RFLP: Restriction Fragment Length Polymorphism

Transcription

1 RFLP: Restriction Fragment Length Polymorphism

2 Various endonucleases: 6 cutters and 4 cutters Enzyme Source Recognition Sequence Cut EcoRI Escherichia coli 5'GAATTC 5'---G/AATTC---3' EcoRII Escherichia coli 5'CCWGG 5'---/CCWGG---3' BamHI Bacillus amyloliquefaciens 5'GGATCC 5'---G/GATCC---3' HindIII Haemophilus influenzae 5'AAGCTT 5'---A/AGCTT---3' TaqI Thermus aquaticus 5'TCGA 5'---T/CGA---3' NotI Nocardia otitidis 5'GCGGCCGC 5'---GC/GGCCGC---3' HinfI Haemophilus influenzae 5'GANTC 5'---G/ANTC---3' Sau3A Staphylococcus aureus 5'GATC 5'---/GATC---3' PovII* Proteus vulgaris 5'CAGCTG 5'---CAG/CTG---3' SmaI* Serratia marcescens 5'CCCGGG 5'---CCC/GGG---3

3 6-cutter: recognize six specific base pairs 4-cutter: recognize four specific base pairs Meaning of RFLP in the phylogenetic studies global and brief comparison of target sequences

4 RFLP (Restriction Fragment Length Polymorphism)

5

6 RFLP (Restriction Fragment Length Polymorphism) In molecular biology, the term restriction fragment length polymorphism, or RFLP, (commonly pronounced rif-lip ) refers to a difference between two or more samples of homologous DNA molecules arising from differing locations of restriction sites, and to a related laboratory technique by which these segments can be distinguished. In RFLP analysis the DNA sample is broken into pieces (digested) by restriction enzymes and the resulting restriction fragments are separated according to their lengths by gel electrophoresis. Although now largely obsolete, RFLP analysis was the first DNA profiling technique inexpensive enough to see widespread application. In addition to genetic fingerprinting, RFLP was an important tool in genome mapping, localization of genes for genetic disorders, determination of risk for disease, and paternity testing. RFLP technique with radioisotope (or other labelling methods) normally used for chloroplast genome in the field of plant phylogenetic study.

7 PCR mediated RFLP CAPS (cleaved amplified polymorphic sequence) : amplify long DNA region first and then treat endonuclease.

8 Protocol of PCR product purification Kit Almost similar to the DNA extraction Kit DNA binding filter(sv column) is used. Before the CAPS, PCR products must be purified.

9 ENDONUCLEASE TREATMENT

10 Our CAPS result (2013) CAPS for four Scutellaria species in Korea and one outgroup (Isodon) I. inf S.str1 S.str2 S.ind S.pek v. al I. inf S.str1 S.str2 S.ind S.pek v. al I. inf S.str1 S.str2 S.ind S.pek v. al I. inf S.str1 S.str2 S.ind S.pek v. al Group 4 Group 1 Group 3 Group 2 MboI /GATC HhaI GC/GC HaeIII GG/CC DpnI GA/TC

11 RAPD: Random Amplification of Polymorphic DNA

12 RAPD (Random Amplification of Polymorphic DNA): It is a type of PCR reaction, but the segments of DNA that are amplified are random. The scientist performing RAPD creates several arbitrary, short primers (8-12 nucleotides), then proceeds with the PCR using a large template of genomic DNA, hoping that fragments will amplify. By resolving the resulting patterns, a semi-unique profile can be gleaned from a RAPD reaction.

13

14 An example of RAPD

15 Cons and Pros of RAPD - Pros: Cheap and easy - Cons: low repeatability. Impossible to combine two different experiments Our primer sequences for RAPD experiments: RAPD1 5 -GATCGTCCAG-3 RAPD2 5 -TGCCGAATCC-3 RAPD3 5 -AAGCGTTAAC-3 RAPD4 5 -GGTCCTTATG-3 PCR condition: 95 C 3 min 95 C 30sec 38 C 30sec 72 C 30sec 72 C 7min 35 cycle

16 Our results (2013) Group 1 Group 2 Group 3 Group 4 S. str1 S. str1 S. str2 S. pek.a S. ind I. inf S. str1 S. str2 S. pek.a S. ind S. str2 S. pek.a S. ind I. inf S. str1 S. str2 S. pek.a S. ind I. inf I. inf

17 Analyses of our results S. str1 S. str2 S. pek.a S. ind I. inf S. str1 S. str2 S. pek.a S. ind I. inf Recognize bands Group 1 Group 2 Coding based on recognized bands

18 ISSR (Inter Simple Sequence Repeats)

19 ISSR (Inter Simple Sequence Repeats) ISSR (for inter-simple sequence repeat) is a general term for a genome region between microsatellite loci. The complementary sequences to two neighboring microsatellites are used as PCR primers; the variable region between them gets amplified. Sequences amplified by ISSR-PCR can be used for DNA fingerprinting. Since an ISSR may be a conserved or nonconserved region, this technique is not useful for distinguishing individuals, but rather for phylogeography analyses or maybe delimiting species. RAPD: random primers ISSR: microsatellite primers ISSR shows better repeatability than RAPD 5 -GTCTCTCTCTCTCT-3 AGGTGGTCTCTCTCTCTCTCTCTCTCTC TCCACCAGAGAGAGAGAGAGAGAGAGAG AGAGAGAGAGAGAGAGAGAGAGCCGCCC TCTCTCTCTCTCTCTCTCTCTCGGCGGG 5 -GTCTCTCTCTCTCT-3 Amplified fragment

20 AFLP (Amplified Fragment Length Polymorphism)

21 AFLP (Amplified Fragment Length Polymorphism) AFLP-PCR or just AFLP is a PCR-based tool used in genetics research, DNA fingerprinting, and in the practice of genetic engineering. Developed in the early 1990s by Keygene, AFLP uses restriction enzymes to digest genomic DNA, followed by ligation of adaptors to the sticky ends of the restriction fragments. A subset of the restriction fragments is then selected to be amplified. This selection is achieved by using primers complementary to the adaptor sequence, the restriction site sequence and a few nucleotides inside the restriction site fragments Repeatability of AFLP method is much higher than RAPD and ISSR.

22 Process of AFLP A ACC C AGC