Alkaline protease production, extraction and characterization from alkaliphilic Bacillus licheniformis KBDL4: A Lonar soda lake isolate

Transcription

1 Indian Journal of Experimental Biology Vol. 50,August 2012, pp Alkaline protease production, extraction and characterization from alkaliphilic Bacillus licheniformis KBDL4: A Lonar soda lake isolate Anupama P Pathak* & Kshipra B Deshmukh School of Life Sciences, SRTM University, Nanded , India. Received 23 December 2011; revised 28 March 2012 A bacterium producing an alkaline protease was isolated from the Lonar soda lake, Buldhana district (19 58' N; 76 31' E), Maharashtra, India. The most appropriate medium for the growth and protease production was composed of (g/l): casein 10; yeast extract 4; KH 2 PO 4 0.5, K 2 HPO and CaCl The enzyme showed maximum activity with and without 5 mm Ca 2+ at 70 and 60 o C, respectively. The enzyme retained 40 and 82% of its initial activity after heating for 60 min at 60 o C, in absence and presence of 5 mm CaCl 2 respectively. The enzyme remained active and stable at ph 8-12, with an optimum at ph 10. The enzyme showed stability towards non-ionic and anionic surfactants, and oxidizing agents. It also showed excellent stability and compatibility with commonly used laundry detergents. Wash performance analysis revealed that enzyme could effectively remove blood stains. It also showed decomposition of gelatinous coating on X- ray film. Keywords: Alkaline protease, Bacillus licheniformis, Gelatinous coating, Detergent compatibility, Lonar soda lake Proteases with high activity and stability in alkaline range are useful for bioengineering and biotechnological applications. Their major application is in detergent industry, because the ph of laundry detergents is generally in the range of The performance of detergent proteases is also influenced by several other factors such as wash temperature and detergent composition. Proteolytic enzymes, incorporated into detergent formulations exhibited significant activity and stability at high ph 1. This has prompted the search for new protease producer from Lonar soda lake in Buldhana district, Maharashtra, India (19 58' N; 76 31' E) an extreme alkaline lake 2,3. The present paper describes isolation and identification of Bacillus licheniformis KBDL4 from the Lonar lake and production of extracellular alkaline protease by the organism. It also provides some information on the biochemical characteristics of crude enzyme preparation as well as its compatibility with various detergents. Materials and Methods Sample collection, isolation and screening for efficient alkaline protease producer Water samples *Correspondent author Telephone: , Fax: anupama.micro@rediffmail.com were collected during winter season from the Lonar lake periphery at 15 cm depth. Samples were brought to the laboratory for the isolation of bacteria. The samples were enriched on Tindal s medium by incubating at 30 o C for 8 days on shaking incubator at 200 rpm. After enrichment, the organisms were isolated on same agar media and pure cultures were maintained. The purified colonies were screened for protease production on casein agar plates by incubating at 30 o C for 48 h and examining diameter of the clear zone in the medium. The isolates representing KBDL4 strain was selected as potential producer of proteases. Identification of selected strain of the bacterium Biochemically, KBDL4 strain was characterized by using carbohydrate utilization kit like glucose, galactose, cellobiose, trehalose, mannose, arabinose, fructose, mannitol and xylose. Tests were also carried out to determine reaction with casein, starch, gelatin hydrolysis, catalase and determination of nitrate reduction 4,5. DNA extraction, amplification and 16S rdna sequencing of the strain The bacterial culture was suspended in extraction buffer (10 mm Tris HCL, ph 8; 1 mm EDTA, ph 8) and proteinase K solution was added at the final concentration of 100 µg/ml and incubated at 55 o C for 2 h with continuous shaking.

