Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL)
|
|
|
- Nathaniel Allison
- 6 years ago
- Views:
Transcription
1 Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL) Maria J. Monteros, Joann Mudge, Andrew D. Farmer, Nicholas P. Devitt, Diego A. Fajardo, Thiru Ramaraj, Xinbin Dai, Zhaohong Zhuang, Peng Zhou, Joseph Guhlin, Christopher D. Town, Patrick X. Zhao, Jason R. Miller, Kevin A. Silverstein, E. Charles Brummer, Nevin D. Young NAAIC Madison, WI July 13, 2016
2 Alfalfa - Medicago sativa Complex Diploid 2X Medicago sativa subsp. caerulea Medicago sativa subsp. falcata Medicago sativa subsp. hemicycla Tetraploid 4X Medicago sativa subsp. sativa Medicago sativa subsp. falcata Medicago sativa subsp. varia Warm weather Cold tolerant
3 Alfalfa (Medicago sativa) Genetics Basic chromosome number (x) = 8 Diploid 2n = 2x = 16 Tetraploid 2n = 4x = 32 2X 4X
4 Diploid Genome vs. Tetraploid Alfalfa Images provided by Haibao Tang
5 Cultivated Alfalfa at the Diploid Level (CADL) Population developed by Ted Bingham Developed from cultivated tetraploids over 10 years to produce a diploid form Used 4x-2x cross method and backgrossing to increase cultivated germplasm background Simpler to analyze and assemble the genome than the tetraploid alfalfa grown commercially Genotype HM342 sequenced as part of the M. truncatula HapMap project Bingham ET and McCoy TJ Cultivated Alfalfa at the Diploid Level: origin, reproductive stability, and yield of seed and forage. Crop Science 19:
6 Role of Plant Genomes Growth Development Adaptation Stress tol. Quality Persistence
7 CADL Genome Assembly Pipeline (V.0.95) Daligner 1 (Overlap Computation) >100X coverage Quiver 5 (Polishing assembly) SSPACE- Longread 4 (Scaffolding) Falcon 2,3 (Genome assembly) 1. Myers G The Daligner Overlap Library Chin C, et al Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nature Methods. 10: Chin J FALCON: experimental PacBio diploid assembler Boetzer M, Pirovano W SSPACE-LongRead: scaffolding bacterial draft genomes using long read sequence information. BMC Bioinformatics. 15: PacBio variant consensus caller (Quiver algorithm). Source: Joann Mudge, NCGR
8 CADL - PacBio de novo Assembly (V.0.95) Falcon SSPACE + Quiver Contigs 6,593 Contig Length 1,254,734,629 Contig N50 547,092 Max Contig Size 4,047,589 Source: Joann Mudge, NCGR
9 CADL Gene Annotation Pipeline (V.0.95) 6,593 scaffolds Evidence Alfalfa RNA Seq Alfalfa ESTs Mt and G.max Protein MAKER Pipeline Gene prediction Prelim. gene models Training datasets Augustus for gene models 57,054 High conf. gene models BUSCO annotation quality 956 univ. orthologs in plants (99%) 124,527 gene models SPADA 2,433 small peptide gene models OUTPUT 120,094 prelim gene models Source: Xinbin Dai, Patrick Zhao Campbell MS et al Maker pipeline for genome annotation and curation. Curr. Prot. Bioinformatics. 48:1-39.
