Databases NCBI - ENTREZ

Size: px
Start display at page:

Download "Databases NCBI - ENTREZ"

Transcription

1 Databases NCBI - ENTREZ

2

3

4

5

6

7

8 Data & Software Resources BLAST CDD COG GENSAT GenBank Whole Genome Shotgun Sequences Gene Gene Expression Nervous System Atlas (GENSAT) Gene Expression Omnibus (GEO) Profiles and Datasets Genome Genome Markers (UniSTS) HomoloGene Mapping Data NCBI Taxonomy Protein Clusters PubChem RefSeq SKY/M Fish and CGH Data Sequence Read Archive FTP Site Structure (MMDB) Trace Archive UniGene UniVec GenPept dbgap Open Access Data dbmhc Data RSS Feeds Sequin tbl2asn Batch Entrez CDTree Cn3D E Utilities NCBI Toolbox ProSplign Splign

9

10

11

12

13

14

15

16 Just the upper left corner of moi

17 Just the lower left corner of moi

18

19

20

21

22

23 * is not a wildcard it is a truncation

24

25

26

27

28

29 Combine Searches Eg #1 #2 NOT #3

30

31

32

33 Use of boolean terms for search AND OR NOT General syntax: term [field] OPERATOR term [field] Use of brackets to combine the terms

34 Available for Database Field Accession All Fields Author Name EC/RN Number Feature Key Filter Gene Name Issue Journal Name Keyword Modification Date Molecular Weight Organism Page Number Primary Accession Properties Protein Name Publication Date SeqID String Sequence Length Substance Name Text Word Title Word Volume Short term ACCN ALL AUTH ECNO FKEY FILT GENE ISS JOUR KYWD MDAT MOLWT ORGN PAGE PACC PROP PROT PDAT SQID SLEN SUBS WORD TITL VOL Nucleotide Protein Genome Structure PopSet NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO

35 PubMed ENTREZ search fields Field Affiliation Author EC/RN Number Filter Full Author Name Issue Journal Title MeSH Date MeSH Subheadings NLM Unique ID Pagination Pharmacological Action Publication Date Publisher Identifier Subset Text Word Title / Abstract Volume Short term AD AU RN FILTER FAU IP TA MHDA SH JID PG PA DP AID SB TW TIAB VI Field All Fields Corporate Author Entrez Date First author Grant Name Investigator Language MeSH Major Topic MeSH Terms Other Term Personal Name as Subject Place of Publication Publication Type Secondary Source ID Substance Name Title Unique Identifiers Short term ALL CN EDAT IAU GR IR LA MAJR MH OT PS PL PT SI NM TI UID

36 Can you find the enhancers/promoters for GLP3 (GERMIN like-protein 3)??

37

38

39

40 Range operator : (ACCN, MOLWT, SLEN) x : y [SLEN] works with dates; molecular weight For more information:

41

42

43

44

45

46

47

48

49

50

51

52

53 Display Format Description Databases Available Summary Default display, hotlinked Accession number and brief description Nucleotide, Protein, CoreNucleotide, EST, GSS, PopSet, Genome, Genome Project Brief Hotlinked Accession number and abbreviated description, hotlinked project number in the case of a genome project Nucleotide, Protein, CoreNucleotide, EST, GSS, PopSet, Genome, Genome Project GenBank Full report format Nucleotide, Protein, CoreNucleotide, EST, GSS, Genome GenPept Full report format Protein Complete GenBank record with all features and all Sequence. This GenBank (full) format is useful for very large GenBank records GenPept Complete GenPept record with all protein features and all Sequence. This format is useful for very large GenBank records Nucleotide, Protein, CoreNucleotide, EST, GSS, Genome Protein

