more. Reagents Plasmids: pgl3-u6 sgrna-puro and lenti-u6 sgrna-ef1 -Puro Bsa I (NEB, R0535S) Solution I (TaKaRa, 6022Q) Sal1 (NEB #R3138) Cla1 NEB # (R0197) PrimeSTAR HS DNA Polymerase (Takara, DR010A) T4 DNA Ligase (NEB #M0202) PCR Cleanup Kit (Axygen, AP-PCR-50) Equipment Centrifuge (RT and 4 C) Vortex One Drop OD Spectrophotometer Thermocycler Thermomixer Water bath (37 C, 42 C and 58 C) Procedure I. Construction of pgl3-u6 sgrna-puro expression vector 1. Design of paired sgrna oligos.

2 Select paired sgrnas in a tail-to-tail orientation and separated by bp, which have the sequence 5 -CCN (52-72) GG. All possible paired sites for mouse and human exons are available on the website ( For each sgrna, the 5 - GGN (19) GG motif is preferred, however, 5 -GN (20) GG or 5 -N (21) GG are also satisfactory. BLAT or BLAST the sgrna target sites in UCSC or ENSEMBL genome browsers to find those with few or no highly related sites in the genome. Figure 1. Example of cloning a target sequence using the CRISPR/Cas9 System 2. Annealing oligos prior to cloning. 4.5 µl Top oligo (100 µm) 4.5 µl Bottom oligo (100 µm) 1 µl NEB buffer 2 Annealing oligos using a thermocycler with the following program: 95 C, 5 min; C at 2 C /s; C at 0.1 C /s; hold at 4 C. 3. Preparation of pgl3-u6 sgrna-puro plasmid. 2 µg pgl3-u6 sgrna-puro

3 1 µl BsaI Purify the digestion product using MinElute PCR Purification Kit. 4. Ligation of annealed oligos with BsaI-digested pgl3-u6 sgrna-puro 2 µl annealed oligos 1 µl (25 ng/ µl) digested pgl3-u6 sgrna-puro 3 µl 2 x Solution I Incubate at 16 C for 60 min 5. Transformation and plate on Amp+ plate (100 μg/ml). 6. Confirm correct insertion of sgrna oligos by sequencing using the following primer. Assembly-For: cgattagtgaacggatctcgacg 7. Mini-prep pgl3-u6 sgrna-puro plasmid using Axygen Miniprep Kit. II. Cloning U6-sgRNA into the lenti-u6 sgrna-ef1 -Puro vector 1. Amplification of U6-sgRNA fragment using the following primers, reaction and program from pgl3-u6 sgrna-puro Primer For: GAAATCGATCTCGAGCGGCCGCCCCCTTCA Primer Rev: GAAGTCGACCCATTTGTCTCGAGGTCGAGAATT PCR Reaction Mixture (50 μl) Component Amount (μl) 5X PrimeSTAR Buffer (Mg 2+ plus) 10 dntp Mixture (2.5 mm each) 4 Primer For (10 μm each) 0.5 Primer Rev (10 μm each) 0.5 pgl3-u6 sgrna-puro 1 ng PrimeSTAR HS DNA Polymerase 0.3 Sterilized Distilled Water Up to 50 μl Program: 95 C, 5 min; 95 C, 30 s, 60 C, 30 s, 72 C, 30 s, 30 cycles; 72 C, 5 min; hold at 16 C. 2. Purification of the PCR production and digestion using Cla1 and Sal1 restriction Enzyme Purify the PCR product using Axygen PCR Purification Kit. Digest PCR production as following reaction: PCR production

4 2 µl Cla1 2 µl Sal1 Purify the digestion product using Axygen PCR Purification Kit. 3. Digestion of lenti-u6 sgrna-ef1 -Puro using Cla1 and Sal1 restriction Enzyme 2 µg lenti-u6 sgrna-ef1 -Puro 1 µl Cla1 1 µl Sal1 Purify the digestion product using Axygen PCR Purification Kit. 4. Ligation of Cla1 and Sal1-digested PCR production with Cla1 and Sal1-digested lenti-u6 sgrna-ef1 -Puro Component Amount (μl) Cla1 and Sal1-digested PCR production 50 ng Cla1 and Sal1-digested lenti-u6 sgrna-ef1 -Puro 150 ng T4 ligation buffer, 10 1 T4 ligase 1 H 2 O Up to 10 Incubate at 16 C for 3 h 5. Transformation and plate on Amp+ plate (100 μg/ml). 6. Confirm correct insertion of U6-sgRNA by sequencing using the following primer. Lenti-U6 sgrna-seq: ggacccgacaggcccgaagg 7. Mini-prep lenti-u6 sgrna-ef1 -Puro vector using Axygen Miniprep Kit. Related Products EGFP expression control vector AAV-CMV-EGFP (Catalog number: CTG-CAS9-010) EGFP grna expression vector AAV-U6-EGFP sgrna(catalog number: CTG-CAS9-13) Lenti-U6-EGFP sgrna-ef1a-puro(catalog number: CTG-CAS9-14) pgl3-u6-egfp-sgrna-puro(catalog number: CTG-CAS9-15) Cas9 nuclease expression vector Lenti-CMV-Cas9-P2A-Puro (Catalog number: CTG-CAS9-02)

5 Lenti-EF1a-Cas9-P2A-Puro (Catalog number: CTG-CAS9-05) Lenti-EFS-Cas9-P2A-Puro (Catalog number: CTG-CAS9-06) Lenti-sFFV-Cas9-P2A-Puro (Catalog number: CTG-CAS9-07) pst1374-n-nls-flag-cas9-egfp (Catalog number: CTG-CAS9-08) AAV-mMecp2-Cas9 (Catalog number: CTG-CAS9-09) AAV-TRE-Cas9(Catalog number: CTG-CAS9-16) grna transcription vector in vitro pst1374-n-nls-flag-cas9 (Catalog Number: CTG-CAS9-01) puc57-t7 sgrna-kan (Catalog number: CTG-CAS9-04) grna expression vector pgl3-u6 sgrna-puro( Catalog number: CTG-CAS9-03) Lenti-U6 sgrna-ef1a-puro(catalog number: CTG-CAS9-11) AAV-U6 sgrna-egfp(catalog number: CTG-CAS9-12) AAV-CMV-EGFP-P2A-tTA3g-U6 sgrna(catalog number: CTG-CAS9-17) All-in-one Cas9 and grna expression vector Lenti-EF1a-Cas9-EGFP-U6 sgrna(catalog number: CTG-CAS9-18) PB-TRE-NLS-linker-Cas9-IRES-hrGFP-Zeo(Catalog number: CTG-CAS9-19)