RNA Sequencing Analyses & Mapping Uncertainty

Size: px
Start display at page:

Download "RNA Sequencing Analyses & Mapping Uncertainty"

Transcription

1 RNA Sequencing Analyses & Mapping Uncertainty Adam McDermaid 1/26

2 RNA-seq Pipelines Collection of tools for analyzing raw RNA-seq data Tier 1 Quality Check Data Trimming Tier 2 Read Alignment Assembly De-novo Reference-based Tier 3 Differential Expression Analysis Functional Enrichment Analysis Quality Check (De-novo) Assembly of Transcripts Differential Expression Analysis RNA-seq Reads Read Mapping Gene Read Count Data Trimming Transcription Unit Prediction Functional Enrichment Analysis Tier 4 Clustering & Bi-clustering Network Analyses De-novo (Bi)-Clustering Network Analysis & Modeling 2/26

3 Visualizations for Differential Gene Expression ViDGER R package Available on GitHub Visualization of Differential Gene Expression Results Cufflinks EdgeR DESeq2 Six publication-quality figures Two matrix options Currently under review in Bioinformatics 3/26

4 vsboxplot Boxplots of log-fpkm values for each condition 4/26

5 vsscatterplot log-fpkm scatterplots between two select conditions 5/26

6 vsscattermatrix Matrix option to display all pairwise scatterplot comparisons Also displays pairwise correlations and FPKM densities for each condition 6/26

7 vsdegmatrix Displays shared differentially expressed genes for each pairwise comparison 7/26

8 vsmaplot Pairwise display of log fold change compared with mean expression values Colored data points indicate significant p- values and differential expression 8/26

9 vsvolcano Pairwise display of log fold change compared with negative log p-value 9/26

10 vsvolcanomatrix Matrix option for all pairwise Volcano plots 10/26

11 vsfourway Conditional comparison relative to chosen sample (control) 11/26

12 Current Pipeline Issues Pipeline tools are not optimal Read Alignment Ambiguous Reads All downstream analyses and results are affected Quality Check (De-novo) Assembly of Transcripts RNA-seq Reads Read Mapping Gene Read Count Data Trimming Transcription Unit Prediction Differential Expression Analysis Functional Enrichment Analysis De-novo (Bi)-Clustering Network Analysis & Modeling 12/26

13 Mapping Uncertainty Read alignment may result in multiple possible alignment locations Reads aligned to reference genome may have multiple possible alignments Due to duplicate nature of genomes, especially in plant genomes When a read can be mapped to multiple locations, mapping uncertainty occurs 13/26

14 Mapping Uncertainty Occurrences Plants Highly duplicative nature of genome Animals Alternative splicing Metagenomics Sequencing of entire microbial communities simultaneously Identical genes across different species Similar, mutated or evolved genes 14/26

15 Mapping Uncertainty in Plants 55 RNA-seq datasets 5 Distinct species GB of data Average of 20% ambiguous data Species Uniquemapped Multimapped Unmapped Arabidopsis thaliana Diploid plants Vitis vinifera Solanum lycopersicum Solanum tuberosum Polyploid plants Triticum aestivum 77%~89% 55%~82% 49%~87% 55%~69% 62%~69% 8%~17% 10%~25% 6%~34% 18%~26% 18%~25% 2%~5% 8%~23% 5%~44% 12%~19% 9%~18% 15/26

16 Current Strategies Omission of ambiguous reads Underestimation Alignment to all possible locations Overestimation Best Match Proportionate assignment Best current approach Still over/underestimates 16/26

17 Solving Mapping Uncertainty Two step approach: Determine severity of mapping uncertainty in a given dataset Quantification using relevant factors Address issue of mapping ambiguous reads 17/26

18 Quantifying Mapping Uncertainty GeneQC Computational program collecting relevant information from datasets Interprets information in meaningful way to provide quantification of mapping uncertainty Maximum base-pair similarity between gene pairs Maximum proportion of shared reads between gene pairs Partitions genes into categorizations based on mapping uncertainty severity 18/26

