RNA : functional role

Size: px
Start display at page:

Download "RNA : functional role"

Transcription

1 RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1

2 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying of one strand of DNA into a complementary RNA sequence by the enzyme RNA polymerase. DNA VS. gene? 2

3 From DNA to RNA Transcription key players: DNA template RNA polymerase mrna From DNA to RNA DNA Template DNA template strand: refers to the sequence of DNA that is copied during the synthesis of mrna. Coding Strand: refers to the strand with a base sequence directly corresponding to the mrna sequence. 3

4 From DNA to RNA RNA polymerase The enzyme that perform the transcription. It catalyzes the formation of the phosphodiester bonds that link the nucleotides together to form the linear RNA chain. Promoter Transcription unit Transcription 5 3 Start point RNA polymerase 5 3 Unwound DNA 5 3 DNA Initiation RNA Template strand transcript of DNA Elongation Rewound DNA The three stages of transcription: Initiation After the RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point of the template strand. Elongation The polymerase moves downstream, unwinding the RNA transcript 5`-3`. In the wake of transcription, the DNA strands re-form the double helix. 5 3 RNA transcript 5 Termination Completed RNA transcript Termination Eventually, the RNA transcript is released and the polymerase detaches from the DNA. It happens when the polymerase encounters a terminator. 4

5 The Chain elongation Reaction RNA polymerase catalyzes chain elongation by a mechanism almost identical to the one used by DNA polymerase. The Chain elongation Reaction RNA polymerase catalyses a nucleophilic attack by the 3`-OH group of the growing RNA strand on the alfa phosphorus atom of the dntp. As a result a phosphodister bond forms and pyrophosphate is released. 5

6 The Chain elongation Reaction a Phosphodister bond : A bond between a two sugar groups and a phosphate group; such bonds form the sugar-phosphate-sugar backbone of DNA and RNA. 6

7 5' capping, 3' polyadenylation, RNA splicing From DNA to RNA -RNA Processing- Post transcription 5' capping: From DNA to RNA -RNA Processing- Ensures stability of mrna during translation 7

8 RNA processing 3' polyadenylation The pre-mrna processing at the 3' end of the RNA molecule involves cleavage of its 3' end and then the addition of about 250 adenine residues to form a poly(a) tail. The poly-a tail makes the RNA molecule more stable and prevents its degradation. Additionally, the poly-a tail allows the mature messenger RNA molecule to be exported from the nucleus and translated into a protein by ribosomes in the cytoplasm RNA splicing: From DNA to RNA -RNA Processing- Splicing is a modification of the nascent premessenger RNA (pre-mrna) transcript in which introns are removed and exons are joined 8

9 Sequences within the RNA Determine Where Splicing Occurs The borders between introns and exons are marked by specific nucleotide sequences within the pre-mrnas. 5 splice site: the exon-intron boundary at the 5 end of the intron 3 splice site: the exon-intron boundary at the 3 end of the intron Branch point site: an A close to the 3 end of the intron, which is followed by a polypyrimidine tract (Py tract). 9

10 The intron is removed in a Form Called a Lariat as the Flanking Exons are joined Two successive transesterification Step 1: The OH of the conserved A at the branch site attacks the phosphoryl group of the conserved G in the 5 splice site. As a result, the 5 exon is released and the 5 -end of the intron forms a three-way junction structure. Step 2: The OH of the 5 exon attacks the phosphoryl group at the 3 splice site. As a consequence, the 5 and 3 exons are joined and the intron is liberated in the shape of a lariat. Three-way junction 10

11 RNA splicing: From DNA to RNA -RNA Processing- Alternative splicing : provide alternative transcripts from the same gene which produce multiple proteins. It increase the coding potential of the genome. Humans produce around 150,000 different proteins from their 25,000 30,000 genes. 11

12 Translation The final stage of biological information flow. The translation of mrna and the polymerization of amino acids into proteins. 12

13 The Genetic Code Codons: a sequence of three nucleotide residues in mrna or DNA that specifies a particular amino acid according to the genetic code. The Genetic Code Remember synonymous and non- synonymous mutations 13

14 The Genetic Code Standard Genetic code features: Universality the genetic code is the same in almost all living organisms, from bacteria to mammals Codons are always translated from 5 to 3. Each codon corresponds to only one amino acid. The Genetic Code There are multiple codons for most amino acids Degenerate. For example for Serine there are six codons. Four from glycine, two for lysine. (why this is important?) Different codons that specify the same amino acid are known as synonymous. The only amino acids with single codon are methonine and tryptophan. 14

15 The Genetic Code Only 61 of the 64 codons specify amino acids. The three remaining codons (UAA, UGA, UAG) are termination codons or stop codons. These codons are not recognized by any trna molecule. Methionine codon AUG also specifies the initiation site for protein synthesis Initiation codon. Three main elements mrna Transfer RNA (trna) Ribosomes Translation 15

