Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010!

Size: px
Start display at page:

Download "Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010!"

Transcription

1 Using the Potato Genome Sequence! Robin Buell! Michigan State University! Department of Plant Biology! August 15, 2010! 1

2 Whole Genome Shotgun Sequencing 2

3 New Technologies Revolutionize Sequencing -Very high throughput -Very inexpensive -Usher in era of personal genomics & post-genomic biology genomes genera 3

4 So, you say you can sequence-now what? 4

5 Assemble Fragments SEQUENCER OUTPUT OF RANDOM FRAGMENTS AGCTCGCTAGCTA CTCGCTAGCTAG Gene 1 Gene 2 Gene 3 TAGCTAGC AGCTAGGCTC CTAGCTAGCTAGGCTC AGCTAGC AGCTCGCTA Annotate GCTAGCTAGC ASSEMBLE FRAGMENTS INTO A CONSENUS SEQUENCE *Using Computer AGCTCGCTAGCTAGCTAGCTAGCTAGGCTC GCTAGCTAGC AGCTCGCTAGCTA TAGCTAGC TAGCTAGCTA AGCTCGCTA GCTAGCTAGCT CTCGCTAGCTAG AGCTAGC CTAGCTAGCTAGGCTC AGCTAGGCTC 5

6 Participants have their own grants and financing Data are freely available US funding through National Science Foundation 6

7 With so many potatoes with lots of variation-what should be sequenced? Darth Tater 7

8 RH (RH): a diploid heterozygous genotype genetic map (SH x RH), >10,000 markers Least heterozygous parent Physical map Sanger sequencing; BAC- by- BAC strategy ~6,000 BACs for full coverage 8

9 RHPOTKEY BAC library (78000 clones; 9-10 g.e.) Library clones fingerprinted with AFLP BAC fingerprints aligned into 6400 contigs 1600 BAC contigs anchored to RH AFLP map 9

10 Approx BACs have been sequenced Chromosome 5: ~80% Chromosomes 1, 6 & 9: ~30% Relatively short tiling paths for some LGs Issues due to heterozygosity Slow and uneven progress WGS using NextGen Sequencing? 10

11 Initial Strategy heterozygous clone (RH ) Contig assembly issues 2 divergent haplotypes Revised Strategy (2008 onwards) homozygous genotype (DM R44) Reduced assembly issues 1 haplotype

12 Doubled monoploid line DM R44 of adapted Solanum tuberosum Group Phureja (from Richard Veilleux, Virginia Tech, USA) Reduced complexity for whole genome shotgun sequencing due to homozygosity Taxonomic study (Spooner et al. 2007) suggest it is same species as S. tuberosum Very slow growing, presumably due to increased genetic load caused by exposure of inferior alleles to environment and homozygosity 12

13 Whole Genome Shotgun of two genotypes - RH (RH) diploid heterozygote - DM R44 (DM) diploid homozygote Illumina short read + Roche WGS RNA seq: transcriptome resource For DM; BAC end and Fosmid end sequencing (Sanger)long- range scaffolding) 13

14 Genome estimated to be ~850 Million bases Assembled size ~730 Mb QC on assembly suggests it is of high quality Compare DM BAC sequences with assembly Also use paired end sequence Assembly v3 looks good 14

15 PGSC Mapping group several partners mapping assembly to new map using different sequence- based marker types: SNP, SSR, DArT In silico anchoring using RH WGP, PoMaMo & SGN maps Target: - >90% of assembly anchored to genetic map 15

16 16

17 What are we interested in annotating? Genes where, what, when -Annotated ~40,000 genes -Used deep transcriptome sequencing (45 libraries from RH and DM) to annotate genes and determine expression profiling patterns -In the process of refining the annotation; some made available now 17

18 Still in the process of fixing some assembly and annotation issues 18

19 19

20 Using the potato genome sequence! Access: Agree to the Data Access Agreement -BLAST against your query sequence -Download the mfasta file of scaffolds -View genome through the Genome Browser 20

21 In Class Exercise Reads > Contigs/Scaffolds (PGSC0003DMS) > Super Contigs/Super Scaffolds (PGSC0003DMB) Intro to PGSC Link to Data Test Sequence: Rubisco: GenBank Accession # J Google ncbi entrez Download (or copy) as a fasta formatted sequence

