School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou , P.R.China
|
|
- Benjamin Benson
- 6 years ago
- Views:
Transcription
1 Sequence-specific recognition of double-stranded DNA with molecular beacon with the aid of Ag + under neutral ph environment Zhiyou Xiao, Xiaoting Guo, Liansheng Ling * School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou , P.R.China Chemicals and materials MB and all other oligonucleotides were obtained from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). All chemicals were analytical reagent grade and used without further purification. Nanopure water (18.1 MΩ) was obtained from a 350 Nanopure water system (Guangzhou Crystalline Resource Desalination of Sea Water and Treatment Co. Ltd.) and was used for all experiments. MB stock solutions (100μΜ) were prepared by solving MB in nanopure water and stored in the dark at -20. The working solution of 5.0 μμ MB was obtained by diluting the stock solution with 20 mm PBS buffer (ph 7.4) and quantified by using UV-vis absorption spectroscopy according to the following extinction coefficients (ε 260nm, M -1 cm -1 ): A= 15400, G= 11500, C= 7400, T= The target dsdna and control dsdna were prepared by annealing equi-molar concentrations of the corresponding complementary single-stranded DNA. Measurement of fluorescence spectrum 10 μl of 5.0 μμ MB were mixed with 490 μl PBS buffer solution that contained different amounts of target dsdna, after 1.5 hours of incubation (25 ), the * To whom correspondence should be addressed. Tel: ; cesllsh@mail.sysu.edu.cn
2 fluorescence signal was measured with a RF-5301PC spectrofluorimeter (Shimadzu, Japan). Slit widths were both 5.0 nm, the excitation and emission wavelengths were set at 495 and 518 nm, respectively. Measurement of CD spectroscopy The circular dichroism (CD) spectroscopy was obtained with a J S spectropolarimeter (JASCO International CO. Ltd., Japan) at room temperature. The measurement was performed over the wavelength range from 200 to 350 nm in 0.1 cm path length cuvettes. The result was obtained by averaging 3 scans at the scanning rate of 100 nm per minute with a response time of 1.0 s and the bandwidth of 1.71 nm. Results The recognition of dsdna depended on the concentration of spermine and Ag +, ph environment and incubation time. Therefore, the effect of these factors were investigated, it was estimated with the change of fluorescence intensity (ΔI), which was defined as ΔI = I target dsdna - I no target dsdna (here I target dsdna denotes the fluorescence intensity of the MB in the presence of target dsdna, and I no target dsdna represents the signal in the absence of target dsdna). The fluorescence emission of MB fluorophore and formation of triplex DNA were both influenced by the ph environment, so the effect of ph value on ΔI was investigated. The ΔI increased with the ph value over the range of and reached the maximum at ph 7.4. Athough the acidic condition was favourable to the triplex formation, but it was unfavorable to the fluorescence of the FAM fluorophore, the fluorescence intensity of FAM increased with the ph value. However, the ΔI decreased tramatically when the ph value was higher than 7.4, which might be due to the reason that triplex DNA could not formed under the higher ph environment.
3 Hence, ph 7.4 was used for the research. The sensor works at neutral ph enivironment makes it possible to be applied in the measurement of DNA in cell in the future. Due to electrostatic repulsion between dsdna and MB, thereby multivalent cations such as Mg 2+ and polyamines were usually used to neutralize the negative charges of DNA for triplex formation. Here we selected spermine (H 2 N(CH 2 ) 3 NH(CH 2 ) 4 NH(CH 2 ) 3 NH 2 ) as the stabilizer, and the effect of its concentration was investigated(see ESI). The ΔI increased with the spermine concentration over the range from 0.01 to 0.30 mm, which was attributed to the stabilization property of spermine for triplex formation 1,2. However, the ΔI decreased gradually when the concentration of spermine was higher than 0.30 mm, which might be explained that excess spermine could induce DNA condensation and precipitation 3. So 0.30 mm of spermine was used in this research. Fluorescence restoration of MB depends on the hybridization between MB and target dsdna, so the fluorescence intensity might be affected by the hybridization time, and the effect of hybridization time was investigated. The ΔI increased with the hybridization time over the range of 0-90 minutes, and reached a platform after 90 minutes. Therefore, 90 minutes was selected for the hybridization time. Figure S1 Circular dichroism spectroscopy of MB, target dsdna and their mixture in
4 20 mm PBS buffer (ph 7.4) containing 0.30 mm spermine. 45mins of incubation time a. 7.5 μm of unlabeled MB; b. 7.5 μm of target dsdna; c. a + b ; d. c μm Ag +. Figure S2 Effect of ph on ΔI. Experimental conditions: 100 nm of MB, 50 nm of target dsdna, 15.0 mm of NaNO 3, 0.30 mm of spermine, 0.40 μm of Ag +, 1.5 hours of incubation time.
