RNA Sequencing Analyses & Mapping Uncertainty
|
|
- Holly Owen
- 6 years ago
- Views:
Transcription
1 RNA Sequencing Analyses & Mapping Uncertainty Adam McDermaid 1/26
2 RNA-seq Pipelines Collection of tools for analyzing raw RNA-seq data Tier 1 Quality Check Data Trimming Tier 2 Read Alignment Assembly De-novo Reference-based Tier 3 Differential Expression Analysis Functional Enrichment Analysis Quality Check (De-novo) Assembly of Transcripts Differential Expression Analysis RNA-seq Reads Read Mapping Gene Read Count Data Trimming Transcription Unit Prediction Functional Enrichment Analysis Tier 4 Clustering & Bi-clustering Network Analyses De-novo (Bi)-Clustering Network Analysis & Modeling 2/26
3 Visualizations for Differential Gene Expression ViDGER R package Available on GitHub Visualization of Differential Gene Expression Results Cufflinks EdgeR DESeq2 Six publication-quality figures Two matrix options Currently under review in Bioinformatics 3/26
4 vsboxplot Boxplots of log-fpkm values for each condition 4/26
5 vsscatterplot log-fpkm scatterplots between two select conditions 5/26
6 vsscattermatrix Matrix option to display all pairwise scatterplot comparisons Also displays pairwise correlations and FPKM densities for each condition 6/26
7 vsdegmatrix Displays shared differentially expressed genes for each pairwise comparison 7/26
8 vsmaplot Pairwise display of log fold change compared with mean expression values Colored data points indicate significant p- values and differential expression 8/26
9 vsvolcano Pairwise display of log fold change compared with negative log p-value 9/26
10 vsvolcanomatrix Matrix option for all pairwise Volcano plots 10/26
11 vsfourway Conditional comparison relative to chosen sample (control) 11/26
12 Current Pipeline Issues Pipeline tools are not optimal Read Alignment Ambiguous Reads All downstream analyses and results are affected Quality Check (De-novo) Assembly of Transcripts RNA-seq Reads Read Mapping Gene Read Count Data Trimming Transcription Unit Prediction Differential Expression Analysis Functional Enrichment Analysis De-novo (Bi)-Clustering Network Analysis & Modeling 12/26
13 Mapping Uncertainty Read alignment may result in multiple possible alignment locations Reads aligned to reference genome may have multiple possible alignments Due to duplicate nature of genomes, especially in plant genomes When a read can be mapped to multiple locations, mapping uncertainty occurs 13/26
14 Mapping Uncertainty Occurrences Plants Highly duplicative nature of genome Animals Alternative splicing Metagenomics Sequencing of entire microbial communities simultaneously Identical genes across different species Similar, mutated or evolved genes 14/26
15 Mapping Uncertainty in Plants 55 RNA-seq datasets 5 Distinct species GB of data Average of 20% ambiguous data Species Uniquemapped Multimapped Unmapped Arabidopsis thaliana Diploid plants Vitis vinifera Solanum lycopersicum Solanum tuberosum Polyploid plants Triticum aestivum 77%~89% 55%~82% 49%~87% 55%~69% 62%~69% 8%~17% 10%~25% 6%~34% 18%~26% 18%~25% 2%~5% 8%~23% 5%~44% 12%~19% 9%~18% 15/26
16 Current Strategies Omission of ambiguous reads Underestimation Alignment to all possible locations Overestimation Best Match Proportionate assignment Best current approach Still over/underestimates 16/26
17 Solving Mapping Uncertainty Two step approach: Determine severity of mapping uncertainty in a given dataset Quantification using relevant factors Address issue of mapping ambiguous reads 17/26
18 Quantifying Mapping Uncertainty GeneQC Computational program collecting relevant information from datasets Interprets information in meaningful way to provide quantification of mapping uncertainty Maximum base-pair similarity between gene pairs Maximum proportion of shared reads between gene pairs Partitions genes into categorizations based on mapping uncertainty severity 18/26
19 C D GeneQC 0.5 A B C 97 19/26
20 D-score Allows for comparable metric of mapping uncertainty 0.07 Combines three statistics Maximum proportion of shared ambiguous reads Maximum base-pair similarity Number of gene pair interactions Normalized between 0 and 1 for each dataset i /26
21 D-score Higher D-score indicates more mapping uncertainty D-score increased alphabetically by categorization on average 21/26
22 Addressing Mapping Uncertainty Co-expression Modules (CEMs) Can use expression levels for known co-expressed genes (CEGs) to predict likely expression levels for the gene locations This information can be in turn used to determine which location is most likely for any particular ambiguous read Can use existing information to gain insight into the likelihood of the correct location for alignment 22/26
23 Heuristic Approach to Mapping Uncertainty Utilize Negative Binomial Distribution X i ~NB 2 xҧ i, s 2 i + xҧ i ҧ x i s i 2 + ҧ x i Read alignments follow such that read counts converge to CEM mean 23/26
24 Theoretical Approach to Mapping Uncertainty Hidden Markov Model True state is unknown Background information used for predictions CEM statistics Read alignment interactions 24/26