2 570 INDIAN J EXP BIOL, AUGUST 2012 NaCl (0.5 M) was added and incubated at 72 o C for 30 min. DNA was extracted with phenol-chloroform, washed with 70% ethanol, dissolved in Tris-EDTA buffer (ph 8) electrophorased on 1% agarose gel and visualized by ethidium bromide staining 6. The amplification of 16S rdna fragments were performed by using Applied Biosystem model 9700 PCR with 27f (5' CAGAGTTTGATCGTGGCTCAG 3') and 1488R (5'CGGTTACCTTGTTACGACTTCACC 3') primer pair. The PCR reaction mixture contained 1.5 mm MgCl 2, 200 µm dntps, and 0.3 µm of each primer and 1U of Taq DNA polymerase with a reaction mixture supplied by the manufacturer in a total volume of 100 µl. Reaction mixture was first denatured at 94 o C for 3 min, followed by 30 cycles of denaturation at 94 o C for 30 sec, annealing at 52 o C for 30 sec and extension at 72 o C for 1 min. Amplification was completed by a final extension step at 72 o C for 7 min. PCR products were controlled in 1% agarose gel. PCR products were purified by the PEG/NaCl method 7 and directly sequenced on the Applied Biosystem model 3730 DNA analyzer (Foster city, California, USA). The 16S rdna sequence was initially analyzed using the BLAST search facility ( Multiple sequence alignments were performed using CLUSTALW version Phylogenetic tree was constructed from evolutionary distances using the neighbor joining method 9. Tree files generated by PHYLIP were further viewed by TREE VIEW program. Bootstrap analysis (1000 replications) was applied. Culture conditions for production of alkaline protease The selected strain was grown at ph 10 in the medium containing 10 g casein, 4 g yeast extract, 0.5 g KH 2 PO 4, 0.5 g K 2 HPO 4, 0.5 g CaCl 2 in 1 L deionized water. Aliquot of 100 ml medium was dispensed in 250 ml flask, autoclaved at 115 o C for 15 min and inoculated with 3% inoculum of strain KBDL4 and incubated at 30 o C in incubator shaking at 200 rpm. The culture was harvested, centrifuged and the supernant was used for estimation of proteolytic activity. Assay of protease activity Protease activity was estimated by following the methods described by Kembhavi et al 10. A standard curve was generated using solutions of 0-50 mg/l tyrosine. One unit of protease activity was defined as the amount of enzyme required to liberate 1 µg of tyrosine per minute. Effect of ph on catalytic activity and stability of protease The optimum ph of the proteolytic activity was studied over ph range of The stability of crude enzyme was determined by incubating the crude enzyme preparation for 1 h at 40 o C in different buffers, and the residual proteolytic activity was determined under standard assay conditions. The following buffer systems were used: 100 mm acetate buffer, ph ; 100 mm tris-hcl buffer, ph ; 100 mm glycine-naoh buffer, ph ; 100 mm Na 2 HPO 4 -NaOH buffer ph 11.0; 100 mm KCl-NaOH buffer, ph Effect of temperature on catalytic activity and stability of protease The proteolytic activity was tested at different temperatures between 20 and 90 o C for 15 min at ph 10 in absence or presence of 5 mm CaCl 2 and between 40 and 80 o C in presence of 5 mm CaCl 2. The thermostability was examined by incubating the enzyme preparation at different temperatures for 120 min. Aliquots were withdrawn at desired time intervals, and the remaining proteolytic activity was measured under standard assay conditions. The non-heated crude enzyme was taken as 100%. Effect of various detergent additives, inhibitors and metal ions on proteolytic activity The effect of enzyme inhibitors on protease activity were studied using phenylmethyl sulfonyl fluoride (PMSF), ethylene diamine tetra acetic acid (EDTA), β-mercaptoethanol, and dithio-bis-nitrobenzoic acid (DTNB). The KBDL4 originated crude enzyme was pre-incubated with inhibitors for 30 min at 30 o C, and its activity was determined. The enzyme activity without inhibitor was considered as 100%. The effect of various metal ions (at a concentration of 5 mm) on proteolytic activity were investigated by adding Na +, K +, Ca 2+, Mn 2+, Zn 2+, Cu 2+, Ba 2+, Mg 2+ or Hg 2+ metal ions to the reaction mixture. The activity of the crude enzyme without metallic ions was considered as 100%. Effect of surfactants and oxidizing agents The suitability of the crude protease as a detergent additive was determined by testing its stability towards other essential and common detergent additives viz (SDS, Triton X-100, Tween 80) and oxidizing agents (H 2 O 2 and sodium perborate). The enzyme preparation was incubated with different concentration of additives for 1 h at 30 and 40 o C, and