5 Figure S3 The effect of spermine concentration on the ΔI. 20 mm of PBS (ph 7.4), 100 nm of MB, 50 nm of target dsdna, 15.0 mm of NaNO 3, 0.40 μm of Ag +, 1.5 hours of incubation time. Figure S4 Effect of the concentration of Ag + on the ΔI. 20 mm of PBS (ph 7.4), 100 nm of MB, 50 nm of target dsdna, 15.0 mm of NaNO 3, 0.30 mm of spermine, 1.5 hours of incubation time.
6 Figure S5 Effect of incubation time on the ΔI. 20 mm of PBS (ph 7.4), 100 nm of MB, 50 nm of target dsdna, 15.0 mm of NaNO 3, 0.30 mm of spermine, 0.40 μm of Ag +. Reference 1 L. S. Ling, H. J. Butt and R. Berger, J. Am. Chem. Soc., 2004, 126, H. L. Yan, C. Xiong, H. Yuan, Z. X. Zeng and L. S. Ling, J Phys Chem C, 2009, 113, M. Saminathan, T. Antony, A. Shirahata, L. H. Sigal, T. Thomas and T. J. Thomas, Biochemistry, 1999, 38,
Supporting Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Supporting Information Integration of Graphene Oxide and DNA as Universal Platform
More informationElectronic Supporting information (ESI)
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supporting information (ESI) Hairpin DNA Probes Based on Target-induced in situ Generation
More informationSupporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions
Supporting Information DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Wei Tang, Huaming Wang, Dingzhong Wang, Yan Zhao, Na Li, and Feng Liu* Beijing National
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 214 Electronic Supplementary Information Construction of DNA logic gates utilizing an H + /Ag + induced
More informationBerberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) Berberine as a novel light-up i-motif fluorescence ligand
More informationElectronic Supplementary Information
Electronic Supplementary Information Fluorescence Turn-On Detection of a Protein through the Displaced Single-Stranded DNA Binding Protein Binding to a Molecular Beacon Dan Tang, abc Dongli Liao, ab Qiankun
More informationSupplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationcatalytic hairpin DNA assembly for dual-signal amplification toward homogenous analysis of protein and
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Programmable Mg 2+ -dependent DNAzyme switch by the catalytic hairpin DNA
More informationRandomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Randomly arrayed G-rich DNA sequence for label-free and realtime assay of enzyme activity Zhuoliang
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information dsdna-templated fluorescent copper nanoparticles: poly(at-
More informationSupplementary Information. Binding-responsive catalysis of Taq DNA polymerase for sensitive. and selective detection of cell-surface proteins
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Information Binding-responsive catalysis of Taq DNA polymerase for sensitive and
More informationA nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations
Supporting Information for A nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations Xin Su, Chen Zhang, Xianjin Xiao, Anqin Xu, Zhendong Xu
More informationAn anti-galvanic replacement reaction of DNA templated silver. nanoclusters monitored by light-scattering technique
Electronic Supplementary Information An anti-galvanic replacement reaction of DNA templated silver nanoclusters monitored by light-scattering technique Guoliang Liu, a Da-Qian Feng, a Wenjie Zheng, a Tianfeng
More informationQuantitative Evaluation of the Ability of Ionic Liquids to Offset the Cold- Induced Unfolding of Proteins
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2014 Supplimentary informations Quantitative Evaluation of the Ability of Ionic Liquids
More informationHomogenous electrochemical aptamer-based ATP assay with. signal amplification by exonuclease III assisted target recycling
Supporting Information Homogenous electrochemical aptamer-based ATP assay with signal amplification by exonuclease III assisted target recycling Shufeng Liu, a Ying Wang, a Chengxin Zhang, a Ying Lin a
More informationSupporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez
Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Multiple advanced logic gates made of DNA-Ag nanocluster
More informationG-quadruplexes light up localized DNA circuits.