25 Projected Outcomes GeneQC Allow for quantification of mapping uncertainty over entire dataset Statistical Modeling Allow for re-alignment of ambiguous reads aligned to genes with high levels of mapping uncertainty Implement within R package for widespread use Improve reliability of all reference-based RNA-seq analyses 25/26
26 Acknowledgements Dr. Qin Ma Dr. Anne Fennell NSF-IOS NSF-OIA SDRIC 26/26
Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
More informationRNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 4 overview (brief) theoretical
More informationRNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
More informationNext Generation Sequencing
Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx
More informationIntroduction of RNA-Seq Analysis
Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource
More informationRNA
RNA sequencing Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271 www.inouyelab.org
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
More informationEucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationCanadian Bioinforma3cs Workshops
Canadian Bioinforma3cs Workshops www.bioinforma3cs.ca Module #: Title of Module 2 1 Module 3 Expression and Differen3al Expression (lecture) Obi Griffith & Malachi Griffith www.obigriffith.org ogriffit@genome.wustl.edu
More informationSequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationSequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
More informationPost-assembly Data Analysis
Assembled transcriptome Post-assembly Data Analysis Quantification: the expression level of each gene in each sample DE genes: genes differentially expressed between samples Clustering/network analysis
More informationFigure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More informationAnalysis of RNA-seq Data. Bernard Pereira
Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental
More informationRNAseq Applications in Genome Studies. Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford
RNAseq Applications in Genome Studies Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford RNAseq Protocols Next generation sequencing protocol cdna, not RNA sequencing
More informationGeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment
GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment Zhaojun Zhang, Shunping Huang, Jack Wang, Xiang Zhang, Fernando Pardo
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationCBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
More informationA normalization method based on variance and median adjustment for massive mrna polyadenylation data
ISSN : 0974-7435 Volume 8 Issue 4 A normalization method based on variance and median adjustment for massive mrna polyadenylation data Guoli Ji, Ying Wang, Mingchen Wu, Yangzi Zhang, Xiaohui Wu* Department
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationSO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
More informationmeasuring gene expression December 11, 2018
measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and
More informationAn introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
More informationParts of a standard FastQC report
FastQC FastQC, written by Simon Andrews of Babraham Bioinformatics, is a very popular tool used to provide an overview of basic quality control metrics for raw next generation sequencing data. There are
More informationRNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018
RNA Sequencing: Experimental Planning and Data Analysis Nadia Atallah September 12, 2018 A Next Generation Sequencing (NGS) Refresher Became commercially available in 2005 Construction of a sequencing
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationIntroduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
More informationSCALABLE, REPRODUCIBLE RNA-Seq
SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq Advances in the RNA sequencing workflow, from sample preparation through data analysis, are enabling deeper and more accurate exploration
More informationAnalysis Datasheet Exosome RNA-seq Analysis
Analysis Datasheet Exosome RNA-seq Analysis Overview RNA-seq is a high-throughput sequencing technology that provides a genome-wide assessment of the RNA content of an organism, tissue, or cell. Small
More informationVM origin. Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE
VM origin Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE NGS intro + Genome-Based Transcript Reconstruction and Analysis Using RNA-Seq Data Based on material
More informationQuantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationResult Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics
A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these
More informationAnalysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationStatistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies
Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation
More informationLees J.A., Vehkala M. et al., 2016 In Review
Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial
More informationRNA-Seq Analysis. August Strand Genomics, Inc All rights reserved.