3 PATHK & DESHMUKH: ALKALINE PROTEASE FROM BACILLUS LICHENIFORMIS KBDL4 571 then the residual proteolytic activities were measured. The activity of the enzyme without any additives was taken as 100%. Detergent compatibility The compatibility of the KBDL4 proteases with commercial laundry detergents was also studied by using Ariel (Procter and Gamble, Suisse), Tide (Procter and Gamble, Suisse), Rin (Hindustan Lever Ltd, India), Wheel (Hindustan Lever Ltd, India), Surf Excel (Hindustan Unilever Ltd, India) and Nirma (Nirma Ltd, India). Detergents were diluted in tap water to give final concentration of 7 mg/ml to simulate washing condition. The endogenous enzymes contained in laundry detergents were inactivated by heating the diluted detergents for 1 h at 65 o C prior to the addition of the enzyme preparation. The crude enzyme was incubated in detergent solutions for 1 hr at different temperature (30-50 o C), and then the activities were determined. The enzyme activity without detergent was taken as 100%. Stain removal potential Clean cotton cloth pieces (5cm 5cm) were soaked in blood and allowed to dry. The stained cloth pieces were washed at 37 o C for 30 min, with tap water, Surf Excel (0.7% (w/v), in tap water) and detergent fortified with crude enzyme from KBDL4. After incubation, each piece was rinsed with water for 2 min and then dried. Decomposition of gelatinous coating of X-ray film A piece of X-ray film (2 2 cm) was incubated with the extracted enzyme and incubated at 37 o C. The film was checked for decomposition of gelatinous coating for different incubation times. Results and Discussion Screening of bacterial isolates for protease production Of the 40 isolates 21 have produced alkaline proteases. All the 21 constituting strain KBDL4 was selected for further investigation. It is Gram positive and rod shaped bacterium, µm in length and µm in width growing at ph 8-11 with an optimal ph 10, and temperature at o C with an optimal temperature 30 o C. It produced oxidase, catalase, lipase, protease, gelatinase and amylase (Table 1). Based on morphological, physiological, biochemical characteristic 5 and phylogenetic analysis of its 16S rrna gene sequence it was identified as Bacillus licheniformis resembling with Bacillus licheniformis strain SE-KSU10 (Fig. 1). A 1326 bp 16S rdna gene sequence was submitted to NCBI GenBank (accession no. GU392041). Protease production Protease production was recorded in growth medium containing different carbon sources at a concentration of 10 g/l (Table.2) Bacillus licheniformis KBDL4 produced alkaline protease in culture media containing casein as a carbon source (1460 U/mL), while no protease activity was detected in the medium containing either glucose or maltose as a carbon source (Table 3). Similarly proteins and peptides are necessary for protease production, while glucose repressed protease formation 11,12. However, better protease synthesis in Table 1 Morphological and biochemical characterization of Strain KBDL4 Characters KBDL4 Morphology Rod Gram Nature + Motility + Oxidase + Catalase + ph range Salt range 0-8 Temperature range Urease - Nitrate reduction + H2S production - Lipase + Protease + Hydrolysis of: Casein + Gelatin + Starch + Utilization of: Arabinose - Fructose + D-Glucose + D-Galactose - D-Mannose + Lactose + Fig. 1 Phylogenetic tree of isolate KBDL4 to other Bacillus sp. Each number on a branch indicates the bootstrap values (1000 replicates). The scale bar indicates substitutions per nucleotide position