10 CADL Gene Functional Annotation (V.0.95) 6,593 scaffolds MAKER Pipeline Gene prediction Prelim. gene models SPADA 2,433 small peptide gene models 57,054 gene models Alignment of CADL and M. truncatula Orthologs in M. truncatula InterPro Scan Protein domain analysis BLAST against Unipro database Genome Size Sequenced size H_Conf. Genes M. truncatula MB 370 MB 31,661 Alfalfa CADL MB 1,200 MB 57,054 Source: Xinbin Dai, Patrick Zhao
11 Whole Genome BLASTN CADL vs Mt4.0 Good coverage of the gene space Chr 1 Chr 2 Chr 3 Chr 4 Chr 5 Chr 6 Chr 7 Chr 8 Source: Andrew Farmer, NCGR
12 Divergent Haplotypes Differ in Gene Content (Chr. 7) M. truncatula CADL CADL Mt CADL Source: Andrew Farmer, NCGR
13 Alfalfa Breeder s Toolbox See Poster #25
14 Genome BLAST Search - Alfalfa Breeder s Toolbox CADL (0.95) M. truncatula (4.0)
15 Available at the M. truncatula HapMap Project
16 CADL Genome Assembly Pipeline (~V.1.0) Daligner 1 (Overlap Computation) Falcon 2,3 (Genome assembly) Quiver 4 (Polishing assembly) Dovetail HiRise (Scaffolding) v g4d1fc9b Quiver 4 (Polishing assembly) 1. Myers G The Daligner Overlap Library Chin C, et al Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nature Methods. 10: Chin J FALCON: experimental PacBio diploid assembler PacBio variant consensus caller (Quiver algorithm). Source: Joann Mudge, NCGR
17 CADL Dovetail assembly (Anticipated V.1.0) (Falcon Quiver + Dovetail + Quiver) Scaffolds 5,751 Scaffold Length 1,251,060,667 Scaffold N50 1,271,357 Max Scaffold Size 6,073,685 Source: Joann Mudge, NCGR
18 Univ. of Minnesota Nevin Young Roxanne Denny NCGR Joann Mudge Andrew Farmer Diego Fajardo Nicolas Devitt Thiru Ramaraj Noble Foundation Patrick Zhao Xinbin Dai Jaeyoung Choi Chunlin He Perdeep Mehta Michael Udvardi UC Davis Charlie Brummer Haibao Tang Christopher Town Ted Bingham Acknowledgements PAG 2016
19
20 CADL Scaffolds Painted by Mt Chromosomes chr1=green chr2=orange chr3=blue chr4=black chr5=yellow chr6=red chr7=magenta chr8=pink Source: Andrew Farmer, NCGR
De novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
Gap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
Genomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
Selection Mapping. Charlie Brummer, Gitanshu Munjal, and Scott Newell University of California, Davis
Dissecting Alfalfa Dormancy Using Selection Mapping Charlie Brummer, Gitanshu Munjal, and Scott Newell University of California, Davis Outline Yield and Fall FllDormancy Selection Mapping GWAS in a breeding
NGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Looking Ahead: Improving Workflows for SMRT Sequencing
Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences
Understanding, Curating, and Analyzing your Diploid Genome Assembly
Understanding, Curating, and Analyzing your Diploid Genome Assembly Sarah B. Kingan, Ph.D. Senior Scientist, Bioinformatics, PacBio Applications East Coast UGM, Baltimore, MD Tuesday June 27th 2017 For
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab'
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab' Outline' 1. Assembly'Review' 2. Pacbio' Technology'Overview' Data'CharacterisFcs' Algorithms' Results' 'Assemblies' 3. Oxford'Nanopore'
Analytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
Mate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
The Iso-Seq Method: Transcriptome Sequencing Using Long Reads
The Iso-Seq Method: Transcriptome Sequencing Using Long Reads Elizabeth Tseng, Ph.D. Senior Staff Scientist FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing
Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing Hamid Ashrafi Amanda M. Hulse, Kevin Hoegenauer, Fei Wang,
de novo sequencing of the sunflower genome
de novo sequencing of the sunflower genome Stéphane Muños LIPM INRA Toulouse stephane.munos@toulouse.inra.fr @stephane_munos @SUNRISE_France 39 Sunflower, an important cropfor Europe Million tons of seed
Genetics, Variety Selection and Variety Testing
Genetics, Variety Selection and Variety Testing Presentation by Dan Undersander A. Genetics 1. Centers of Origin Alfalfa first cultivated +9,000 yrs ago 2. Alfalfa Genetics a. Alfalfa is a pollinating
MAKER: An easy to use genome annotation pipeline. Carson Holt Yandell Lab Department of Human Genetics University of Utah
MAKER: An easy to use genome annotation pipeline Carson Holt Yandell Lab Department of Human Genetics University of Utah Introduction to Genome Annotation What annotations are Importance of genome annotations
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora Jerry Jenkins 1, Xiaohan Yang 2, Hengfu Yin 2, Gerald A. Tuskan 2, John C. Cushman 3, Won Cheol Yim 3, Jason
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION 1 Supplementary Figures Supplementary Figure 1 Assembly of the P. reichenowi and P. gaboni genome sequences. process. The process by which the genomes were assembled, are detailed
Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
Building a platinum human genome assembly from single haplotype human genomes. Karyn Meltz Steinberg PacBio UGM December,
Building a platinum human genome assembly from single haplotype human genomes Karyn Meltz Steinberg PacBio UGM December, 2015 @KMS_Meltzy Single haplotype from hydatidiform mole Enucleated egg (no maternal
Genome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
From Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
The Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
De novo assembly of complex genomes using single molecule sequencing
De novo assembly of complex genomes using single molecule sequencing Michael Schatz Jan 14, 2014 PAG XXII @mike_schatz / #PAGXXII 1. Shear & Sequence DNA Assembling a Genome 2. Construct assembly graph
Introduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
Bioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
Bioinformatics in SMRT Analysis 3.x
Bioinformatics in SMRT Analysis 3.x For Research Use Only. Not for use in diagnostics procedures. Copyright 2016 by Pacific Biosciences of California, Inc. All rights reserved. AGENDA - SMRT Link Basics
NCGR Advanced Bioinformatics
NCGR Advanced Bioinformatics Prepared for University of Alaska, Fairbanks and Anchorage January 28-29, 2016 Faye D. Schilkey Director of Strategic Projects and NM-INBRE Sequencing and Bioinformatics Core
The Federated Plant Database Initiative for the Legumes
The Federated Plant Database Initiative for the Legumes Steven Cannon (ARS ISU) Ethy Cannon (ISU) David Fernandez-Baca (ISU; PI) Andrew Farmer (NCGR) Jeremy DeBarry (iplant) Chris Town (JCVI) The Federated
Anker P Sørensen Crop innovation through novel NGS applications
nker P Sørensen Crop innovation through novel NGS applications Session 1: NGS / Omic Technologies for Plant Research 19 e March 2015, Kuala Lumpur Malaysia KeyGene s corporate profile Wageningen NL Rockville
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
Variant Callers. J Fass 24 August 2017
Variant Callers J Fass 24 August 2017 Variant Types Caller Consistency Pabinger (2014) Briefings Bioinformatics 15:256 Freebayes Bayesian haplotype caller that can call SNPs, short CNVs / duplications,
Targeted PacBio sequencing of wild zebrafish immune gene families. Jaanus Suurväli University of Cologne Institute for Genetics
Targeted PacBio sequencing of wild zebrafish immune gene families Jaanus Suurväli University of Cologne Institute for Genetics Leiden, 12. June 2018 Cyprinidae ~3000 species of cyprinids ~9-10 % of all
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
What the Genome of Raffaelea lauricola Can Tell Us About Laurel Wilt
What the Genome of Raffaelea lauricola Can Tell Us About Laurel Wilt Laurel Wilt Summit November 3-4, 2016 Dr. Jeffrey Rollins Associate Professor Plant Pathology Department University of Florida Gainesville,
Sequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
WHAT S ON THE HORIZON FOR BIOTECHNOLOGY IN ALFALFA AND FORAGE GRASSES? Joe Bouton 1 ABSTRACT
WHAT S ON THE HORIZON FOR BIOTECHNOLOGY IN ALFALFA AND FORAGE GRASSES? Joe Bouton 1 ABSTRACT Biotechnology is concentrated in two evolving research areas, genomics and transgenics. For the genomics approach,
Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
Bacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Analysis of Structural Variants using 3 rd generation Sequencing
Analysis of Structural Variants using 3 rd generation Sequencing Michael Schatz January 12, 2016 Bioinformatics / PAG XXIV @mike_schatz / #PAGXXIV Analysis of Structural Variants using 3 rd generation
Detecting Structural Variants in PacBio Reads Tools and Applications
Detecting Structural Variants in PacBio Reads Tools and Applications Aaron Wenger 2017-06-28 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California,
Genome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses Dr. Susanne Barth Teagasc Crops Research Centre Oak Park Carlow Irland Global challenges
The Resurgence of Reference Quality Genome Sequence
The Resurgence of Reference Quality Genome Sequence Michael Schatz Jan 12, 2016 PAG IV @mike_schatz / #PAGIV Genomics Arsenal in the year 2015 Sample Preparation Sequencing Chromosome Mapping Summary &
EvidentialGene: Perfect Genes Constructed from Gigabases of RNA Gilbert, Don Indiana University, Biology, Bloomington, IN 47405;
EvidentialGene: Perfect Genes Constructed from Gigabases of RNA Gilbert, Don Indiana University, Biology, Bloomington, IN 47405; gilbertd@indiana.edu Gene construction, not prediction. The decade of gene
De novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
Title: High-quality genome assembly of channel catfish, Ictalurus punctatus
Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
Understanding Accuracy in SMRT Sequencing