54 Display Format Description Databases Available INSDSeq XML XML DTD for sequence records Nucleotide, Protein GI list List of GenInfo GI indentifiers Nucleotide, Protein, CoreNucleotide, EST, GSS, ASN.1 Abstract syntax Notation One, used data storage and retrieval and to help achieve interoperability among platforms Nucleotide, Protein, CoreNucleotide, EST, GSS, PopSet, Genome EST Native display format for Expressed Sequence Tag records EST Graphics or Graph The graphical view of the sequence Nucleotide, Protein and accessible by selecting the hotlinked Genome Accession numbers GSS Native Display format for the Genome Survey Sequences TinySeq XML Simplified XML for parsing GSS Nucleotide, Protein, CoreNucleotide, EST, GSS, Genome

55 Display Format Description Databases Available Overview Tabular-layout of data including Links to BLAST results, CDD, ftp site and general information for a genome in Genomes; for Genome Project database it is a complete display of links to projects in the database, serves as a portal to links to all projects in the database about the organism specific genome PopSet summary The number set of Accession Numbers comprising the PopSet PopSet accessible by selecting the hotlinked PopSet Acession Numbers UI List List of database ID's PopSet XML Script-parseable format Nucleotide, Protein, Genome Genome, Genome Project

56 Text mining

57

58 Caveat emptor

What You NEED to Know

What You NEED to Know What You NEED to Know Major DNA Databases NCBI RefSeq EBI DDBJ Protein Structural Databases PDB SCOP CCDC Major Protein Sequence Databases UniprotKB Swissprot PIR TrEMBL Genpept Other Major Databases MIM

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

NCBI Molecular Biology Resources. Entrez & BLAST. Entrez: Database Integration. Database Searching with Entrez. WWW Access. Using Entrez.

NCBI Molecular Biology Resources. Entrez & BLAST. Entrez: Database Integration. Database Searching with Entrez. WWW Access. Using Entrez. NCBI Molecular Biology Resources Using Entrez WWW Access Entrez & BLAST March 2007 Phylogeny Entrez: Database Integration Taxonomy PubMed abstracts Genomes Word weight 3-D Structure VAST Neighbors Related

More information

Redundancy at GenBank => RefSeq. RefSeq vs GenBank. Databases, cont. Genome sequencing using a shotgun approach. Sequenced eukaryotic genomes

Redundancy at GenBank => RefSeq. RefSeq vs GenBank. Databases, cont. Genome sequencing using a shotgun approach. Sequenced eukaryotic genomes Databases, cont. Redundancy at GenBank => RefSeq http://www.ncbi.nlm.nih.gov/books/bv.fcg i?rid=handbook RefSeq vs GenBank Many sequences are represented more than once in GenBank 2003 RefSeq collection

More information

A Field Guide to GenBank and NCBI Molecular Biology Resources

A Field Guide to GenBank and NCBI Molecular Biology Resources A Field Guide to GenBank and NCBI Molecular Biology Resources slightly modified from Peter Cooper ftp://ftp.ncbi.nih.gov/pub/cooper/fieldguide/ Eric Sayers ftp://ftp.ncbi.nih.gov/pub/sayers/field_guide/u_penn/

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

Databases in genomics

Databases in genomics Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Databases in Bioinformatics. Molecular Databases. Molecular Databases. NCBI Databases. BINF 630: Bioinformatics Methods

Databases in Bioinformatics. Molecular Databases. Molecular Databases. NCBI Databases. BINF 630: Bioinformatics Methods Databases in Bioinformatics BINF 630: Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Molecular Databases Molecular Databases Nucleic acid sequences: GenBank, DNA Data Bank of Japan, EMBL

More information

Entrez Gene: gene-centered information at NCBI

Entrez Gene: gene-centered information at NCBI D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National

More information

Database resources of the National Center for Biotechnology Information

Database resources of the National Center for Biotechnology Information Published online 12 November 2009 Nucleic Acids Research, 2010, Vol. 38, Database issue D5 D16 doi:10.1093/nar/gkp967 Database resources of the National Center for Biotechnology Information Eric W. Sayers

More information

Deakin Research Online

Deakin Research Online Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Hot Topics. What s New with BLAST?