G-quadruplexes light up localized DNA circuits. Oscar Mendoza,*,, Jean-Louis Mergny,, Jean-Pierre Aimé, and Juan Elezgaray*,, Univ. Bordeaux, 33600 Bordeaux, France CBMN, CNRS UMR-5248, F-33600 Pessac,
More informationDisassembly of gold nanoparticle dimers for colorimetric
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2015 Disassembly of gold nanoparticle dimers for colorimetric determination of ochratoxin
More informationElectronic Supplementary Information. Enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Enzyme-free catalytic DNA circuit for amplified detection
More informationIsothermal amplification system based on template-dependent extension
Electronic Supplementary Information (ESI) Isothermal amplification system based on template-dependent extension 1. Experimental Section The molecular beacon (Takara Biotechnology Co., Ltd. Dalian, China)
More informationKinetically Grafting G-quadruplex onto DNA Nanostructure as Structure and. Function Encoding via DNA Machine
Supporting information Kinetically Grafting G-quadruplex onto DNA Nanostructure as Structure and Function Encoding via DNA Machine Jiangtao Ren a, b, Jiahai Wang *a, Lei Han a, b, Erkang Wang *a and Jin
More informationThe yield of transcripts for RNA polymerase regulated by hairpin structures in nascent RNA
Supporting Information The yield of transcripts for RNA polymerase regulated by hairpin structures in nascent RNA Satoru Nagatoishi a, Ryoya Ono b, Naoki Sugimoto a,b * a Frontier Institute for Biomolecular
More informationReversible Molecular Switching of Molecular Beacon: Controlling DNA Hybridization Kinetics and Thermodynamics Using Mercury(II) Ions
Supporting Information: Reversible Molecular Switching of Molecular Beacon: Controlling DNA Hybridization Kinetics and Thermodynamics Using Mercury(II) Ions Ronghua Yang, Jianyu Jin, Liping Long, Yongxiang
More informationElectronic Supplementary Information (ESI) for
Electronic Supplementary Information (ESI) for Multicolor Fluorescent Biosensor for Multiplexed Detection of DNA Rong Hu, 1, 2 Tao Liu, 1 Xiao-Bing Zhang 1 *, Shuang-Yan Huan 1, Cuichen Wu 2, Ting Fu 1,
More informationA Cell-Surface-Anchored Ratiometric I-Motif Sensor for. Extracellular ph Detection
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 216 Electronic Supplementary Information (ESI) A Cell-Surface-Anchored Ratiometric I-Motif Sensor for
More informationFacile synthesis of red-emitting lysozyme-stabilized Ag nanoclusters
Electronic Supplementary Information on Facile synthesis of red-emitting lysozyme-stabilized Ag nanoclusters Tingyao Zhou, a Yunhe Huang, a Zhimin Cai, a Feng Luo, c Chaoyong James Yang* a, and Xi Chen*
More informationSupporting Information. A one-step sensitive dynamic light scattering method for. adenosine detection using split aptamer fragments
Supplementary Material (ESI) for Analytical Methods This journal is (c) The Royal Society of Chemistry 2011 Supporting Information for A one-step sensitive dynamic light scattering method for adenosine
More informationG-Quadruplex formation using fluorescent oligonucleotide as a detection method for discriminating AGG trinucleotide repeats
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 1 Electronic Supplementary Information G-Quadruplex formation using fluorescent oligonucleotide as a
More informationSupporting Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information An enzyme-free molecular catalytic device: dynamically self-assembled
More informationElectronic supplementary information (ESI) Kinetic Study of DNA Hybridization on DNA-modified Gold Nanoparticles. with Engineered Nano-Interfaces
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic supplementary information (ESI) Kinetic Study of DNA Hybridization on DNA-modified
More informationCharacterization of G4-G4 crosstalk in c-kit promoter region
Supplementary information Characterization of G4-G4 crosstalk in c-kit promoter region Riccardo Rigo #, Claudia Sissi #,* # Department of Pharmaceutical and Pharmacological Sciences, University of Padova,
