Shoshan, David H. MacLennan, and Donald S. Wood, which appeared in the August 1981 issue ofproc. NatL Acad. Sci. USA
|
|
- Chad Morrison
- 6 years ago
- Views:
Transcription
1 2124 Corrections Correction. n the article "Nucleotide sequence and the encoded amino acids of human serum albumin mrna" by Achilles Dugaiczyk, Simon W. Law, and Olivia E. Dennison, which appeared in the January 1982 issue ofproc. NatL. Acad. Sci. USA (79, 71-75), the first paragraph of Discussion was garbled by a printer's error. The correct paragraph is printed below. Determining the complete nucleotide sequence ofthe cdna has permitted us to identify the pre- and the propeptides of human serum albumin. Actually, the amino acid sequence of the propeptide has been reported for carriers of an abnormal albumin, Christchurch (18), which is longer than normal human albumin by six amino acids at the NH2 terminus. This additional hexapeptide has the sequence Arg-Gly-Val-Phe-Arg-Gln (18) and differs only in the terminal position from the sequence we are presently reporting for the apparently normal protein, Arg- Gly-Val-Phe-Arg-Arg-albumin (Fig. 3). Thus, carriers of albumin Christchurch must be carriers of a CGA to CAA mutation, which changes the codon for Arg to Gln in the last position of the propeptide. The altered protein consequently ceases to be a substrate for the specific protease that removes propeptides from secretory proteins. t is interesting to note, however, that failure to remove such a propeptide does not prevent the protein from being secreted; at least this is true about albumin Christchurch, which has reached the bloodstream of its carriers (18). Proc. NatL Acad. Sci. USA 79 (1982) Correction. n the article "A proton gradient controls a calcium-release channel in sarcoplasmic reticulum" by Varda Shoshan, David H. MacLennan, and Donald S. Wood, which appeared in the August 1981 issue ofproc. NatL Acad. Sci. USA (78, ), the authors request that the following correction be noted. n the experiment reported in Fig. 5 and discussed on pages 4830 and 4831, the concentration of Ca2+ used to inhibit Ca + release was, in fact, 100,uM not 3.3 jum as reported. Consequently, although Ca2' release was measurably reduced by Ca2' in the experiments of Fig. 5, the data neither support nor preclude the possibility that physiological Ca2+ levels ('10,uM) can inhibit Ca2' release.
2 Proc. Nati Acad. Sci. USA Vol. 79, pp , January 1982 Biochemistry Nucleotide sequence and the encoded amino acids of human serum albumin mrna (cdna clones/codon usage/prepropeptide/triple-domain structure) ACHLLES DUGACZYK, SMON W. LAW*, AND OLVA E. DENNSON Department of Cell Biology, Baylor College of Medicine, Texas Medical Center, Houston, Texas Communicated by James F. Bonner, Septemnber 3, 1981 ABSTRACT The complete nucleotide sequence of human serum albumin mrna has been determined from recombinant cdna clones and from a primer-extended cdna synthesis on the mrna template. The sequence is composed of 2078 nucleotides, starting upstream from a potential ribosome binding site in the 5' untranslated region. t contains all the translated codons and extends into the poly(a) at the 3' terminus. Part of the translated sequence codes for a hydrophobic prepeptide, Met--Trp-Val- Thr-Phe-le-Ser-Leu-Leu-Phe-Leu-Phe-Ser-Ser-Ala-Tyr-Ser, followed by a basic propeptide, Arg-Gly-Val-Phe-Arg-Arg. These signal peptides are absent from mature normal serum albumin and, so far, have not been identified in their nascent state in humans. A remaining 1755 nucleotides of the translated mrna sequence code for 585 amino acids, which are in agreement, with few exceptions, with the published amino acid sequence for human serum albumin. The mrna sequence verifies and refines the repeating