Hot Topics. What s New with BLAST? Hot Topics What s New with BLAST? Slides based on NCBI talk at American Society of Human Genetics October 2005 Hot Topics Outline I. New BLAST Algorithm: Discontiguous MegaBLAST II. New Databases III.

More information

org.ag.eg.db October 2, 2015 org.ag.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.ag.eg.db October 2, 2015 org.ag.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.ag.eg.db October 2, 2015 org.ag.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.ag.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures

Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Chapter 2. Genomic Databases and Resources at the National Center for Biotechnology Information. Tatiana Tatusova. Abstract. 1.

Chapter 2. Genomic Databases and Resources at the National Center for Biotechnology Information. Tatiana Tatusova. Abstract. 1. Chapter 2 Genomic Databases and Resources at the National Center for Biotechnology Information Tatiana Tatusova Abstract The National Center for Biotechnology Information (NCBI), as a primary public repository

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics

More information

user s guide Question 1

user s guide Question 1 Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

org.bt.eg.db April 1, 2019

org.bt.eg.db April 1, 2019 org.bt.eg.db April 1, 2019 org.bt.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.bt.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

A Prac'cal Guide to NCBI BLAST

A Prac'cal Guide to NCBI BLAST A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities

More information

org.tgondii.eg.db November 7, 2017

org.tgondii.eg.db November 7, 2017 org.tgondii.eg.db November 7, 2017 org.tgondii.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.tgondii.egaccnum is an R object that contains mappings between Entrez Gene identifiers

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic

More information

7.91 Lecture #1 Introduction to Bioinformatics

7.91 Lecture #1 Introduction to Bioinformatics 7.91 Lecture #1 Introduction to Bioinformatics Focus on Kinases Michael Yaffe & Pairwise Sequence Comparisons ARDFSHGLLENKLLGCDSMRWE.::..:::..:::: :::. GRDYKMALLEQWILGCD-MRWD Reading: This lecture: Mount

More information

Introduction to Bioinformatics October 13, 03

Introduction to Bioinformatics October 13, 03 Intrductin t Biinfrmatics http://www.biinfrmaticscurses.cm/biinfrm/ Helge Weissig, Ph.D. helgew@biinfrmaticscurses.cm Intrductin t Biinfrmatics http://www.biinfrmaticscurses.cm/biinfrm/ Helge Weissig,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement

More information

org.gg.eg.db November 2, 2013 org.gg.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.gg.eg.db November 2, 2013 org.gg.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.gg.eg.db November 2, 2013 org.gg.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.gg.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

GenBank. Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette

GenBank. Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette 1998 Oxford University Press Nucleic Acids Research, 1998, Vol. 26, No. 1 1 7 GenBank Dennis A. Benson*, Mark S. Boguski, David J. Lipman, James Ostell and B. F. Francis Ouellette National Center for Biotechnology

More information

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo South African National Bioinformatics Institute University of the Western Cape RELEVEANCE OF DATA SHARING! Fragmented data

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part

This software/database/presentation is a United States Government Work under the terms of the United States Copyright Act. It was written as part This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology ICB Fall 2004 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Copyright 2004 Oliver Jovanovic, All Rights Reserved. Analysis of Protein Sequences Coding

More information

NCBI Molecular Biology Resources. NCBI Resources

NCBI Molecular Biology Resources. NCBI Resources NBI Molecular Biology Resources A Field Guide NBI Resources The NBI Entrez System NBI Sequence Databases Primary data: GenBank Derivative data: RefSeq, Gene Protein Structure and Function Sequence polymorphisms

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

GenBank. Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via (EST, GSS, STS) ftp accounts sequencing centers

GenBank. Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via  (EST, GSS, STS) ftp accounts sequencing centers What is GenBank? NCBI s Primary Sequence Database Nucleotide sequence database Archival in nature GenBank Data Direct submissions individual records (BankIt( BankIt,, Sequin) Batch submissions via email