19 C D GeneQC 0.5 A B C 97 19/26

20 D-score Allows for comparable metric of mapping uncertainty 0.07 Combines three statistics Maximum proportion of shared ambiguous reads Maximum base-pair similarity Number of gene pair interactions Normalized between 0 and 1 for each dataset i /26

21 D-score Higher D-score indicates more mapping uncertainty D-score increased alphabetically by categorization on average 21/26

22 Addressing Mapping Uncertainty Co-expression Modules (CEMs) Can use expression levels for known co-expressed genes (CEGs) to predict likely expression levels for the gene locations This information can be in turn used to determine which location is most likely for any particular ambiguous read Can use existing information to gain insight into the likelihood of the correct location for alignment 22/26

23 Heuristic Approach to Mapping Uncertainty Utilize Negative Binomial Distribution X i ~NB 2 xҧ i, s 2 i + xҧ i ҧ x i s i 2 + ҧ x i Read alignments follow such that read counts converge to CEM mean 23/26

24 Theoretical Approach to Mapping Uncertainty Hidden Markov Model True state is unknown Background information used for predictions CEM statistics Read alignment interactions 24/26

25 Projected Outcomes GeneQC Allow for quantification of mapping uncertainty over entire dataset Statistical Modeling Allow for re-alignment of ambiguous reads aligned to genes with high levels of mapping uncertainty Implement within R package for widespread use Improve reliability of all reference-based RNA-seq analyses 25/26

26 Acknowledgements Dr. Qin Ma Dr. Anne Fennell NSF-IOS NSF-OIA SDRIC 26/26

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD) Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your

More information

RNA-Seq Analysis. Simon Andrews, Laura v

RNA-Seq Analysis. Simon Andrews, Laura v RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 4 overview (brief) theoretical

More information

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS) RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx

More information

Introduction of RNA-Seq Analysis

Introduction of RNA-Seq Analysis Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource

More information

RNA

RNA RNA sequencing Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271 www.inouyelab.org

More information

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing

More information

Eucalyptus gene assembly

Eucalyptus gene assembly Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted

More information

Transcriptome analysis

Transcriptome analysis Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

Applications of short-read

Applications of short-read Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments

More information

Canadian Bioinforma3cs Workshops

Canadian Bioinforma3cs Workshops Canadian Bioinforma3cs Workshops www.bioinforma3cs.ca Module #: Title of Module 2 1 Module 3 Expression and Differen3al Expression (lecture) Obi Griffith & Malachi Griffith www.obigriffith.org ogriffit@genome.wustl.edu

More information

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments

More information

RNAseq Differential Gene Expression Analysis Report

RNAseq Differential Gene Expression Analysis Report RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample

More information

Sequence Analysis 2RNA-Seq

Sequence Analysis 2RNA-Seq Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological

More information

Post-assembly Data Analysis

Post-assembly Data Analysis Assembled transcriptome Post-assembly Data Analysis Quantification: the expression level of each gene in each sample DE genes: genes differentially expressed between samples Clustering/network analysis

More information

Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.

Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from

More information

1. Introduction Gene regulation Genomics and genome analyses

1. Introduction Gene regulation Genomics and genome analyses 1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing

More information

Analysis of RNA-seq Data. Bernard Pereira

Analysis of RNA-seq Data. Bernard Pereira Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental

More information

RNAseq Applications in Genome Studies. Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford

RNAseq Applications in Genome Studies. Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford RNAseq Applications in Genome Studies Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford RNAseq Protocols Next generation sequencing protocol cdna, not RNA sequencing

More information

GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment

GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment Zhaojun Zhang, Shunping Huang, Jack Wang, Xiang Zhang, Fernando Pardo

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

CBC Data Therapy. Metatranscriptomics Discussion

CBC Data Therapy. Metatranscriptomics Discussion CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu

More information

A normalization method based on variance and median adjustment for massive mrna polyadenylation data

A normalization method based on variance and median adjustment for massive mrna polyadenylation data ISSN : 0974-7435 Volume 8 Issue 4 A normalization method based on variance and median adjustment for massive mrna polyadenylation data Guoli Ji, Ying Wang, Mingchen Wu, Yangzi Zhang, Xiaohui Wu* Department