homology in the triple-domain structure of the serum albumin molecule. The gene for serum albumin, which codes for the major plasma protein, is ofparticular interest to study because it is regulated in development. n mammals, serum albumin is synthesized by the adult liver, and its synthesis increases from low levels early in development to a high plateau in adulthood. The embryonic liver and yolk sac, on the other hand, produce predominantly a-fetoprotein, but the synthesis decreases drastically after birth (1-3). This inverse relationship between the expression of the two genes makes it an attractive problem in developmental biology, particularly because the two genes are related. We have recently determined the complete sequence of mouse a-fetoprotein mrna (4). The deduced a-fetoprotein structure revealed extensive homology to mammalian serum albumin, indicating that the two proteins are encoded in the same gene family. Similar conclusions have been reached by others from studies on rat (5) and mouse (6) a-fetoprotein genes. n the present effort we extend our studies to the human genome and report the cloning and sequence determination of DNA complementary to the human serum albumin mrna. We deduce the unknown amino acid sequence of the signal peptide and verify a repeating homology in the triple-domain structure of the human serum albumin molecule. METHODS mrna. Human liver mrna was obtained by the procedure of Chirgwin et al (7) from fetal livers removed at weeks of gestation. mmunoprecipitation of albumin-containing polysomes was performed according to Taylor and Tse (8). n vitro translation of mrna was carried out in a cell-free reticulocyte The publication costs ofthis article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U. S. C solely to indicate this fact. 71 A B C am- -~ FG. 1. Autoradiogram of proteins, labeled with [assimethionine in an in vitro reticulocyte translation system, and separated electrophoretically in a sodium dodecyl sulfate/acrylamide gel (9). Lane A, no mrna added to the translation system. Lane B, translation products of total human liver mrna. Lane C, translation products of human liver mrna obtained from immunoprecipitated albumin-producing polysomes. Lane D, part of the translation sample that is separated in lane B was immunoprecipitated with antibody prior to its electrophoretic separation on the gel. system, following the instruction of the supplier (New England Nuclear). The translation products were separated electrophoretically according to Laemmli (9). Cloning and Sequence Determination of DNA. Doublestranded cdna has been cloned in the Pst site of the plasmid pbr322, as described in detail previously (4, 10). DNA sequence was determined according to the procedure of Maxam and Gilbert (11). RESULTS Enriched mrna. The products of in vitro translation of human liver mrna are shown in Fig. 1. On the basis of this translation, mrna that was enriched for serum albumin sequences was estimated to be over 50% pure (Fig. 1, lane C). This enriched mrna was used to obtain a cdna probe to screen the recombinant clones for serum albumin sequences. * Present address: National Heart, Lung and Blood nstitute, National nstitutes of Health, Bethesda, MD D