More information

NCBI Molecular Biology Resources

NCBI Molecular Biology Resources NCBI Molecular Biology Resources Part 2: Using NCBI BLAST December 2009 Using BLAST Basics of using NCBI BLAST Using the new Interface Improved organism and filter options New Services Primer BLAST Align

More information

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,

More information

Digital information cycle. Database. Database. BINF 630: Bioinformatics Methods

Digital information cycle. Database. Database. BINF 630: Bioinformatics Methods Digital information cycle BINF 630: Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Creation and capture Storage and management Rights management Search and access Distribution Electronic

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Textbook. Web sites. Literature references

Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Textbook. Web sites. Literature references Introduction to Bioinformatics Who is taking this course? People with very diverse backgrounds in biology Some people with backgrounds in computer science and biostatistics Most people (will) have a favorite

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.

More information

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

org.hs.eg.db April 10, 2016 org.hs.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.hs.eg.db April 10, 2016 org.hs.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.hs.eg.db April 10, 2016 org.hs.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.hs.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession

More information

National Center for Biotechnology Information (NCBI):

National Center for Biotechnology Information (NCBI): National Center for Biotechnology Information (NCBI): http://www.ncbi.nlm.nih.gov By: Dr Hadi Mozafari As a national resource for molecular biology information, NCBI's mission is to develop new information

More information

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology

More information

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing

More information

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Databases and Resources Biological Databases and Resources Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

More information

The Single Nucleotide Polymorphism Database (dbsnp) of Nucleotide Sequence

The Single Nucleotide Polymorphism Database (dbsnp) of Nucleotide Sequence 5. The Single Nucleotide Polymorphism Database (dbsnp) of Nucleotide Sequence Adrienne Kitts and Stephen Sherry Created: October 09, 2002 Updated: September 13, 2006 Summary Sequence variations exist at

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology ICB Fall 2009 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology & Immunology Copyright 2009 Oliver Jovanovic, All Rights Reserved. Analysis of Protein

More information

hgu95av2 March 17, 2019 Bioconductor annotation data package hgu95av2 Description

hgu95av2 March 17, 2019 Bioconductor annotation data package hgu95av2 Description hgu95av2 March 17, 2019 hgu95av2 Bioconductor annotation data package The annotation package was built using a downloadable R package - AnnBuilder (download and build your own) from www.bioconductor.org

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 24 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays at 1pm-2pmRoom 438 Library Admin Building Beginning September

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Introduction to NGS analyses

Introduction to NGS analyses Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

More information

BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology

BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Introduction to Molecular Biology Databases

Introduction to Molecular Biology Databases Introduction to Molecular Biology Databases Laboratorio de Bioinformática Centro de Astrobiología INTA-CSIC Centro de Astrobiología PRESENT BIOLOGY RESEARCH Data sources Genome sequencing projects: genome

More information

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and

More information

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Source: Zanotti (1745). c July :14 AM

Source: Zanotti (1745). c July :14 AM Chapter 2 introduces ways to access molecular data, including information about DNA and proteins. One of the first scientists to study proteins was Iacopo Bartolomeo Beccari (1682 1776), an Italian philosopher

More information

This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott

This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott QUT Digital Repository: http://eprints.qut.edu.au/ This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott and Wirges, Sally (2010) BLAST Atlas : a

More information

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

MOLECULAR BIOLOGY DATABASES. Juan Carlos Sánchez Ferrero

MOLECULAR BIOLOGY DATABASES. Juan Carlos Sánchez Ferrero MOLECULAR BIOLOGY DATABASES Juan Carlos Sánchez Ferrero Centro Nacional de Biotecnología, CSIC July 2008 GROWING NUMBER OF DATA Molecular biology data explosion in the omics era: genome sequencing, high-throughput