4 572 INDIAN J EXP BIOL, AUGUST 2012 presence of glucose as carbon source has also been reported 13,14. Enhanced protease production was recorded with soybean meal and yeast extract (Tables 4 and 5). Effect of temperature and ph on activity and stability of crude protease Protease of KBDL4 was active at temperatures between 20 and 90 o C and ph It showed maximum enzyme activity with or without 5 mm Ca 2+ at 70 and 60 o C, respectively, and retained 20% of its maximum activity at 90 o C (Fig. 2 a). Ca 2+ increased thermal stability of KBDL4 protease retaining about 93 and 80% of its original activity after incubation at 60 o C for 30 and 60 min, respectively (Fig. 2 b). Ca 2+ has been shown to increase the activity and thermal stability of alkaline protease at higher temperatures The enzyme showed maximum activity at ph 10. and was highly active between ph 8 and 12 (Fig. 3 a). KBDL4 protease was stable between ph 7 and 12 and retained about 90% of its activity after incubation at 30 o C for 6 hr (Fig. 3 b). The KBDL4 crude protease has higher ph stability compared to proteases from B. licheniformis NH1 19, B. cereus 20 and B. pumilus 21. Detergent and tanning industries preferably required such extremozymes 22,23. Effect of various enzyme inhibitors and metal ions on protease activity The crude proteolytic preparation was strongly inhibited by the serine protease inhibitor but not by thiol reagent (DTNB) (Table 6) EDTA (5 mm) caused loss of 22.20% of its original activity. Alkaline proteases from B. licheniformis NH1 19 and B. horikoshi 24 were completely inhibited by PMSF and partially inhibited by EDTA. Unlike the alkaline proteases of B. licheniformis RP1 those were completely inhibited by PMSF, where as 70% of this enzyme activity was inhibited by EDTA 25. The crude enzyme was found to be highly active in the presence of all metal ions tested. Enhanced protease activity (109%) was recorded after addition of CaCl 2, while MgSO 4, BaCl 2, CuSO 4, MnSO 4 and HgSO 4 inhibited the enzyme activity of KBDL4 crude extract by 4.5%, 3.5%, 9.0%, 24% and 42%, respectively. The enzyme activity was not affected by monovalent (Na + and K + ) Table 5 Effect of yeast extract concentration on protease produc Protease activity (U/mL) Biomass A 600 Yeast extract (g/l) Cultivation was performed for 24 h at 37 C in media consisting of (g/l): casein 10, KH 2 PO and K 2 HPO and different concentration of yeast extract. Table 2 Effect of different carbon sources on alkaline protease production Carbon source Casein Maltose Glucose Starch Lactose Protease activity (U/mL) Biomass A Cultivation were performed for 24 h at 37 C in media consisting of (g/l): carbon source 10, yeast extract 2, KH 2 PO and K 2 HPO Values are means of three independent experiments. Standard deviations ± 1.5% (based on three replicates). Table 3 Effect of casein concentration on protease production Casein (g/l) Protease activity (U/mL) Biomass A Cultivation were performed for 24 h at 37 C in media consisting of (g/l): yeast extract 2, KH 2 PO and K 2 HPO and different concentration of casein. Values are means of three independent experiments. Standard deviations ± 1.5% (based on three replicates). Table 4 Effect of different nitrogen sources on alkaline protease production Nitrogen source Yeast extract Soyabean meal Ammonium sulphate Peptone Urea None Protease activity (U/ml) Biomass A Cultivation were performed for 24 h at 37 C in media consisting of (g/l): casein 10, nitrogen source 2, KH 2 PO and K 2 HPO Values are means of three independent experiments. Standard deviations ± 1.5% (based on three replicates).

5 PATHK & DESHMUKH: ALKALINE PROTEASE FROM BACILLUS LICHENIFORMIS KBDL4 573 Table 6 Effect of some enzyme inhibitors and metal ions on activity and stability of KBDL4 protease Chemicals Concentration (mm) Activity (%) None 100% PMSF DTNB β-mercaptoethanol EDTA Ca Mg Zn Mn Cu Ba Hg Na K Fig. 2 Effect of temperature on activity and stability of KBDL4 (a) Relative activities with or without 5 mm CaCl 2 at different temperatures (b) Residual activities after incubation for various times at different temperatures, with or without 5 mm CaCl 2 Fig. 3 Effects of ph on the activity and stability of KBDL4 (a) Relative activities at different ph values (b) Stability at different ph values ions. There are reports where bacterial serine proteases are inhibited by Cu 2+, Mn 2+ and Hg 2+ 20,22,26. KBDL4 crude protease was preincubated with various inhibitors in 100 mm glycine NaOH buffer (ph 10.0) for 30 min at 30 C and then the residual activity was determined at ph 10.0 and 60 C. Enzyme activity measured in the absence of any additive was taken as 100%. Effect of metal ions on activity was determined by incubating KBDL4 crude protease at 60 C and ph Effect of organic solvent on protease activity and stability The stability of crude protease in organic solvent (at a final concentration of 20% (v/v)) was observed in the following order: n-hexane (log P 3.5) > methanol (log P ) > xylene (log P 3.1) > ethanol (log P ) ~ acetonitrile (log P ) > benzene (log P 2.0) (Fig. 4). There is a paucity of information on organic solvent tolerant microbial proteases and those enzymes that function in nonaqueous solvent offers new avenues of their industrial application 27,28. Interestingly, KBDL4 demonstrated higher stability in methanol compared to xylene although log P value of former was higher than the latter solvent. Effect of surfactant and oxidizing agents on protease activity The enzyme KBDL4 was incubated for 60 min at 30 and 40 o C in the presence of additives and then the residual protease activity was assayed at ph 10 and at 60 o C (Table 7). Stability of crude protease in the presence of the non-ionic surfactant was high. It retained more than 76% of its initial activity in the presence of 5% Triton X-100 and more than 80% with 5% Triton-X 100, after 1 hr incubation at 30 o C. In addition the crude

6 574 INDIAN J EXP BIOL, AUGUST 2012 enzyme was highly stable in the presence of strong anionic surfactant (1% SDS), retaining approximately 97% of its initial activity after 1 hr incubation at 30 o C, while the residual activity was only 40% after 1h incubation at 40 o C. Alkaline proteases from B. pumilus lost 22% of its activity by treatment with 0.1% SDS for 1h 29. The enzyme preparation was subsequently tested for its stability with oxidizing agents. KBDL4 crude enzyme was slightly influenced by oxidizing agents (Table 6). It retained about 78% and 82% of its initial activity after 1 h incubation at 40 o C in the presence of 1% (v/v) H 2 O 2 and 0.2% (w/v) sodium perborate, respectively. The stability of Fig. 4 Organic solvent stability of KBDL4. Enzyme activity in the absence of solvents were considered as 100% activity and other values were compared with that. Table 7 Stability of KBDL4 crude protease in presence of various surfactants and bleaches Oxidizing agents Concentration (%) Residual activity (%) 30 C 40 C None SDS 0.1 (w/v) Triton X (w/v) Tween 80 1 (w/v) H 2 O 2 1 (w/v) Sod. 0.2 (w/v) Perborate KBDL4 proteases were incubated with different surfactants and oxidizing agents for 1 h at 30 and 40 C and the remaining activity was measured under standard conditions. The activity is expressed as a percentage of the activity level in the absence of additives. proteolytic enzymes from KBDL4 strain was similar to crude protease from B. licheniformis NH 1 after incubation with 1% H 2 O 2 and 0.2% sodium perborate for 1 h at 40 o C 19. The alkaline protease from Bacillus spp RGR-14 showed 40% loss in enzyme activity in the presence 1% H 2 O Alkaline proteass from Bacillus sp. 103 and B. clausii I-52 retained 91% and 114% of the enzyme activity by treating with 1% H 2 O 2 for 72 h, respectively 31. In order to be effectively during washing, a good detergent protease must be compatible and stable with all commonly used detergent compounds such as surfactant, bleaches, oxidizing agents and other additives, which might be present in detergent formulation 27. Stability in the presence of detergents To check the compatibility of the alkaline protease with detergents, the enzyme was pre-incubated in the presence of detergent for 1 h at 40 o C and ph 10. The detergents were diluted in tap water to a final concentration of 7 mg/ml to stimulate washing conditions. The residual activity was assayed at ph 10 and compared with control sample incubated under the same conditions without detergents. The data show that the enzyme is extremely stable in the presence of Surf Excel, Nirma and Tide retaining about 97, 95 and 92% of its initial activity (Fig. 5). In the presence of Ariel and Wheel the enzyme retained about 80% of the original activity. However, the enzyme was found to be least stable in the presence of Rin, retaining about 62% of its initial activity. These findings shows that KBDL4 crude protease is better than the reported alkaline protease from Spilosoma oblique 32 which retained 80% of its initial activity with Surf, 60% with Nirma and 30% with Ariel after 1 hr incubation at 40 o C at ph Excellent detergent enzymes are expected to be active in the Fig. 5 Detergent stability and compatibility of KBDL4 at 37 C. Enzyme activity in the absence of detergent was considered as 100% activity and other values were compared with that.