3 72 Biochemistry: Dugaiczyk et al. Recombinant Plasmids pha36 and pha206. A restriction endonuclease map of the largest positive clone, pha36, is shown in Fig. 2, together with a restriction map of the primerextended plasmid clone pha206. The latter was obtained in a second transformation experiment after initiating the cdna synthesis from an internal primer. This primer was a 91-basepair-long DNA fragment, Msp (152)-Taq (182/3), isolated from pha36. The two plasmids, pha36 and pha206, share 0.15 kilobase of homologous DNA. Together, they encode the entire sequence for human serum albumin, starting with the CTT codon for Leu at position - 10 of the prepeptide and extending into the 3' untranslated region of poly(a). Sequence of the Albumin cdna. The entire nucleotide sequence of the serum albumin mrna, as determined from the cloned DNA in pha36 and pha206 and from the primer-extended cdna at the 5' terminus of the message, is shown in Fig. 3. The inferred amino acid sequence is also indicated. The mrna length is 2078 nucleotides, of which 38 represent the 5' untranslated region, 54 identify a prepeptide of 18 amino acids, 18 identify a propeptide of 6 amino acids, 1755 code for the known 585 amino acids of serum albumin, 189 make up the 3' untranslated region, and 24 are the poly(a) sequence. Nucleotides 5 to 15 (-34 to -24) in the 5' untranslated region (Fig. 3) are complementary to a 3'-terminal region of eukaryotic 18S RNA (13) and thus could represent a ribosome binding site: (5')... T-T-C C-T-T-C-T-G-T... albumin mrna (3')... G-A-G-G-A-A-G-G-C-G-U-C-C-m62A-m6A... 18S RNA The translated portion of the mrna sequence codes for the signal peptide and the main body of the albumin polypeptide chain. Because prepeptides are removed from nascent secretory proteins (such as albumin) in the endoplasmic reticulum, and the conversion ofproalbumin to albumin takes place in the Golgi vesicles, the presence and the sequence of the signal peptide for normal human serum albumin have not been reported previously. At the 3' end of the message, the putative polyadenylylation signal sequence A-A-T-A-A-A, is located 16 nucleotides upstream from the beginning of the poly(a) sequence. Another characteristic sequence located near the polyadenylylation site has been identified by Benoist et al. (14); the consensus sequence from several mrnas was T-T-T-T-C-A-C-T-G-C. A Proc. Nad Acad. Sci. USA 79 (1982) similar sequence, T-T-T-T-C-T-C-T-G-T, is located 19 nucleotides upstream from the A-A-T-A-A-A hexanucleotide in the human albumin mrna molecule (Fig. 3). Primary Structure of Human Serum Albumin. Amino acid sequences for human serum albumin have been published by Behrens et al. (15) and by Meloun et al (16). (See Fig. 4.) There are a few discrepancies between the two reports, often involving sequences surrounding cysteine residues. Perhaps the most serious in terms of the structure of the albumin molecule is the sequence around the 17th and 18th cysteines, because the presence (15) or absence (16) of other amino acids between the two cysteines would affect the polypeptide loops generated by the disulfide bonds ofthese two cysteines. Our results in this critical region are shown by the sequencing gel in Fig. 5, which permits an identification of residues 261 to 290. The 17th and 18th cysteines are residues 278 and 279, and there are clearly no other amino acids between them. Consequently, such a sequence arrangement establishes the near-perfect homology in the triple-domain structure of the albumin molecule (Fig. 4). Our sequence results are in better agmeement with those of Meloun et al (16), although several discrepancies remain. Amino acid positions 94 (Gln), 95 (), 97 (Gly), 170 (Gln), 464 (His), 465 (), and 501 () are specified (16) as, 94 (), 95 (Gln), 97 (), 170 (), 464 (), 465 (His), and 501 (Gln). Residues (Fig. 3), Ala-Asp-Pro-His---Tyr, are specified (16) as His-Asp-Pro-Tyr---Ala. There are several.possible explanations for these differences, but we do not think the differences are due to erroneous DNA sequence determinations. DSCUSSON Determining the complete nucleotide sequence of the cdna has permitted us to identify the pre- and the propeptides of human serum albumin. Actually, the amino acid sequence of the propeptide. The altered protein