Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

NEXT GENERATION SEQUENCING. Farhat Habib

NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme

Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in

Variation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI

Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality

Genome 373: Mapping Short Sequence Reads II. Doug Fowler

Genome 373: Mapping Short Sequence Reads II Doug Fowler The final Will be in this room on June 6 th at 8:30a Will be focused on the second half of the course, but will include material from the first half

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère

C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/

GNUMap: Unbiased Probabilistic Mapping of Next- Generation Sequencing Reads

: Unbiased Probabilistic Mapping of Next- Generation Sequencing Reads Nathan Clement Computational Sciences Laboratory Brigham Young University Provo, Utah, USA GNUMap Next-Generation Sequencing (Solexa/Illumina)

Analysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah

Analysis of structural variation Alistair Ward USTAR Center for Genetic Discovery University of Utah What is structural variation? What differentiates SV from short variants? What are the major SV types?

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014

Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

Introduction to Short Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

Introduction to Short Read Alignment UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

Analysis of structural variation. Alistair Ward - Boston College

Analysis of structural variation Alistair Ward - Boston College What is structural variation? What differentiates SV from short variants? What are the major SV types? Summary of MEI detection What is an

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

Read Mapping and Variant Calling. Johannes Starlinger

Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.

NGS in Pathology Webinar

NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical

Challenging algorithms in bioinformatics

Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use

Mapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010

Mapping Next Generation Sequence Reads Bingbing Yuan Dec. 2, 2010 1 What happen if reads are not mapped properly? Some data won t be used, thus fewer reads would be aligned. Reads are mapped to the wrong

Next Generation Sequencing. Tobias Österlund

Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

Transcriptomics analysis with RNA seq: an overview Frederik Coppens

Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)

Introduction to Next Generation Sequencing

The Sequencing Revolution Introduction to Next Generation Sequencing Dena Leshkowitz,WIS 1 st BIOmics Workshop High throughput Short Read Sequencing Technologies Highly parallel reactions (millions to

Short Read Alignment to a Reference Genome

Short Read Alignment to a Reference Genome Shamith Samarajiwa CRUK Summer School in Bioinformatics Cambridge, September 2018 Aligning to a reference genome BWA Bowtie2 STAR GEM Pseudo Aligners for RNA-seq

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

High-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler

High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014

Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012

+ Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools

Genomic DNA ASSEMBLY BY REMAPPING. Course overview

ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

SNP calling and VCF format

SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

NGS part 2: applications. Tobias Österlund

NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

SEQUENCING. M Ataei, PhD. Feb 2016

CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

Next Generation Sequencing: An Overview

Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation

Analysis of RNA-seq Data

Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,

TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)

tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law

Disclosing the nature of computational tools for the analysis of Next Generation Sequencing data.

Disclosing the nature of computational tools for the analysis of Next Generation Sequencing data. Francesca Cordero 1,2, Marco Beccuti 1, Susanna Donatelli 1 and Raffaele A Calogero 2 (1) Department of

L3: Short Read Alignment to a Reference Genome

L3: Short Read Alignment to a Reference Genome Shamith Samarajiwa CRUK Autumn School in Bioinformatics Cambridge, September 2017 Where to get help! http://seqanswers.com http://www.biostars.org http://www.bioconductor.org/help/mailing-list

Functional annotation of metagenomes

Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

Next-Generation Sequencing. Technologies

Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Read Complexity

Supplementary Figure 1 Read Complexity A) Density plot showing the percentage of read length masked by the dust program, which identifies low-complexity sequence (simple repeats). Scrappie outputs a significantly

Data Analysis with CASAVA v1.8 and the MiSeq Reporter

Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data

BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%

Mapping of Next Generation Sequencing Data

Mapping of Next Generation Sequencing Data Agnes Hotz-Wagenblatt Bioinformatik (HUSAR) Next Generation Sequencers Next (or 3 rd ) generation sequencers came onto the scene in the early 2000 s General characteristics

Single alignment: FASTA. 17 march 2017

Single alignment: FASTA 17 march 2017 FASTA is a DNA and protein sequence alignment software package first described (as FASTP) by David J. Lipman and William R. Pearson in 1985.[1] FASTA is pronounced

Background Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009

Comparing a few SNP calling algorithms using low-coverage sequencing data

Yu and Sun BMC Bioinformatics 2013, 14:274 RESEARCH ARTICLE Open Access Comparing a few SNP calling algorithms using low-coverage sequencing data Xiaoqing Yu 1 and Shuying Sun 1,2* Abstract Background:

Next Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs

Next Genera*on Sequencing II: Personal Genomics Jim Noonan Department of Gene*cs Personal genome sequencing Iden*fying the gene*c basis of phenotypic diversity among humans Gene*c risk factors for disease

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

Introduction to Bioinformatics and Gene Expression Technologies

Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

UAB DNA-Seq Analysis Workshop. John Osborne Research Associate Centers for Clinical and Translational Science

+ UAB DNA-Seq Analysis Workshop John Osborne Research Associate Centers for Clinical and Translational Science ozborn@uab.,edu + Thanks in advance You are the Guinea pigs for this workshop! At this point

Theory and Application of Multiple Sequence Alignments

Theory and Application of Multiple Sequence Alignments a.k.a What is a Multiple Sequence Alignment, How to Make One, and What to Do With It Brett Pickett, PhD History Structure of DNA discovered (1953)

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)

RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their

About Strand NGS. Strand Genomics, Inc All rights reserved.