More information

Genomics and Transcriptomics of Spirodela polyrhiza

Genomics and Transcriptomics of Spirodela polyrhiza Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop

More information

measuring gene expression December 11, 2018

measuring gene expression December 11, 2018 measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and

More information

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular

More information

Parts of a standard FastQC report

Parts of a standard FastQC report FastQC FastQC, written by Simon Andrews of Babraham Bioinformatics, is a very popular tool used to provide an overview of basic quality control metrics for raw next generation sequencing data. There are

More information

RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018

RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018 RNA Sequencing: Experimental Planning and Data Analysis Nadia Atallah September 12, 2018 A Next Generation Sequencing (NGS) Refresher Became commercially available in 2005 Construction of a sequencing

More information

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)

More information

Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016

Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016 Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data

More information

SCALABLE, REPRODUCIBLE RNA-Seq

SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq Advances in the RNA sequencing workflow, from sample preparation through data analysis, are enabling deeper and more accurate exploration

More information

Analysis Datasheet Exosome RNA-seq Analysis

Analysis Datasheet Exosome RNA-seq Analysis Analysis Datasheet Exosome RNA-seq Analysis Overview RNA-seq is a high-throughput sequencing technology that provides a genome-wide assessment of the RNA content of an organism, tissue, or cell. Small

More information

VM origin. Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE

VM origin. Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE VM origin Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE NGS intro + Genome-Based Transcript Reconstruction and Analysis Using RNA-Seq Data Based on material

More information

Quantifying gene expression

Quantifying gene expression Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known

More information

Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail

Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.

More information

Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for

Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics

ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these

More information

Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),

Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation

More information

Lees J.A., Vehkala M. et al., 2016 In Review

Lees J.A., Vehkala M. et al., 2016 In Review Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial

More information

RNA-Seq Analysis. August Strand Genomics, Inc All rights reserved.

RNA-Seq Analysis. August Strand Genomics, Inc All rights reserved. RNA-Seq Analysis August 2014 Strand Genomics, Inc. 2014. All rights reserved. Contents Introduction... 3 Sample import... 3 Quantification... 4 Novel exon... 5 Differential expression... 12 Differential

More information

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

More information

How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018

How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Sequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing

Sequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 3 QC of aligned reads

More information

High performance sequencing and gene expression quantification

High performance sequencing and gene expression quantification High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS

More information

Optimal Calculation of RNA-Seq Fold-Change Values

Optimal Calculation of RNA-Seq Fold-Change Values International Journal of Computational Bioinformatics and In Silico Modeling Vol. 2, No. 6 (2013): 285-292 Research Article Open Access ISSN: 2320-0634 Optimal Calculation of RNA-Seq Fold-Change Values

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis -Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification

More information

Introduction to NGS analyses

Introduction to NGS analyses Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy

More information

RNA-Seq analysis using R: Differential expression and transcriptome assembly

RNA-Seq analysis using R: Differential expression and transcriptome assembly RNA-Seq analysis using R: Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 12/7/2016 Agenda Brief about RNA-seq and experiment design Gene oriented analysis Gene quantification

More information

How to deal with your RNA-seq data?

How to deal with your RNA-seq data? How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

Nature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.

Nature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP

More information

Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz

Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure

More information

GENOME ASSEMBLY FINAL PIPELINE AND RESULTS

GENOME ASSEMBLY FINAL PIPELINE AND RESULTS GENOME ASSEMBLY FINAL PIPELINE AND RESULTS Faction 1 Yanxi Chen Carl Dyson Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica Rowell Ankit Srivastava Camila Medrano Trochez Venna Wang Seyed Alireza

More information

Analysis of NGS data. resources. Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015

Analysis of NGS data. resources. Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015 Analysis of NGS data using MetaCentrum VO resources Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015 Basic introduction 12/1/2015 Jan Oppelt, NCBR & CEITEC MU 2 Introduction

More information

Integrative Genomics 1a. Introduction

Integrative Genomics 1a. Introduction 2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering

More information

Arraygen Technologies Pvt. Ltd.