consequently ceases to be a substrate for the specific'protease that removes propeptides from secretory proteins. t is interesting to note, however, that failure to remove such a propeptide does not prevent the protein from being secreted; at least this is 'true about albumin are presently reporting for the apparently normal protein, Arg- Gly-Val-Phe-Arg-Arg-albumin (Fig. 3). Thus, carriers of albumin Christchurch must be carriers of a CGA to CAA mutation, which changes the codon for Arg to Gln in the last position of HpaU (3658) J 1 Taq 1 5' Psol bombo (3611) 16/7 31 Hpa 1 (3548) Pat 182/3 (3611) Taq, H1%~~~~~Hn / /8 Hinf Mbo Mbo Mu 1-1 [3.Pst s0 (3611) Hp&( A2 (3646) / / Taq Mbo Taq Mlo HknU Mbo 1L11 H Kiobases l - 493/4 Taq Hha sat /7 HM H*n41 531/2 472/3 479/0 pha36 O A FG. 2. Restriction endonuclease cleavage map of the overlapping human albumin cdna inserts in the recombinant plasmids pha36 and pha26.' The map shows the inserted albumin DNA (opent bar) and its orientation in-the pbr322 plasmid DNA (black bar). The mrna sequence is presented by the upper DNA strands, with the 5' and 3' termini as indicated. Numbers on restriction sites within the human-derived'dna correspond to amino- acid positions in the albumin molecule. Numbers such as 182/3 indicate that the restriction sequence overlaps two amino acids. The Taq (270) site is actually not cleaved in our system'by Taq, due to methylation of this sequence to T-C-G-m6A. The inserted sequence in pha206 starts with the'ctt codon for Leu at position -10 of the prepeptide. Numbers on restriction sites within the pbr322 sequence are taken from available sequence data from Sutcliffe (12). One of the two Pst sites in each recombinant plasmid, indicated by *, has not been reconstituted due to loss of a terminal A in the Pst'-linearized plasmid DNA. 666 term TAA Hhdlll * Pot (3611) 34 Hhfl (3668)
4 Biochemistry: Dugaiczyk et al. Proc. Nati. Acad. Sci. USA 79 (1982) p r e -10 Met lys trp val thr phe ile ser leu leu phe leu phe ser (A)GCTTTTCTCTTCTGTCAACCCCACACGCCTTTGGCACA ATG AAG TGG GTA ACC TTT ATT TCC CTT CTT m CTC m AGC (80) -1-6 p r o ser ala tyr ser arg gly val phe arg arg asp ala his lys ser glu val ala his arg phe lys asp leu gly glu glu asn phe lys TCG GCT TAT TCC AGG GGT GTG m CGT CGA GAT GCA CAC AAG AGT GAG GTT GCT CAT CGGM AAA GAT TTG GGA GAA GAA AAT TTC AAA (170) ala leu val leu ile ala phe ala gin tyr leu gin gin cys pro phe glu asp his val lys leu val am glu val thr glu phe ala GCC TTG GTG TTG ATT GCC TTT GCT CAG TAT CTT CAG CAG TGT CCA m GAA GAT CAT GTA AAA TTA GTG AAT GAA GTA ACT GAA TTT GCA (260) lys thr cys val ala asp glu ser ala glu asn cys asp lys ser leu his thr leu phe gly asp lys leu cys thr val ala thr leu AAA ACA TGT GTT GCT GAT GAG TCA GCT GAA AAT TGT GAC AAA TCA CTT CAT ACC CTTm GGA GAC AAA TTA TGC ACA GTT GCA ACT CTT (350) arg glu thr tyr gly glu met ala asp cys cys ala lys gin glu pro gly arg asn glu cys phe leu gin his lys asp asp asn pro CGT GAA ACC TAT GGT GAA ATG GCT GAC TGC TGT GCA AAA CM GAA CCT GGG AGA MT GM TGC TTC TTG CM CAC MA GAT GAC AAC CCA (440) asn leu pro arg leu val arg pro glu val asp val met cys thr ala phe his asp asn glu glu thr phe leu lys lys tyr leu tyr MC CTC CCC CGA TTG GTG AGA CCA GAG GTT GAT GTG ATG TGC ACT GCTm CAT GAC MT GM GAG ACA TTT TTG AAA MA TAC TTA TAT (530) glu ile ala arg arg his pro tyr phe tyr ala pro glu leu leu phe pbe ala lys arg tyr lys ala ala phe thr glu cys cys gin GAA ATT GCC AGA AGA CAT CCT TAC TTT TAT GCC CCG GAA CTC CTT TTCm GCT MA AGG TAT MA GCT GCT m ACA GAA TGT TGC CM (620) ala ala asp lys ala ala cys leu leu pro lysleu asp glu lie arg asp glu gly lys ala ser ser ala lys gin arg leu lys cys GCT GCT GAT MA GCT GCC TGC CTG TTG CCA MG CTC GAT GM CTT CGG GAT GM GGG AAG GCT TCG TCT GCC MA