About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive

BIOINFORMATICS ORIGINAL PAPER

BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 20 2011, pages 2790 2796 doi:10.1093/bioinformatics/btr477 Sequence analysis Advance Access publication August 19, 2011 Comparative analysis of algorithms for

NGS Data Analysis and Galaxy

NGS Data Analysis and Galaxy University of Pretoria Pretoria, South Africa 14-18 October 2013 Dave Clements, Emory University http://galaxyproject.org/ Fourie Joubert, Burger van Jaarsveld Bioinformatics

Course Presentation. Ignacio Medina Presentation

Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

Eucalyptus gene assembly

Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

Frumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health

Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the

IDENTIFYING A DISEASE CAUSING MUTATION

IDENTIFYING A DISEASE CAUSING MUTATION Targeted resequencing MARCELA DAVILA 3/MZO/2016 Core Facilities at Sahlgrenska Academy Statistics Software bioinformatics@gu.se www.cf.gu.se/english// Increasing

Optimization of Process Parameters of Global Sequence Alignment Based Dynamic Program - an Approach to Enhance the Sensitivity.

Optimization of Process Parameters of Global Sequence Alignment Based Dynamic Program - an Approach to Enhance the Sensitivity of Alignment Dr.D.Chandrakala 1, Dr.T.Sathish Kumar 2, S.Preethi 3, D.Sowmya

Next-generation sequencing technologies

Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop

Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10

Genome Sequence Assembly

Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

Next Generation Sequencing. Dylan Young Biomedical Engineering

Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions

NOW GENERATION SEQUENCING. Monday, December 5, 11

NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000

Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD

Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Type Alkan et al, Nature Reviews Genetics 2011 doi:10.1038/nrg2958 Variant Type http://www.broadinstitute.org/education/glossary/snp

Lecture 7. Next-generation sequencing technologies

Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively

Bioinformatics Course AA 2017/2018 Tutorial 2

UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

Introduction to NGS analyses

Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

STAT 536: Genetic Statistics

STAT 536: Genetic Statistics Karin S. Dorman Department of Statistics Iowa State University August 22, 2006 What is population genetics? A quantitative field of biology, initiated by Fisher, Haldane and

The Basics of Understanding Whole Genome Next Generation Sequence Data

The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next

Bioinformatics for High Throughput Sequencing

Bioinformatics for High Throughput Sequencing Eric Rivals LIRMM & IBC, Montpellier http://www.lirmm.fr/~rivals http://www.lirmm.fr/~rivals 1 / High Throughput Sequencing or Next Generation Sequencing High

HHS Public Access Author manuscript Nat Biotechnol. Author manuscript; available in PMC 2012 May 07.

Integrative Genomics Viewer James T. Robinson 1, Helga Thorvaldsdóttir 1, Wendy Winckler 1, Mitchell Guttman 1,2, Eric S. Lander 1,2,3, Gad Getz 1, and Jill P. Mesirov 1 1 Broad Institute of Massachusetts

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.

Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up

Applications of short-read

Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments

GREG GIBSON SPENCER V. MUSE

A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

CHAPTER 4 PATTERN CLASSIFICATION, SEARCHING AND SEQUENCE ALIGNMENT

92 CHAPTER 4 PATTERN CLASSIFICATION, SEARCHING AND SEQUENCE ALIGNMENT 4.1 INTRODUCTION The major tasks of pattern classification in the given DNA sample, query pattern searching in the target database

A Rank-Based Sequence Aligner with Applications in Phylogenetic Analysis

with Applications in Phylogenetic Analysis Liviu P. Dinu 1,2., Radu Tudor Ionescu 1 *., Alexandru I. Tomescu 3. 1 Faculty of Mathematics and Computer Science, University of Bucharest, Bucharest, Romania,

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

Contact us for more information and a quotation

GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1

BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio

Statistical method for Next Generation Sequencing pipeline comparison

Statistical method for Next Generation Sequencing pipeline comparison Pascal Roy, MD PhD EPICLIN 2016 Strasbourg 25-27 mai 2016 MH Elsensohn 1-4*, N Leblay 1-4, S Dimassi 5,6, A Campan-Fournier 5,6, A

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis

Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-

The Malta Human Genome Project Progress Report

The Malta Human Genome Project Progress Report Sara Ann Abdilla (188396M) Supervisor(s): Dr Jean-Paul Ebejer Faculty of ICT University of Malta December 2016 Submitted in partial fulfillment of the requirements

Genomics. Data Analysis & Visualization. Camilo Valdes

Genomics Data Analysis & Visualization Camilo Valdes cvaldes3@miami.edu https://github.com/camilo-v Center for Computational Science, University of Miami ccs.miami.edu Today Sequencing Technologies Background

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq

Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

Compute- and Data-Intensive Analyses in Bioinformatics"

Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics

Structural variation analysis using NGS sequencing

Structural variation analysis using NGS sequencing Victor Guryev NBIC NGS taskforce meeting April 15th, 2011 Scale of genomic variants Scale 1 bp 10 bp 100 bp 1 kb 10 kb 100 kb 1 Mb Variants SNPs Short

Chapter 7. DNA Microarrays

Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining

Biology Evolution: Mutation I Science and Mathematics Education Research Group

a place of mind F A C U L T Y O F E D U C A T I O N Department of Curriculum and Pedagogy Biology Evolution: Mutation I Science and Mathematics Education Research Group Supported by UBC Teaching and Learning

Performance comparison of five RNA-seq alignment tools

New Jersey Institute of Technology Digital Commons @ NJIT Theses Theses and Dissertations Spring 2013 Performance comparison of five RNA-seq alignment tools Yuanpeng Lu New Jersey Institute of Technology