7 PATHK & DESHMUKH: ALKALINE PROTEASE FROM BACILLUS LICHENIFORMIS KBDL4 575 presence of laundry detergents during washing conditions. These results clearly indicating that the performance of the enzymes in detergents depends on number of factors, including the detergents compounds since the proteolytic stability varied with each laundry detergent. Stain removal from cotton fabrics and decomposition of gelatinous coating on X-ray film In view of the excellent laundry detergent stability of enzyme KBDL4, its stain removal potency for application in commercial laundry detergent was evaluated. It was observed that enzyme KBDL4 could remove blood stain from cotton fabrics. It has been recommended that proteases and other hydrolytic enzymes to be used in detergent formulations should be effective at low levels ranging from 0.4 to 0.8% 33 and therefore, it is reasonable to assume that enzyme KBDL4 is an ideal member for use in laundry detergent (Fig. 6). This is an important property of detergent enzymes as they are required to act on protein substrates attached to solid surfaces, making them attractive additives to hard surface cleaners. They could also help in the removal of proteinaceous stains that are often encountered in the laundry. Usefulness of alkaline proteases in the facilitation of blood stains removal from cotton cloth 22, Protease had completely decomposed the gelatinous coating on the X-ray film with an incubation of 24 hr which is useful in the recovery of silver (Fig. 7). Conclusions An alkaliphilic bacterial strain isolated from the Lonar soda lake of India was identified as B. licheniformis KBDL4. It produced protease that was highly stable and active at high ph and showing optimum activity at ph 8 12 and at 60 o C. The KBDL4 crude protease showed excellent stability and compatibility with various commercial detergents. Considering the high activity and stability in high alkaline ph and temperature, stability in the presence of surfactants and stability in the presence of various commercial detergents, the KBDL4 protease may find potential application in laundry detergents. The enzyme could decolorize a blood stain on cotton fabrics indicating its potential use in detergent formulation. KBDL4 protease has the commercial application in decomposing of gelatinous coating on the X-ray films. Acknowledgement Thanks are due to Dr Yogesh Shouche, National Centre for Cell Science, Pune for molecular analysis, Prof. S Mohan Karuppayil for guidance and Prof. S B Nimse, Hon ble VC, S.R.T.M. University for facilities. Fig. 6 Washing performance analysis of the Bacillus licheniformis enzyme preperation in the presence of commercial detergent Surf Excel. (a) Cloth stained with blood washed with tap water; (b) blood stained cloth washed with Surf Excel; (c) blood stained cloth washed with Surf Excel added with crude enzyme of Bacillus licheniformis KBDL4. I: untreated cloths (control) and II: treated cloths. Fig. 7 Decomposition of gelatinous coating on X-ray film. References 1 Anissa Haddar, Rym Agrebi, Ali Bougatef, Noomen Hmidet, Alya Sellami-Kamoun & Moncef Nasri, Two detergent stable alkaline serine- proteases from Bacillus mojavensis A21: Purification, characterization and potential application as a laundry detergent additive, Bioresource Technol, 100 (2009) Kanekar P P, Nilegaonkar S S, Sarnaik S S & Kelkar A S, Optimization of protease activity of alkaliphilic bacteria isolated from an alkaline lake in India, Bioresource Technol, 85 (2002) Deshmukh K B, Pathak A P & Karuppayil M S, Bacterial diversity of Lonar soda lake of India, Indian J Microbiol, 51 (1) (2011) Aneja KR, Experiments in Microbiology, plant pathology and biotechnology. 4 th edition, (New International Publishers, New Delhi) Peter HA, Sneath Nicolas S & Mair M, Bergey s manual of systematic bacteriology edited by Elisabeth Sharpe & John G. Holt., Vol 2, (Williams and Wilkins Publication)1986.