CAG AGA CTC AAG TGT (710) ala ser leu gin lys pbe gly glu arg ala phe lys ala trp ala val ala arg leu ser gin arg phe pro lys ala glu phe ala glu GCC AGT CTC CAA MA TTT GGA GM AGA GCT TTC MA GCA TGG GCA GTA GCT CGC CTG AGC CAG AGA TTT CCC AAA GCT GAG TTT GCA GAA (800) val ser lys leu val thr asp leu thr lys val his thr glu cys cys his gly asp leu leu glu cys ala asp asp arg ala asp leu GTT TCC AAG TTA GTG ACA GAT CTT ACC MA GTC CAC ACG GAA TGC TGC CAT GGA GAT CTG CTT GM TGT GCT GAT GAC AGG GCG GAC CTT (890) ala lys tyr se cys glu asn gin asp ser ile ser ser lys leu lys glu cys cys glu lys pro leu leu glu lys ser his cys ile GCC AAG TAT ATC TGT GAA MT CAA GAT TCG ATC TCC AGT AAA CTG MG GM TGC TGT GAA MA CCT CTG TTG GM AAA TCC CAC TGC ATT (980) ala glu val glu asn asp glu met pro ala asp leu pro ser leu ala ala asp phe val glu ser lys asp val cys lys asn tyr ala GCC GAA GTG GM MT GAT GAG ATG CCT GCT GAC TTG CCT TCA TTA GCT GCT GAT TTT GTT GAA AGT AAG GAT GTT TGC AM MC TAT GCT(1070) glu ala lys asp val phe leu gly met phe leu tyr glu tyr ala arg arg his pro asp tyr ser val val leu leu leu arg leu ala GAG GCA AAG GAT GTC TTC TTG GGC ATG m TTG TAT GAA TAT GCA AGA AGG CAT CCT GAT TAC TCT GTC GTG CTG CTG CTG AGA CTT GCC(1160) lys thr tyr glu thr thr leu glu lys eys cys ala ala ala asp pro his glu cys tyr ala lys val phe asp glu phe lys pro leu MG ACA TAT GM ACC ACT CTA GAG MG TGC TGT GCC GCT GCA GAT CCT CAT GAA TGC TAT GCC MA GTG TTC GAT GM U AA CCT CTT(1250) val glu glu pro gin asn leu ile lys gin asn cys glu leu phe glu gin leu gly glu tyr lys phe gin asn ala leu leu val arg GTG GAA GAG CCT CAG AAT TTA ATC MA CAA MT TGT GAG CTT m GAG CAG CTT GGA GAG TAC MA TTC CAG MT GCG CTG TTA GTT CGT(1340) tyr thr lys lys val pro gin val ser thr pro thr leu val glu val ser arg asn leu gly lys val gly ser lys eys cys lys his TAC ACC MG MA GTA CCC CAA GTG TCA ACT CCA ACT CTT GTA GAG GTC TCA AGA MC CTA GGA MA GTG GGC AGC AM TGT TGT AM CAT(1430) pro glu ala lys arg met pro eys ala glu asp tyr leu ser val val leu asn gin leu cys val leu his glu lys thr pro val ser CCT GM GCA AAA AGA ATG CCC TGT GCA GM GAC TAT CTA TCC GTG GTC CTG AAC CAG TTA TGT GTG TTG CAT GAG AAA ACG CCA GTA AGT(1520) asp arg val thr lys cys cys thr glu ser leu val asn arg arg pro cys phe ser ala leu glu val asp glu thr tyr val pro lys GAC AGA GTC ACC AAA TGC TGC ACA GM TCC TTG GTG MC AGG CGA CCA TGC TTT TCA GCT CTG GM GTC GAT GM ACA TAC GTT CCC AAA(1610) glu pbe asn ala glu thr phe thr phe his ala asp ile cys thr leu ser glu lys glu arg gin ile lys lys gin thr ala leu val GAG mu MT GCT GAA ACA TTC ACC TTC CAT GCA GAT ATA TGC ACA CTT TCT GAG MG GAG AGA CAA ATC MG AM CM ACT GCA CTT GTT(1700) glu leu val lys his lys pro lys ala thr lys glu gin leu lys ala val met asp asp phe ala ala phe val glu lys cys cys lys GAG CTC GTG MA CAC MG CCC MG GCA ACA AM GAG CM CTG MA GCT GTT ATG GAT GAT TTC GCT GCT TTT GTA GAG MG TGC TGC MG(1790) ala asp asp lys glu thr cys phe ala glu glu gly lys lys leu val ala ala ser gln ala ala leu gly leu ter ter GCT GAC GAT MG GAG ACC TGC m GCC GAG GAG GGT AM MA CTT GTT GCT GCA AGT CAA GCT GCC TTA GGC TTA TM CATCACAUMAAMG(1883) ter ter CATCTCAGCCTACCATGAGAATAAGAGAAAGAAAATGAAGATCAAAAGCTTATTCATCTGTTTTTCTTTTTCGTTGGTGTAAAGCCAACACCCTGTCTAAAAAACATAAATT CTTT (2oo2) TCATTTTGCCTCTTTTCTCTGTGCTTCMTMTAAMAATGGAAAGMTCTM M (2078) FG. 3. Nucleotide sequence of human serum albumin mrna as determined from cloned cdna. The sequence 5'-upstream of the Leu at -10, which is not contained in pha206, was determined as follows. A short DNA fragment, containing the Taq site (Arg at -1 in the propeptide), was obtained from the 5' end of the albumin DNA in pha206 (Fig. 2). The fragment was terminated by the Alu sequence (Ser at -5 in the prepeptide) and the Mnl sequence (-6), and