More informationOne-Electron Oxidation of DNA: Thymine versus Guanine Reactivity
One-Electron Oxidation of DNA: Thymine versus Guanine Reactivity Sriram Kanvah and Gary B Schuster SUPPORTING INFORMATION EXPERIMENTAL PROCEDURES T4 polynucleotide Kinase (T4 PNK) was purchased from New
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
More informationIn situ semi-quantitative assessment of single cell viability by resonance
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) In situ semi-quantitative assessment
More informationA highly selective G-quadruplex-based luminescent switch-on probe for the detection of gene deletion
Electronic Supporting Information A highly selective G-quadruplex-based luminescent switch-on probe for the detection of gene deletion Hong-Zhang He, a Daniel Shiu-Hin Chan, a Chung-Hang Leung* b,c and
More informationSupplementary Information
Supplementary Information Nonlinear optical dye TSQ1 as an efficiently selective fluorescent probe for G-quadruplex DNA Yuqi Chen a, Shengyong Yan a, Libo Yuan a, Weng* a and Xiang Zhou* a b Yimin Zhou
More informationLab 1: Ensemble Fluorescence Basics
Lab 1: Ensemble Fluorescence Basics This laboratory module is divided into two sections. The first one is on organic fluorophores, and the second one is on ensemble measurement of FRET (Fluorescence Resonance
More informationSupporting Information. Self-constructing G-quadruplex From AGG Trinucleotide Repeats
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Supporting Information A Novel Nucleic Acid Aptamer Tag: A Rapid Fluorescent Strategy Using A Self-constructing
More informationElectronic Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supporting Information Phosphorylation-Induced Hybridization Chain Reaction on Beads:
More informationElectronic Supplementary Information
Electronic Supplementary Information Pt Nanoparticles Decorated with a Discrete Number of DNA Molecules for Programmable Assembly of Au/Pt Bimetallic Superstructures Yulin Li, Yuanqin Zheng, Ming Gong,
More informationElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) Ultra-pH-responsive split i-motif based aptamer anchoring
More informationSupporting Information. Glutathione-stabilized fluorescent gold nanoclusters vary in their
Supporting Information Glutathione-stabilized fluorescent gold nanoclusters vary in their influences on the proliferation of pseudorabies virus and porcine reproductive and respiratory syndrome virus Yanli
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong
More information3-Input Majority Logic Gate and Multiple Input Logic Circuit Based on DNA Strand Displacement
Supporting Information for 3-Input Majority Logic Gate and Multiple Input Logic Circuit Based on DNA Strand Displacement Wei Li, Yang Yang, Hao Yan, Yan Liu Department of Chemistry and Biochemistry and
More informationLow Background D-A-D Type Fluorescent Probe for Imaging of Biothiols
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Electronic supplementary information Low Background D-A-D Type Fluorescent
More informationRatio and Spectral Scanning
A p p l i c a t i o n N o t e Micro-Volume Purity Assessment of Nucleic Acids using Ratio and Spectral Scanning Peter Brescia, BioTek Instruments, Inc., Winooski, VT A common method to determine the purity
More informationElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A label free fluorescent assay for uracil-dna glycosylase
More informationAnaTag 5-FAM Protein Labeling Kit
AnaTag 5-FAM Protein Labeling Kit Catalog # 72053 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate 5-FAM SE (5-carboxyfluorescein) to proteins (e.g., IgG). It provides ample materials
More informationCharacterization and Application to the Detection of Single-Stranded DNA Binding Protein of Fluorescent DNA-Templated Copper/Silver Nanoclusters
Electronic Supplementary Information for Characterization and Application to the Detection of Single-Stranded DNA Binding Protein of Fluorescent DNA-Templated Copper/Silver Nanoclusters Guo-Yu Lan, a Wei-Yu
More informationA novel label-free cascade amplification strategy based dumbbell. probe-mediated rolling circle amplification-responsive