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments

BLAST. compared with database sequences Sequences with many matches to high- scoring words are used for final alignments BLAST 100 times faster than dynamic programming. Good for database searches. Derive a list of words of length w from query (e.g., 3 for protein, 11 for DNA) High-scoring words are compared with database

More information

IBM TRIRIGA Application Platform Version 3 Release 4.1. Reporting User Guide

IBM TRIRIGA Application Platform Version 3 Release 4.1. Reporting User Guide IBM TRIRIGA Application Platform Version 3 Release 4.1 Reporting User Guide Note Before using this information and the product it supports, read the information in Notices on page 166. This edition applies

More information

Exploring Similarities of Conserved Domains/Motifs

Exploring Similarities of Conserved Domains/Motifs Exploring Similarities of Conserved Domains/Motifs Sotiria Palioura Abstract Traditionally, proteins are represented as amino acid sequences. There are, though, other (potentially more exciting) representations;

More information

EBI web resources I: databases and tools. Yanbin Yin Spring 2013

EBI web resources I: databases and tools. Yanbin Yin Spring 2013 EBI web resources I: databases and tools Yanbin Yin Spring 2013 1 Outline Intro to EBI Databases and web tools UniProt Gene Ontology Hands on PracBce MOST MATERIALS ARE FROM: hkp://www.ebi.ac.uk/training/online/course-

More information

Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Different user needs, different approaches

Introduction to Bioinformatics. What are the goals of the course? Who is taking this course? Different user needs, different approaches Introduction to Bioinformatics Who is taking this course? Monday, November 19, 2012 Jonathan Pevsner pevsner@kennedykrieger.org Bioinformatics M.E:800.707 People with very diverse backgrounds in biology

More information

Supplementary Figure 1. BLASTN search of human ESTs using TSLC1-109 to. Supplementary Figure 2. The Minimal Promoter of TSLC1 was verified using a

Supplementary Figure 1. BLASTN search of human ESTs using TSLC1-109 to. Supplementary Figure 2. The Minimal Promoter of TSLC1 was verified using a Supplementary Figure Legend Click here to download Figure: Supplementary FigureLegends.doc Supplementary Figure 1. BLASTN search of human ESTs using TSLC1-109 to +91. The results of this BLASTN search

More information

Oracle Spreadsheet Add-In for Predictive Analytics for Life Sciences Problems

Oracle Spreadsheet Add-In for Predictive Analytics for Life Sciences Problems Oracle Life Sciences eseminar Oracle Spreadsheet Add-In for Predictive Analytics for Life Sciences Problems http://conference.oracle.com Meeting Place: US Toll Free: 1-888-967-2253 US Only: 1-650-607-2253

More information

Online Mendelian Inheritance in Man (OMIM)

Online Mendelian Inheritance in Man (OMIM) HUMAN MUTATION 15:57 61 (2000) MDI SPECIAL ARTICLE Online Mendelian Inheritance in Man (OMIM) Ada Hamosh, Alan F. Scott,* Joanna Amberger, David Valle, and Victor A. McKusick McKusick-Nathans Institute

More information

Biological Interpretation of Metabolomics Data. Martina Kutmon Maastricht University

Biological Interpretation of Metabolomics Data. Martina Kutmon Maastricht University Biological Interpretation of Metabolomics Data Martina Kutmon Maastricht University Contents Background on pathway analysis WikiPathways Building Research Communities on Biological Pathways Data Analysis

More information

Dennis A. Benson, Ilene Karsch-Mizrachi, David J. Lipman, James Ostell and Eric W. Sayers*

Dennis A. Benson, Ilene Karsch-Mizrachi, David J. Lipman, James Ostell and Eric W. Sayers* D32 D37 Nucleic Acids Research, 2011, Vol. 39, Database issue Published online 10 November 2010 doi:10.1093/nar/gkq1079 GenBank Dennis A. Benson, Ilene Karsch-Mizrachi, David J. Lipman, James Ostell and

More information