it was 32P-labeled at the 5' terminus of the latter. This fragment was annealed with human liver mrna, and the resulting RNADNA template/primer was used in the reverse transcriptase reaction to synthesize a cdna copy extended into the 5' terminus of the mrna template. This cdna was separated from the deoxyribonucleoside triphosphates on a Sephadex G-50 column and used directly for sequence determination. The first A residue was determined from genomic DNA. The amino acid sequence shown is deduced from the nucleotide sequence. ter, Termination. the propeptide. The altered protein consequently ceases to be Christchurch, which has reached the bloodstream of its carriers a substrate for the specific protease that removes propeptides (18). from secretory proteins. t is interesting to note, however, that The nucleotide sequence of the albumin mrna has also perfailure to remove such a propeptide does not prevent the pro- mitted us to refine the repeated homology in the triple-domain tein from being secreted; at least this is true about albumin structure of the human albumin molecule. The fact that cys-
5 74 Biochemistry: Dugaiczyk et alp ji~~~~~~~h Proc. Natl. Acad. Sci. USA 79 (1982) - _ mma Domain A)~~~~~~~~~~~~~~~~1 Doai 1 ~~~~~~~~~~~ k Domain11E { FG. 4.A ioai _iae eune n iufd odn atr fhmnsrmabmn rpedmi tutr fitra oooyi n varw.tesqec ersnsordeetdt:telvu s codn obon(7.nt h erdretsmer ftedslie bridges throughout the molecule.
6 Biochemistry: Dugaiczyk et al 290 lle His Ser Leu Leu Pro X r cys O k 2 Leu k Ser Ser 'le ;Ser Asp Gn Asn lle Tyr Ala 261 FG. 5. Autoradiogram of a DNA sequencing gel showing the region coding for the 17th and 18th cysteines of human serum albumin; the two cysteines are residues 278 and 279 and there are no other amino acids between them. teines 278 and 279 are not separated by other amino acids, as was originally thought (15), brings the structure of domain closer to the structures of the remaining two domains (Fig. 4). As nucleotide sequences of genes or mrnas become available, they prompt renewed speculations about codon usage, because some insight might be gained into rates of mutation or other evolutionary forces, from any nonrandom pattern of codons used in a given gene, or a given species. For example, analyzing published nucleotide sequence data of human a- and,b3globin genes, Modiano et al (19) noticed that when several degenerate codons specify one amino acid, the codon that gives rise to a termination codon in a one-step mutation is never used. These "dispensable pretermination codons" are avoided, it was argued (19), in order to reduce the risk to mutate to termination. Such an argument implicitly postulates that evolution is anticipatory. This argument, however, receives no support from the distribution of codons utilized on the serum albumin gene. Table 1 summarizes the prevalence ofcodons utilized for each of the amino acids in human serum albumin, including the presequence and prosequence. There is no evidence for discrimination against the seven dispensable pretermination codons: UUA, UUG, UCA, UCG, CGA, AGA, and GGA. We thank Dr. Paul C. MacDonald and Dr. Evan R. Simpson from the University of Texas Southwest Medical Center, Dallas, for kindly providing human fetal liver samples. We also thank Dr. Brian J. McCarthy and Dr. Arthur D. Riggs for critical reading of the manu- c A Proc. Natd Acad. Sci. USA 79 (1982) 75 Table 1. Codon usage in human serum albumin mrna U C A G Phe 25 Ser 3 Tyr U u Phe 10 Ser 7 Tyr 6 20 C Leu 10 Ser 6 Ter 1 Ter 0 A Leu 13 Ser 3 Ter 0 Trp 2 G Leu 19 Pro 10 His 11 Leu 7 Pro 6 His 5 Leu 3 Pro 7 Gln 11 Leu: 12 Pro 1 Gln 9 ile fle ile Met 4 Thr 7 Asn 11 4 Thr 9 Asn 6 1 Thr Thr 2 20 Val 12 Ala 31 G Val 7 Ala 14 Val 8 Ala 16 Val 16 Ala 2 Asp 25 Asp Arg 3 Arg 1 Arg 3 Arg 2 Ser 6 Ser 3 Arg 13 Arg 5 U C A G U C A G Gly 3 U Gly 3 C Gly 6 A Gly 2 G The numbers indicate the number of times the individual codons are used in the coding region of the mrna. Ter, termination. script. The artwork is by David Scarff. The work was supported by the Baylor Center for Population Research and Reproductive Biology. 