A novel label-free cascade amplification strategy based dumbbell probe-mediated rolling circle amplification-responsive G-quadruplex formation for highly sensitive and selective detection of NAD + or ATP
More informationA novel fluorescent probe for Hg 2+ detection in a wide ph range and its application in living cell imaging
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information A novel fluorescent probe for Hg 2+ detection in
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Direct Detection of Circulating MicroRNA in Cancer Patient
More informationHigh-Pressure Circular Dichroism Spectroscopy up to 400 MPa Using Polycrystalline Yttrium Aluminum Garnet (YAG) as Pressure-Resistant Optical Windows
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Supplementary Information for High-Pressure Circular Dichroism Spectroscopy up to 400 MPa Using
More informationSupporting Information
Supporting Information Ultrasensitive Electrochemiluminescence Biosensor for MicroRNA Detection by 3D DNA Walking Machine Based Target Conversion and Distance-Controllable Signal Quenching and Enhancing
More informationObtaining More Accurate Signals: Spatiotemporal Imaging of Cancer Sites Enabled by a Photoactivatable Aptamer-Based Strategy
Supporting Information Obtaining More Accurate Signals: Spatiotemporal Imaging of Cancer Sites Enabled by a Photoactivatable Aptamer-Based Strategy Heng Xiao,,, Yuqi Chen,, Erfeng Yuan,, Wei Li, Zhuoran
More informationSupplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates
Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization
More informationEffective construction of AuNPs-DNA system for the. implementation of various advanced logic gates
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Effective construction of AuNPs-DNA system for the implementation of various advanced logic
More informationEfficient enzyme-powered micromotor device fabricated by a cyclic alternate hybridization assembly for DNA detection
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Efficient enzyme-powered micromotor device fabricated by a cyclic alternate hybridization assembly
More informationSupporting Information
Supporting Information Wiley-VCH 27 6945 Weinheim, Germany Helical arrangement of interstrand stacked pyrenes in a DNA framework. Vladimir Malinovskii, Florent Samain and Robert Häner Contents: Experimental
More informationIntroduction. Technical Note
DNA and RNA quantification: fast and simple with PicoGreen dsdna and RiboGreen RNA quantification reagents Fluorescence intensity on Infinite F2 and Infinite M2 Introduction DNA quantification Detection
More informationThree. hree-dimensional DNA Amplifier Able to Function. Living. Cells
Supporting Information An mrna-initiated, Three hree-dimensional DNA Amplifier Able to Function Inside Living Cells Lei He, Danqing Lu, Hao Liang, Sitao Xie, Xiaobing Zhang, Qiaoling Liu, Quan Yuan, *
More informationSupporting Information. Molecular engineering of a dual emission near-infrared ratiometric fluorophore for detection of ph at the organism level
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2015 Supporting Information Molecular engineering of a dual emission near-infrared ratiometric fluorophore
More informationIn Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1
This journal is The Royal Society of Chemistry 213 In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1 Dong-Dong Zheng, a Dong Pan, a Xiao Zha, ac Yuqing Wu,* a Chunlai
More informationA Quick-responsive DNA Nano-Device for Bio-molecular Homeostasis Regulation
Supplementary Information A Quick-responsive DNA Nano-Device for Bio-molecular Homeostasis Regulation Songlin Wu, Pei Wang, Chen Xiao, Zheng Li, Bing Yang, Jieyang Fu, Jing Chen, Neng Wan, Cong Ma, Maoteng
More informationSupplementary Information
Supplementary Information Functional isodna aptamers: Modified thrombin binding aptamers with -5 -linked sugar phosphate backbone (isotba) Anita D. Gunjal, Moneesha Fernandes, Namrata D. Erande, P. R.