Arraygen Technologies Pvt. Ltd. P r o j e c t s 50 M O N T H LY Arraygen Technologies Pvt. Ltd. Our Services ArrayGen offers an expanded selection of custom services and solutions in Genomics Bioinformatics. We assess and evaluate the

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

More information

Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data

Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology

More information

Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput

Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,

More information

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture

More information

Post-assembly Data Analysis

Post-assembly Data Analysis Assembled transcriptome Post-assembly Data Analysis Quantification: get expression for each gene in each sample Genes differentially expressed between samples Clustering/network analysis Identifying over-represented

More information

Single Cell Transcriptomics scrnaseq

Single Cell Transcriptomics scrnaseq Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Cassava. Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing 4/19/2013

Cassava. Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing 4/19/2013 Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing Farhahna Allie University of the Witwatersrand Plant Biotechnology Laboratory ACGT

More information

www.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange

More information

From reads to results: differential. Alicia Oshlack Head of Bioinformatics

From reads to results: differential. Alicia Oshlack Head of Bioinformatics From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts

More information

Accurate, Fast, and Model-Aware Transcript Expression Quantification

Accurate, Fast, and Model-Aware Transcript Expression Quantification Accurate, Fast, and Model-Aware Transcript Expression Quantification Carl Kingsford Associate Professor, Computational Biology Department Joint work with Rob Patro & Geet Duggal Challenge of Large-Scale

More information

Analysis of Biological Sequences SPH

Analysis of Biological Sequences SPH Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,

More information

RNA sequencing Integra1ve Genomics module

RNA sequencing Integra1ve Genomics module RNA sequencing Integra1ve Genomics module Michael Inouye Centre for Systems Genomics University of Melbourne, Australia Summer Ins@tute in Sta@s@cal Gene@cs 2016 SeaBle, USA @minouye271 inouyelab.org This

More information

David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis

David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis Outline RNA-Seq for differential expression analysis Statistical methods for RNA-Seq: Structure

More information

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:

More information

Exploring and Understanding ChIP-Seq data. Simon v

Exploring and Understanding ChIP-Seq data. Simon v Exploring and Understanding ChIP-Seq data Simon Andrews simon.andrews@babraham.ac.uk @simon_andrews v2018-03-02 Data Creation and Processing Starting DNA Fragmented DNA ChIPped DNA Mapped BAM File FastQ

More information

RNASEQ WITHOUT A REFERENCE

RNASEQ WITHOUT A REFERENCE RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly

De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly Additional File 1 De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly Monika Frazier, Martin Helmkampf, M. Renee Bellinger, Scott Geib, Misaki

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory

Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Bioinformatics Monthly Workshop Series Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Schedule for Fall, 2015 PILM Bioinformatics Web Server (09/21/2015)

More information

Supplementary Information Supplementary Figures

Supplementary Information Supplementary Figures Supplementary Information Supplementary Figures Figure S. The number of reads mapped to the and models for 76 human plasmablasts (AW-AW dataset) using bowtie reconstructed from (A) (B) (C) IMGT_mapped

More information

NGS Data Analysis and Galaxy

NGS Data Analysis and Galaxy NGS Data Analysis and Galaxy University of Pretoria Pretoria, South Africa 14-18 October 2013 Dave Clements, Emory University http://galaxyproject.org/ Fourie Joubert, Burger van Jaarsveld Bioinformatics

More information

Introduction to Algorithms in Computational Biology Lecture 1

Introduction to Algorithms in Computational Biology Lecture 1 Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from

More information

NGS part 2: applications. Tobias Österlund

NGS part 2: applications. Tobias Österlund NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

More information

RNA-Seq Software, Tools, and Workflows

RNA-Seq Software, Tools, and Workflows RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Pilot CrY2H-seq experiments to confirm strain and plasmid functionality.

Nature Methods: doi: /nmeth Supplementary Figure 1. Pilot CrY2H-seq experiments to confirm strain and plasmid functionality. Supplementary Figure 1 Pilot CrY2H-seq experiments to confirm strain and plasmid functionality. (a) RT-PCR on HIS3 positive diploid cell lysate containing known interaction partners AT3G62420 (bzip53)

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information