1. Abelev, G.. (1971) Adv. Cancer Res. 14, Gitlin, D., Perricelli, A. & Gitlin, G. M. (1972) Cancer Res. 32, Sell, S. & Gord, D. R. (1973) mmunochemistry 10, Law, S. W. & Dugaiczyk, A. (1981) Nature (London) 291, Jagodzinski, L. L., Sargent, T. D., Yang, M., Glackin, C. & Bonner, J. (1981) Proc. NatL Acad. Sci. USA 78, Gorin, M. B., Cooper, D. L., Eiferman, F., van de Rijn, P. & Tilghman, S. M. (1981)J. Biol Chem. 256, Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter, W. J. (1979) Biochemistry 18, Taylor, J. M. & Tse, T. P. H. (1976) J. Biol Chem. 251, Laemmli, U. K. (1970) Nature (London) 227, Law, S., Tamaoki, T., Kreuzaler, F. & Dugaiczyk, A. (1980) Gene 10, Maxam, A. & Gilbert, W. (1980) Methods Enzymot 65, Sutcliffe, J. G. (1978) Nucleic Acids Res. 5, Azad, A. A. & Deacon, N. J. (1980) Nucleic Acids Res. 8, Benoist, C., O'Hare, K., Breathnach, R. & Chambon, P. (1980) Nucleic Acids Res. 8, Behrens, P. O., Spiekerman, A. M. & Brown, J. R. (1975) Fed. Proc. Fed. Am. Soc. Exp. Biol 34, 591 (abstr.). 16. Meloun, B., Moravek, L. & Kostka, V. (1975) FEBS Lett. 58, Brown, J. R. (1976) Fed. Proc. Fed. Am. Soc. Exp. Biol 35, Brennan, S. 0. & Carrell, R. W. (1978) Nature (London) 274, Modiano, G., Battistuzzi, G. & Motulsky, A. G. (1981) Proc. Natl Acad. Sci. USA 78,
Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More informationwww.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations
More informationLezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationThr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationExpression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationNational PHL TB DST Reference Center PSQ Reporting Language Table of Contents
PSQ Reporting Language Table of Contents Document Page Number PSQ for Rifampin 2-6 Comparison table for rpob Codon Numbering 2 rpob mutation list (new numbering system) 3-5 rpob interpretations 6 PSQ for
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationCreation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein
Supplementary Information Creation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein Seiji Sakamoto,* Mika Terauchi, Anna Hugo, Tanner Kim, Yasuyuki Araki and Takehiko Wada*
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationGenomic Sequence Analysis using Electron-Ion Interaction
University of Aizu, Graduation Thesis. March, 25 s1985 1 Genomic Sequence Analysis using Electron-Ion Interaction Potential Masumi Kobayashi s1985 Supervised by Hiroshi Toyoizumi Abstract This paper proposes
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationINTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE
The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationIntroduction to Bioinformatics Dr. Robert Moss
Introduction to Bioinformatics Dr. Robert Moss Bioinformatics is about searching biological databases, comparing sequences, looking at protein structures, and more generally, asking biological questions
More informationFROM DNA TO GENETIC GENEALOGY Stephen P. Morse
1. GENES, CHROMOSOMES, AND DNA Chromosomes FROM DNA TO GENETIC GENEALOGY Stephen P. Morse (steve@stevemorse.org) Every human cell = 46 chromosomes (1 to 22 in pairs, 2 sex chromosomes) Male: sex chromosomes
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationLevel 2 Biology, 2017
91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationEvolution of protein coding sequences