22 Lets BLAST this gene against v3 of the DM assembly Go to BLAST page: Paste sequence, Select blastn Get alignment hits (PGSC0003DMS Length = 311,235); look at the alignment (see gapped alignment) *Note there is a paralog present in the DM genome (second best hit) Find this scaffold on the Genome Browser. NOTE THE GENOME BROWSER IS SUPERSCAFFOLD (SUPERCONTIG) based. Paste PGSC0003DMS in the Landmark box, hit return Zoom out to 1 MB to get a perspective of this scaffold/contig to other scaffolds/contigs NOTE THE SCAFFOLDS/CONTIGS CAN BE PLACED IN EITHER ORIENTATION IN SUPERSCAFFOLD/SUPERCONTIG Zoom in on PGSC0003DMS ; zoom in on kb region or kb region

23 Using the Potato Genome Browser Instructions Panel: Bookmark, Hide Banner, High Resolution image, RESET Search: Landmark or Region Use Scaffold name Scroll/Zoom: View selection box Move to the left either 50 or 100% Move to the right either 50 or 100% Zoom in/out 10% Flip sequence Overview: Select region to view using the rubberband Tracks: Select which tracks to view; Update Image Configure track order, color, etc Display Settings: Show tracks Show tooltips Track Name 23

24 BLAST sequence search tool to identify sequences via sequence similarity: Step 1: Go to the PGSC BLAST site at Step 2: Select the type of search that you which to use. Note that only BLASTN, TBLASTN, and TBLASTX is supported Step 3: Paste your favorite sequence into the search box in the FASTA format Step 4: Select the database you wish to search. The potato genome sequence is Solanum phureja scaffolds v3. Also provided are databases of BAC and BAC end sequences from S. phureja and S. tuberosum as well as transcript (PUTs) assemblies of potato from the ISU PlantGDB project (plantgdb.org). 24

25 Step 5: Submit your sequence for a BLAST search. An intermediate page will appear telling you that your search is in progress and that the results will be held for 15 minutes via a specific URL. In your BLAST results, the DM sequence is represented as scaffolds. A sample scaffold is listed below: PGSC0003DMS PGSC0003DM: denotes the PGSC version 3 assembly S: Scaffold : Unique identifier Step 6: A link is available that allows you to download your scaffold sequence(s) of interest directly from the BLAST report. In the table of hits, simply click on the scaffold accession you wish to download and you will be presented with the PGSC data access agreement. After you accept the terms of the agreement, the scaffold file will be retrieved and packaged, and you should be prompted by your browser to save the file. Note that the DM 1-3 scaffold sequences are being made available under the terms of the PGSC data access agreement, so you must read and agree to these terms before downloading the full scaffold database. 25

26 Download of the potato genome sequence While the BLAST site will assist in identifying your sequence within the PGSC DM genome assembly, you will need to download the sequence from the PGSC web site to access the scaffold and genome sequence. Step 1: Go to p=download Step 2: To download the PGSC DM scaffolds, select Solanum_phureja.DM.scaffolds-v3.tar.bz2 Step 3: Read and if you agree to the data access agreement, click on Yes, I agree to these terms Step 4: The sequence databases are packaged using the Tar ( archiver, and then compressed using the bzip2 ( compression software. These programs are generally available on a linux machine; on a Windows machine, a number of applications are available that should be capable of extracting a bzip2- compressed tar file, including WinZip, WinRAR, and WinAce. Note: This file will be LARGE (185 Mb) and will take sometime to download. 26

27 Step 5: In the uncompressed file will be: README: A description of the DM Scaffolds Data_access: Statement of data access agreement PGSC0003DMS.fa: Multi-fasta file of the scaffolds Step 6: How to retrieve a specific sequences from the multi-fasta file. You can use any text editor that is capable of opening large files and doing a text search, for example 'vim' in Linux ( vim_tutorial.html ) or 'vim' in Windows( download.php#pc), 'textedit' on a Mac, or 'wordpad' on Windows. Better still, there are a number of utilities available for retrieving individual records from a fasta sequence database. The NCBI BLAST package has a utility called 'fastacmd' that serves this purpose, the equivalent utility in the WUBLAST package is called 'xdget'. Other tools are available with packages such as EMBOSS or exonerate that will also allow you to index and fetch sequences from a fasta database. 27

Browser Exercises - I. Alignments and Comparative genomics

Browser Exercises - I. Alignments and Comparative genomics Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

NGS developments in tomato genome sequencing

NGS developments in tomato genome sequencing NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,

More information

Genome Sequencing-- Strategies

Genome Sequencing-- Strategies Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

More information

BMC Genomics. Sample. doi: /s

BMC Genomics. Sample. doi: /s BMC Genomics This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Homologues of potato chromosome

More information

The Diploid Genome Sequence of an Individual Human

The Diploid Genome Sequence of an Individual Human The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.