16 trna They are the crucial links between the mrna sequence and the sequence of amino acids in the polypeptide. There is a specific trna for each amino acid. Transfer RNA trna look like threelobed cloverleaf due to base pairing between complementary nucleotides on different regions of each trna molecule causing it to fold 16

17 trna Structure Amino Acid stem The Amino acid is covalently attached to the 3 of this stem Anticodon Arm Anticodon The anticodon sequence is written in the 3 to 5 direction. 17

18 trna Anticodons with mrna codons trna and mrna interacts through base pairing between anticodons and codons. Base pairing follows Watson-Crick rules with exceptions!! Wobble position The codon must form watson-crick base pairs with the 3 and middle bases of the anticodon. BUT, other types of base pairing are permitted at 5 position of the anticodon. This postion is called Wobble Position. 18

19 Wobble position I : Inosine Wobble position 19

20 Peptide Synthesis Aminoacyl-tRNA Synthetases In Aminoacylation a particular amino acid is covalently attached to the 3 end of each trna molecule. The product of this reaction is called an aminoacyl-trna. 20

21 In step 1, an O atom of the amino acid a- carboxyl attacks the P atom of the initial phosphate of ATP. In step 2, the 3' OH of the terminal adenosine of trna attacks the amino acid carbonyl C atom. Aminoacyl-tRNA Synthetase - summary: 1. amino acid + ATP aminoacyl-amp + PP i 2. aminoacyl-amp + trna aminoacyl-trna + AMP 21

22 Ribosomes They are composed of: Ribosomal RNA Protein 22

23 Ribosome Composition (S = sedimentation coefficient) Ribosome Source Whole Ribosome Small Subunit prokaryotic 70S 30S 16S rrna 21 proteins Eukaryotic 80S 40S 18S rrna 33 proteins Large Subunit 50S 23S & 5S rrnas 31 proteins 60S 28S, 5.8S, &5S rrnas 49 proteins Eukaryotic cytoplasmic ribosomes are larger and more complex than prokaryotic ribosomes. 23

24 Ribosomes Ribosomes have two Aminoacyl-tRNA Sites: A site P site Initiation of Translation The first codon is usually AUG. There are at least two types of trna that recognize AUG codon. One of them is used exclusively for initiation of translation and is called Initiator trna. 24

25 Chain elongation Peptidyl Transferase Enzymatic activity of large ribosomal subunit. It catalyzes peptide bond formation. Termination of translation Initiated by termination codons (UGA, UAG, UAA) at A site. These codons are not recognized by trna so protein synthesis stall. Release factors bind to the A site. And the whole complex will get disassociated. 25

26 mrna trna rrna Types of RNA 26

27 27

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

From RNA To Protein

From RNA To Protein From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose

More information

Translation BIT 220 Chapter 13

Translation BIT 220 Chapter 13 Translation BIT 220 Chapter 13 Making protein from mrna Most genes encode for proteins -some make RNA as end product Proteins -Monomer Amino Acid 20 amino acids -peptides -polypeptides -Structure of Amino

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Transcription steps. Transcription steps. Eukaryote RNA processing

Transcription steps. Transcription steps. Eukaryote RNA processing Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

Year Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein.

Year Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. DNA Year 1920 Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. Which one actually carries the genetic information? The stuff that gets passed on from generation

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Q. No. 1. How can RNA be distinguished from DNA?

Q. No. 1. How can RNA be distinguished from DNA? Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,

More information

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

PROTEIN SYNTHESIS. Higher Level

PROTEIN SYNTHESIS. Higher Level PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 13 Protein Synthesis 2 3 4 5 6 7 8 9 10 Are You Getting It?? Which properties are characteristic of the normal genetic code? (multiple answers) a) A

More information

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1 Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

The Central Dogma. DNA makes RNA makes Proteins

The Central Dogma. DNA makes RNA makes Proteins The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF

More information

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

DNA, RNA, and PROTEIN SYNTHESIS

DNA, RNA, and PROTEIN SYNTHESIS DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein. AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Translation Mechanisms

Translation Mechanisms Translation Mechanisms Biology I Hayder A. Giha Translation The translation is the process of protein synthesis, where information in nucleotides sequences of a mrna is translated into amino acids sequence

More information

From Gene to Protein

From Gene to Protein Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

AP Biology

AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

From Gene to Protein. Chapter 17

From Gene to Protein. Chapter 17 From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?

DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information? DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits

More information

الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1

الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1 الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء 222Cell Biolgy 1 Lecture 14 222Cell Biolgy 2 DNA replication DNA replication is a semi-conservative

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information