Understanding Accuracy in SMRT Sequencing Jonas Korlach, Chief Scientific Officer, Pacific Biosciences Introduction Single Molecule, Real-Time (SMRT ) DNA sequencing achieves highly accurate sequencing
United States Department of Agriculture Final Report. Alfalfa and Forage Program. Departments Monteros Lab {NO DATA ENTERED}
Title: Root Traits to Enhance Nutrient and Water Use in Alfalfa Sponsoring Agency Funding Source Accession No. Project Start Date Reporting Period Start Date Submitted By NIFA Non Formula 1004474 09/01/2014
ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas
ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences
De novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
The Irys System. Rapid Genome Wide Mapping for de novo Assembly and Structural Variation Analysis. Jack Peart, Ph.D. Director of Sales EMEA
The Irys System Rapid Genome Wide Mapping for de novo Assembly and Structural Variation Analysis Jack Peart, Ph.D. Director of Sales EMEA BioNano Snapshot Developed & Commercialized the Irys System for
TREE CODE PRODUCT BROCHURE
TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for
Introduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
GREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about
Genome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
Pan Genome and Structural Variation Analysis using different Approaches for de novo Assembly and Haplotype Reconstruction
PAG XXV, January 14-18, 2017 - San Diego, CA, USA Pan Genome and Structural Variation Analysis using different Approaches for de novo Assembly and Haplotype Reconstruction Davide Scaglione dscaglione@igatechnology.com
100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes
100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes Michael Schatz January 15, 2019 PAG2019 Bioinformatics Workshop @mike_schatz Tomato Domestication & Agriculture Tomatoes are
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Introduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
Taking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013
Taking Advantage of Long RNA-Seq Reads Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013 Overview Proof-of-Principle SMART-cDNA Synthesis PB-SBL size distributions Gene Annotation
Structural Variant Detection in SMRT Link 5 with pbsv
Structural Variant Detection in SMRT Link 5 with pbsv Aaron Wenger 2017-06-27 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All
Structural Variant Detection in SMRT Link 5 with pbsv
Structural Variant Detection in SMRT Link 5 with pbsv Aaron Wenger 2017-06-27 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All
De Novo Transcript Discovery using Long and Short Reads
De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
Accurate & Complete Gene Construction with EvidentialGene. eugenes.org/evidentialgene/ 2016 June
Accurate & Complete Gene Construction with EvidentialGene eugenes.org/evidentialgene/ Don Gilbert 2016 June gilbertd@indiana.edu What is EvidentialGene? Classifier of gene models Class = good, alternate,
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge
Genome evolution on the allotetraploid Xenopus laevis
Genome evolution on the allotetraploid Xenopus laevis Taejoon Kwon Department of Biomedical Engineering, School of Life Sciences Ulsan National Institute of Science & Technology (UNIST) Xenopus Bioinformatics
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
The genome of Fraxinus excelsior (European Ash)
The genome of Fraxinus excelsior (European Ash) Elizabeth Sollars, Laura Kelly, Bernardo Clavijo, David Swarbreck, Jasmin Zohren, David Boshier, Jo Clark, Anika Joecker, Sarah Ayling, Mario Caccamo, Richard
Improving Genome Assemblies without Sequencing
Improving Genome Assemblies without Sequencing Michael Schatz April 25, 2005 TIGR Bioinformatics Seminar Assembly Pipeline Overview 1. Sequence shotgun reads 2. Call Bases 3. Trim Reads 4. Assemble phred/tracetuner/kb
Why can GBS be complicated? Tools for filtering, error correction and imputation.
Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower
Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
Genome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
Genome Assembly With Next Generation Sequencers
Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly
1 st transplant user training workshop Versailles, 12th-13th November 2012
trans-national Infrastructure for Plant Genomic Science 1 st transplant user training workshop Versailles, 12th-13th November 2012 Paul Kersey, EMBL-EBI More people, less land Plant genome sequences, 2005
REFORMA Resilient, water- and energy-efficient forage and feed crops for Mediterranean agricultural systems
REFORMA Resilient, water- and energy-efficient forage and feed crops for Mediterranean agricultural systems (2012 2016) Overall budget: 549 000 (excluding associate partners) Coordinator Paolo ANNICCHIARICO