More information

Bionano Access v1.2 Release Notes

Bionano Access v1.2 Release Notes Bionano Access v1.2 Release Notes Document Number: 30220 Document Revision: A For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics, Inc. All Rights Reserved. Table

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Sequencing and assembly of the sheep genome reference sequence

Sequencing and assembly of the sheep genome reference sequence Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience

The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk

More information

Identifying Regulatory Regions using Multiple Sequence Alignments

Identifying Regulatory Regions using Multiple Sequence Alignments Identifying Regulatory Regions using Multiple Sequence Alignments Prerequisites: BLAST Exercise: Detecting and Interpreting Genetic Homology. Resources: ClustalW is available at http://www.ebi.ac.uk/tools/clustalw2/index.html

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Why can GBS be complicated? Tools for filtering & error correction. Edward Buckler USDA-ARS Cornell University

Why can GBS be complicated? Tools for filtering & error correction. Edward Buckler USDA-ARS Cornell University Why can GBS be complicated? Tools for filtering & error correction Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Maize has more molecular diversity than humans and apes combined

More information

Why can GBS be complicated? Tools for filtering, error correction and imputation.

Why can GBS be complicated? Tools for filtering, error correction and imputation. Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower

More information

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris

More information

SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen

SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:

More information

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY Michael Gribskov Hock 331 Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Transcriptome Assembly, Functional Annotation (and a few other related thoughts)

Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Runs of Homozygosity Analysis Tutorial

Runs of Homozygosity Analysis Tutorial Runs of Homozygosity Analysis Tutorial Release 8.7.0 Golden Helix, Inc. March 22, 2017 Contents 1. Overview of the Project 2 2. Identify Runs of Homozygosity 6 Illustrative Example...............................................

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

Exercise I, Sequence Analysis

Exercise I, Sequence Analysis Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt

More information

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html

More information

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*

More information

Genome Assembly With Next Generation Sequencers

Genome Assembly With Next Generation Sequencers Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly

More information

Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager

Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications

More information

Genome Projects. Part III. Assembly and sequencing of human genomes

Genome Projects. Part III. Assembly and sequencing of human genomes Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences

More information

Bioinformatics Course AA 2017/2018 Tutorial 2

Bioinformatics Course AA 2017/2018 Tutorial 2 UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

More information

This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part

This software/database/presentation is a United States Government Work under the terms of the United States Copyright Act. It was written as part This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of

More information

Genome Assembly Using de Bruijn Graphs. Biostatistics 666

Genome Assembly Using de Bruijn Graphs. Biostatistics 666 Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park

Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast

More information

High throughput omics and BIOINFORMATICS

High throughput omics and BIOINFORMATICS High throughput omics and BIOINFORMATICS Giuseppe D'Auria Seville, February 2009 Genomes from isolated bacteria $ $ $ $ $ $ $ $ $$ $ $ $ $ $ $ $ se q se uen q c se uen ing q c se uen ing qu c en ing c

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases

More information

Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)

Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Martin Mascher IPK Gatersleben PAG XXII January 14, 2012 slide 1 Proof-of-principle in barley Diploid model for wheat 5 Gb

More information

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

A Prac'cal Guide to NCBI BLAST

A Prac'cal Guide to NCBI BLAST A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities

More information

user s guide Question 1

user s guide Question 1 Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966

More information

Experimental Design Microbial Sequencing

Experimental Design Microbial Sequencing Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!

The international effort to sequence the 17Gb wheat genome: Yes, Wheat can! ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC

More information

Finishing Drosophila ananassae Fosmid 2410F24

Finishing Drosophila ananassae Fosmid 2410F24 Nick Spies Research Explorations in Genomics Finishing Report Elgin, Shaffer and Leung 23 February 2013 Abstract: Finishing Drosophila ananassae Fosmid 2410F24 Finishing Drosophila ananassae fosmid clone

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Biol 478/595 Intro to Bioinformatics

Biol 478/595 Intro to Bioinformatics Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

More information

Finding Genes, Building Search Strategies and Visiting a Gene Page

Finding Genes, Building Search Strategies and Visiting a Gene Page Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use

More information

Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does

More information

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu.   handouts, papers, datasets Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

BME 110 Midterm Examination

BME 110 Midterm Examination BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource

More information

SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018

SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018 SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) 1. Instructor: Spring 2018 Name: Professor Dr. Hongbin Zhang E-mail: hbz7049@tamu.edu Office: 427A Heep Center Office Phone: 862-2244 Office

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

Prioritization: from vcf to finding the causative gene

Prioritization: from vcf to finding the causative gene Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for

More information

DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN

DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

De novo assembly in RNA-seq analysis.