More informationHeat-Set Gels and Egg-Like Vesicles Using Two-Component Gel System Based on Chiral Calix[4]arenes
Supplementary Information Heat-Set Gels and Egg-Like Vesicles Using Two-Component Gel System Based on Chiral Calix[4]arenes Jin-Lan Zhou, Xian-Jie Chen and Yan-Song Zheng * Department of Chemistry and
More informationAnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit
AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit Catalog # 72044 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 750 SE to proteins (e.g., IgG). It provides ample
More informationBenzothiazole Sulfinate: a Water Soluble and Slow Releasing Sulfur Dioxide Donor
Benzothiazole Sulfinate: a Water Soluble and Slow Releasing Sulfur Dioxide Donor Supporting Information Jacob J. Day, a, Zhenhua Yang, b, Wei Chen, a Armando Pacheco, a and Ming Xian a,b, * a Department
More informationAnaTag HiLyte Fluor 647 Protein Labeling Kit
AnaTag HiLyte Fluor 647 Protein Labeling Kit Catalog # 72049 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647 SE to proteins (e.g., IgG). It provides ample materials
More informationSupplementary information. Quantifying the Degree of Aggregation from Fluorescent. Dye-Conjugated DNA Probe by Single Molecule
Supplementary information Quantifying the Degree of Aggregation from Fluorescent Dye-Conjugated DNA Probe by Single Molecule Photobleaching Technology for the Ultra-sensitive Detection of Adenosine Xingbo
More informationAptamer-Based FRET Nanoflares for Imaging Potassium Ions. in Living Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) Aptamer-Based FRET Nanoflares for Imaging Potassium
More informationOn-chip Selective Capture of Cancer Cells and. Ultrasensitive Fluorescence Detection of. Survivin mrna in Single Living Cell
Supporting Information On-chip Selective Capture of Cancer Cells and Ultrasensitive Fluorescence Detection of Survivin mrna in Single Living Cell Xiang-Ling Li, Shu Shan, Meng Xiong, Xing-Hua Xia, Jing-Juan
More informationMulti-pathogen Screening and/or Confirmation via Microarray Detections. Bruce Applegate, Sergei Savikhin and Michael Kane
Multi-pathogen Screening and/or Confirmation via Microarray Detections Bruce Applegate, Sergei Savikhin and Michael Kane Multiplex PCR Detect multiple target DNA sequences Multiple organism detection Reduction
More informationDynamic light scattering (DLS)-based immunoassay for. ultrasensitive detection of tumor marker protein
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Dynamic light scattering (DLS)-based immunoassay for ultrasensitive detection of
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationElectronic Supplementary Information. Target-induced Intermolecular Hybridization
Electronic Supplementary Information The Real-time PCR for Sensitive Protein Detection by Target-induced Intermolecular Hybridization Cuiping Ma a, Lijie Cao a, Chao Shi a *and Naihao Ye b * a State Key
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationTable S1. Sequences of the DNA used in this study. Sequence (5' 3')
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information Portable and Quantitative Monitoring of Mercury Ions Using DNA-capped
More informationExtraction of DNA staining dyes from DNA using hydrophobic ionic liquids
Electronic Supplementary Information Extraction of DNA staining dyes from DNA using hydrophobic ionic liquids Imran Khimji, Krystina Doan, Kiara Bruggeman, Po-Jung Jimmy Huang, Puja Vajha, and Juewen Liu*
More informationSupporting Information. for. Cryogenic Fluorescence Localization Microscopy of Spectrally Selected Individual FRET Pairs in a Water Matrix
Supporting Information for Cryogenic Fluorescence Localization Microscopy of Spectrally Selected Individual FRET Pairs in a Water Matrix Hiroaki Tabe, Kei Sukenobe, Toru Kondo, Atsunori Sakurai, Minako
More informationFluorescent Detection of Methylmercury by Desulfurization. Reaction of Rhodamine Hydrazide Derivatives
Electronic Supplementary Information Fluorescent Detection of thylmercury by Desulfurization Reaction of Rhodamine Hydrazide Derivatives Young-Keun Yang, Sung-Kyun Ko, Injae Shin* and Jinsung Tae* General
More informationSupplementary Information. Silver Nanoclusters Beacon as Stimuli-Responsive Versatile. Platform for Multiplex DNAs Detection and
Supplementary Information Silver Nanoclusters Beacon as Stimuli-Responsive Versatile Platform for Multiplex DNAs Detection and Aptamer-substrate Complexes Sensing Guoliang Liu,,, Jingjing Li,, Da-Qian