Evolution of protein coding sequences Kinds of nucleo-de subs-tu-ons Given 2 nucleo-de sequences, how their similari-es and differences arose from a common ancestor? We assume A the common ancestor: Single
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationDegenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism
Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationSampling Random Bioinformatics Puzzles using Adaptive Probability Distributions
Sampling Random Bioinformatics Puzzles using Adaptive Probability Distributions Christian Theil Have 1, Emil Vincent Appel 1, Jette Bork-Jensen 1, and Ole Torp Lassen 2 1 Novo Nordisk Foundation Center
More informationANCIENT BACTERIA? 250 million years later, scientists revive life forms
ANCIENT BACTERIA? 250 million years later, scientists revive life forms Thursday, October 19, 2000 U.S. researchers say they have revived bacteria that have been dormant for more then 250 million years,
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationCONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages
CONVERGENT EVOLUTION Def n acquisition of some biological trait but different lineages Living Rock cactus Baseball plant THE QUESTION From common ancestor or independent acquisition? By Lineage By Convergence
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationNucleic Acids Research
Volume 10 Number 1 1982 VoLume 10 Number 11982 Nucleic Acids Research Nucleic Acids Research A convenient and adaptable package of DNA sequence analysis programs for microcomputers James Pustell and Fotis
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More information7.016 Problem Set 3. 1 st Pedigree
7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations
More informationA Circular Code in the Protein Coding Genes of Mitochondria
J. theor. Biol. (1997) 189, 273 290 A Circular Code in the Protein Coding Genes of Mitochondria DIDIER G. ARQUE` S* AND CHRISTIAN J. MICHEL *Equipe de Biologie The orique, Universite de Marne la Valle
More informationMolecular Level of Genetics
Molecular Level of Genetics Most of the molecules found in humans and other living organisms fall into one of four categories: 1. carbohydrates (sugars and starches) 2. lipids (fats, oils, and waxes) 3.
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationBIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks
Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationBioinformatics CSM17 Week 6: DNA, RNA and Proteins
Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure Transcription - reading the data enzyme - transcriptase gene opens
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationiclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3
Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following
More informationTRANSCRIPTION. Renáta Schipp
TRANSCRIPTION Renáta Schipp Gene expression Gene expression: - is the process by which information from a gene is used for the synthesis of gene products. These products are proteins, but in the case of
More informationAdditional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name
1 2 3 Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name Scientific name Accession number Accession number (introns) Codons
More information(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationMolecular cloning and nucleotide sequence of full-length cdna for sweet potato catalase mrna
Eur. J. Biochem. 165,437-442 (1987) 0 FEBS 1987 Molecular cloning and nucleotide sequence of full-length cdna for sweet potato catalase mrna Shigeru SAKAJO, Kenzo NAKAMURA and Tadashi ASAHI Laboratory
More informationThe combination of a phosphate, sugar and a base forms a compound called a nucleotide.
History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More information