De novo assembly in RNA-seq analysis. De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct

More information

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa CSE/Beng/BIMM 182: Biological Data Analysis Instructor: Vineet Bafna TA: Nitin Udpa Today We will explore the syllabus through a series of questions? Please ASK All logistical information will be given

More information

Bionano Access 1.0 Software User Guide

Bionano Access 1.0 Software User Guide Bionano Access 1.0 Software User Guide Document Number: 30142 Document Revision: A For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved.

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids. Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

A tutorial introduction into the MIPS PlantsDB barley&wheat database instances

A tutorial introduction into the MIPS PlantsDB barley&wheat database instances transplant 2 nd user training workshop Poznan, Poland, June, 27 th, 2013 A tutorial introduction into the MIPS PlantsDB barley&wheat database instances TUTORIAL ANSWERS Please direct any questions related

More information

StarGenetics User Guide

StarGenetics User Guide StarGenetics User Guide Table of Contents General Information Opening StarGenetics Opening Files Saving StarGenetics Files Resources and Help StarGenetics Visualizers Available Organisms In StarGenetics

More information

MODULE TSS2: SEQUENCE ALIGNMENTS (ADVANCED)

MODULE TSS2: SEQUENCE ALIGNMENTS (ADVANCED) MODULE TSS2: SEQUENCE ALIGNMENTS (ADVANCED) Lesson Plan: Title MEG LAAKSO AND JAMIE SIDERS Identifying the TSS for a gene in D. eugracilis using sequence alignment with the D. melanogaster ortholog Objectives

More information

Introduction to NGS analyses

Introduction to NGS analyses Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

More information

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects. Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

Genome evolution on the allotetraploid Xenopus laevis

Genome evolution on the allotetraploid Xenopus laevis Genome evolution on the allotetraploid Xenopus laevis Taejoon Kwon Department of Biomedical Engineering, School of Life Sciences Ulsan National Institute of Science & Technology (UNIST) Xenopus Bioinformatics

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Fig. S1 Genetic linkage maps of T. gondii chromosomes using F1 progeny from the ME49 and VAND genetic cross. All the recombination points were identified by whole genome sequencing

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

N50 must die!? Genome assembly workshop, Santa Cruz, 3/15/11

N50 must die!? Genome assembly workshop, Santa Cruz, 3/15/11 N50 must die!? Genome assembly workshop, Santa Cruz, 3/15/11 twitter: @assemblathon web: assemblathon.org Should N50 die in its role as a frequently used measure of genome assembly quality? Are there other

More information

The Bioluminescence Heterozygous Genome Assembler

The Bioluminescence Heterozygous Genome Assembler Brigham Young University BYU ScholarsArchive All Theses and Dissertations 2014-12-01 The Bioluminescence Heterozygous Genome Assembler Jared Calvin Price Brigham Young University - Provo Follow this and

More information

High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple

High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple CSIRO Livestock Industries on behalf of the International Sheep Genomics Consortium Outline of presentation

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

A tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013

A tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 MIPS PlantsDB tutorial - some exercises Please go to: http://mips.helmholtz-muenchen.de/plant/genomes.jsp

More information

Fruit and Nut Trees Genomics and Quantitative Genetics

Fruit and Nut Trees Genomics and Quantitative Genetics Fruit and Nut Trees Genomics and Quantitative Genetics Jasper Rees Department of Biotechnology University of the Western Cape South Africa jrees@uwc.ac.za The Challenges of Tree Breeding Long breeding

More information

Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.

Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN

More information

De Novo Assembly of High-throughput Short Read Sequences

De Novo Assembly of High-throughput Short Read Sequences De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,

More information

CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes.

CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes. CrusView Manual CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes. Contents System Requirement..........................................

More information

Small Exon Finder User Guide

Small Exon Finder User Guide Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...

More information

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases). Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are

More information

Next Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs

Next Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs Next Genera*on Sequencing II: Personal Genomics Jim Noonan Department of Gene*cs Personal genome sequencing Iden*fying the gene*c basis of phenotypic diversity among humans Gene*c risk factors for disease

More information