RNA-Seq Analysis August 2014 Strand Genomics, Inc. 2014. All rights reserved. Contents Introduction... 3 Sample import... 3 Quantification... 4 Novel exon... 5 Differential expression... 12 Differential
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationHow much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationSequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing
Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 3 QC of aligned reads
More informationHigh performance sequencing and gene expression quantification
High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS
More informationOptimal Calculation of RNA-Seq Fold-Change Values
International Journal of Computational Bioinformatics and In Silico Modeling Vol. 2, No. 6 (2013): 285-292 Research Article Open Access ISSN: 2320-0634 Optimal Calculation of RNA-Seq Fold-Change Values
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More informationIntroduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
More informationRNA-Seq analysis using R: Differential expression and transcriptome assembly
RNA-Seq analysis using R: Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 12/7/2016 Agenda Brief about RNA-seq and experiment design Gene oriented analysis Gene quantification
More informationHow to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationNature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.
Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP
More informationAssemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure
More informationGENOME ASSEMBLY FINAL PIPELINE AND RESULTS
GENOME ASSEMBLY FINAL PIPELINE AND RESULTS Faction 1 Yanxi Chen Carl Dyson Sean Lucking Chris Monaco Shashwat Deepali Nagar Jessica Rowell Ankit Srivastava Camila Medrano Trochez Venna Wang Seyed Alireza
More informationAnalysis of NGS data. resources. Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015
Analysis of NGS data using MetaCentrum VO resources Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015 Basic introduction 12/1/2015 Jan Oppelt, NCBR & CEITEC MU 2 Introduction
More informationIntegrative Genomics 1a. Introduction
2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering
More informationArraygen Technologies Pvt. Ltd.
P r o j e c t s 50 M O N T H LY Arraygen Technologies Pvt. Ltd. Our Services ArrayGen offers an expanded selection of custom services and solutions in Genomics Bioinformatics. We assess and evaluate the
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationBenchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
More informationMassive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput
Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationRNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
More informationPost-assembly Data Analysis
Assembled transcriptome Post-assembly Data Analysis Quantification: get expression for each gene in each sample Genes differentially expressed between samples Clustering/network analysis Identifying over-represented
More informationSingle Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationCassava. Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing 4/19/2013
Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing Farhahna Allie University of the Witwatersrand Plant Biotechnology Laboratory ACGT
More informationwww.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange
More informationFrom reads to results: differential. Alicia Oshlack Head of Bioinformatics
From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts
More informationAccurate, Fast, and Model-Aware Transcript Expression Quantification
Accurate, Fast, and Model-Aware Transcript Expression Quantification Carl Kingsford Associate Professor, Computational Biology Department Joint work with Rob Patro & Geet Duggal Challenge of Large-Scale
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationRNA sequencing Integra1ve Genomics module
RNA sequencing Integra1ve Genomics module Michael Inouye Centre for Systems Genomics University of Melbourne, Australia Summer Ins@tute in Sta@s@cal Gene@cs 2016 SeaBle, USA @minouye271 inouyelab.org This
More informationDavid M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis
David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis Outline RNA-Seq for differential expression analysis Statistical methods for RNA-Seq: Structure
More informationCourse Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses
Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:
More informationExploring and Understanding ChIP-Seq data. Simon v
Exploring and Understanding ChIP-Seq data Simon Andrews simon.andrews@babraham.ac.uk @simon_andrews v2018-03-02 Data Creation and Processing Starting DNA Fragmented DNA ChIPped DNA Mapped BAM File FastQ
More informationRNASEQ WITHOUT A REFERENCE
RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationDe novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly
Additional File 1 De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly Monika Frazier, Martin Helmkampf, M. Renee Bellinger, Scott Geib, Misaki
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationBioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory
Bioinformatics Monthly Workshop Series Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Schedule for Fall, 2015 PILM Bioinformatics Web Server (09/21/2015)
More informationSupplementary Information Supplementary Figures
Supplementary Information Supplementary Figures Figure S. The number of reads mapped to the and models for 76 human plasmablasts (AW-AW dataset) using bowtie reconstructed from (A) (B) (C) IMGT_mapped
More informationNGS Data Analysis and Galaxy
NGS Data Analysis and Galaxy University of Pretoria Pretoria, South Africa 14-18 October 2013 Dave Clements, Emory University http://galaxyproject.org/ Fourie Joubert, Burger van Jaarsveld Bioinformatics
More informationIntroduction to Algorithms in Computational Biology Lecture 1
Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from
More informationNGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Pilot CrY2H-seq experiments to confirm strain and plasmid functionality.
Supplementary Figure 1 Pilot CrY2H-seq experiments to confirm strain and plasmid functionality. (a) RT-PCR on HIS3 positive diploid cell lysate containing known interaction partners AT3G62420 (bzip53)
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More information