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationGenova Nano. Micro-volume Spectrophotometer
Genova Nano Micro-volume Spectrophotometer This spectrophotometer is dedicated to life science analysis. It is fitted with a micro-volume accessory enabling micro-volume samples to be pipetted directly
More informationMnO 2 -Nanosheet-Modified Upconversion Nanosystem for Sensitive Turn-On Fluorescence Detection of H 2 O 2 and Glucose in Blood
Supporting Information MnO 2 -Nanosheet-Modified Upconversion Nanosystem for Sensitive Turn-On Fluorescence Detection of H 2 O 2 and Glucose in Blood Jing Yuan, Yao Cen, Xiang-Juan Kong, Shuang Wu, Chen-Liwei
More informationInvestigation of dendrimers functionalized with eosin as macrophotoinitiators for polymerization-based signal amplification reactions
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Investigation of dendrimers functionalized with eosin as macrophotoinitiators
More informationHighly efficient detection of hydrogen peroxide in solution and in the vapor phase via fluorescence quenching
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information for Highly efficient detection of hydrogen peroxide in solution
More informationSupporting information
Supporting information Large Hollow Cavity Luminous Nanoparticles with Near-Infrared Persistent Luminescence and Tunable Sizes for Tumor Afterglow Imaging and Chemo/Photodynamic Therapies Jun Wang, Jinlei
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Multiplexed Detection of Lung Cancer Cells at the Single-Molecule
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationElectronic Supplementary Information
Electronic Supplementary Information An Affinity Capture Involved Enzymatic Assay for Thrombin by Using Peptide Aptamer as Affinity Ligands on Magnetic Beads Qiang Zhao a* Jie Gao b Research Center for
More informationprotocol DNaseAlert Substrate Nuclease Detection System User Manual molecular biology reagents See what we can do for you at
molecular biology reagents protocol DNaseAlert Substrate Nuclease Detection System User Manual See what we can do for you at www.idtdna.com. For Research Use Only. (14-01-01-13) protocol molecular biology
More informationSUPPLEMENTARY INFORMATION
Electronic Supplementary Material (ESI) for ChemComm. Chemical Communications. This journal is The Royal Society of Chemistry 2014 SUPPLEMENTARY INFORMATION Single primer-triggered isothermal amplification
More informationRetention of nisin activity at elevated ph in an organic acid complex and gold nanoparticle composite
Retention of nisin activity at elevated ph in an organic acid complex and gold nanoparticle composite Manab Deb Adhikari, a Gopal Das, *,b and Aiyagari Ramesh *,a a Department of Biotechnology, Indian
More informationHierarchical manganese dioxide nanoflowers enable accurate ratiometric fluorescence enzyme-linked immunosorbent assay
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 Hierarchical manganese dioxide nanoflowers enable accurate ratiometric fluorescence enzyme-linked
More informationA Fluorescence turn-on chemodosimeter for selective detection of Nb 5+ ions in mixed aqueous media
Electronic Supporting Information A Fluorescence turn-on chemodosimeter for selective detection of b 5+ ions in mixed aqueous media Abhishek Kumar Gupta, Abhimanew Dhir, Chullikkattil P. Pradeep* School
More informationSupporting Information for
Supporting Information for Building Electromagnetic Hot Spots in Living Cells via Target-Triggered Nanoparticle Dimerization Wen Zhou, 1,2 Qiang Li, 1 Huiqiao Liu, 1 Jie Yang, 1 Dingbin Liu 1,2 * 1. College
More informationSupporting Information. A Real-Time Surface Enhanced Raman Spectroscopy Study of Plasmonic Photothermal Cell Death Using Targeted Gold Nanoparticles
Supporting Information A Real-Time Surface Enhanced Raman Spectroscopy Study of Plasmonic Photothermal Cell Death Using Targeted Gold Nanoparticles Mena Aioub and Mostafa A. El-Sayed* Laser Dynamics Laboratory,
More informationSupplementary Information. Facile fabrication of microsphere-polymer brush hierarchically. three-dimensional (3D) substrates for immunoassays
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information Facile fabrication of microsphere-polymer brush hierarchically three-dimensional
More information