8 576 INDIAN J EXP BIOL, AUGUST Yates C, Gilling M R, Davison A D, Altavilla N & Veal D A, PCR amplification of crude microbial DNA extracted from soil, Lett Appl Microbiol, 25 (1997) Ausubel F M, Brent R, Kingston R E, Moore D D, Seidman J G, Smith J A & Struhl K, The polymerase chain reaction, in Short protocols in molecular biology, 5th edn. Vol II. (Wiley, New York) Thompson J D, Higgins D G & Gibson T J, CLUSTAL W: improving sensitivity of progressive multiple sequence alignments through sequence weighing, position-specific gap penalties and weight matrix choice, Nucleic Acids Res, 22 (1994) Saitou N & Nei M, The neighbour joining method a new method for reconstructing phylogenetic trees, Mol Biol Evol, 4 (1987) Kembhavi A A, Kulkarni A & Pant A, Salt-tolerant and thermostable alkaline protease from Bacillus subtilis NCIM 64, App Biochem Biotechnol, 38 (1993) Fukushima Y, Itoh H, Fukase T & Motai H, Continuous protease production in a carbon-limited chemostat culture by salt tolerant Aspergillus oryzae, App Microbiol Biotechnol, 30 (1989) Drucker H, Regulation of exocellular protease in Neurospora crassa: induction and repression of enzyme synthesis, J Bacteriol, 110 (1972) Ferrero M A, Castro G R, Abate C M, Baigori M D & Sineriz F, Thermostable alkaline proteases of Bacillus licheniformis MIR 29 isolation, production and characterization, Appl Microbiol Biotechnol, 45 (1996) Mehrotra S, Pandey P K, Gaur R & Darmwal N S, The production of alkaline protease by a Bacillus species isolate, Bioresour Technol, 67 (1999) Durham D R, Stewart D B & Stellwag E J, Novel alkalineand heat-stable serine proteases from alkalophilic Bacillus sp. strain GX6638, J Bacteriol, 169 (1987) Rahman R N Z A, Razak C N, Ampon K, Basri M, Yunus W M Z W & Salleh A B, Purification and characterization of a heat-stable alkaline protease from Bacillus stearothermophilus F1, Appl Microbiol Biotechnol, 40 (1994) Kumar C G, Tiwari M P & Jany K D. Novel alkaline serine proteases from alkalophilic Bacillus spp.: purification and some properties, Process Biochem, 34 (1999) Patel R K, Dodia M S, Joshi R H & Singh S P, Purification and characterization of alkaline protease from a newly isolated haloalkaliphilic Bacillus sp., Process Biochem, 41 (2006) Hmidet N, El-Hadj Ali N, Haddar A, Kanoun S, Sellami- Kamoun A & Nasri M, Alkaline proteases and thermostable amylase co-produced by Bacillus licheniformis NH1: characterization and potential application as detergent additive, Biochem Eng, J 47 (2009) Manni L, Jellouli K, Ghorbel-Bellaaj O, Agrebi R, Haddar A, Sellami- Kamoun A & Nasri M, Anoxidant-and solventstable protease produced by Bacillus cereus SV1: Application in the deproteinization of shrimp wastes and as a laundry detergent additive, Appl Biochem Biotechnol, 160 (2010) Fakhfakh-Zouari N, Haddar A, Hmidet N, Frikha F & Nasri M, Application of statistical experimental design for optimization of keratinases production by Bacillus pumilus A1 grown on chicken feather and some biochemical properties, Process Biochem, 45 (2010) Beg Q K & Gupta R, Purification and characterization of an oxidation-stable, thiol-dependent serine alkaline protease from Bacillus mojavensis, Enzyme Microb Technol, 32 (2003) Joo H S, Kumar C G, Park G C, Paik S R & Chang C S, Oxidant and SDS-stable alkaline protease from Bacillus clausii I-52: production and some properties, J Appl Microbiol, 95 (2003) Joo H S, Kumar C G, Park G C, Kim K T, Paik S R & Chang C S, Optimization of the production of an extracellular alkaline protease from Bacillus horikoshii, Process Biochem, 38 (2002) Sellami-Kamoun A, Haddar A, El-HadjAli N, Ghorbel-Frikha B, Kanoun S & Nasri M, Stability of thermostable alkaline protease from Bacillus licheniformis RP1 in commercial solid laundry detergent formulations, Microbiol Res, 163 (2008) Venugopal M & Saramma A V, Characterization of alkaline protease from Vibrio fluvialis strain VM10 isolated from a mangrove sediment sample and its application as a laundry detergent additive, Process Biochem, 41 (2006) Gupta A & Khare S K, Enhanced production and characterization of a solvent stable protease from solvent tolerant Pseudomonas aeruginosa Pse A, Enzyme Microb Technol, 42 (2007) Rai S K & Mukherjee A K, Ecological significance and some biotechnological application of an organic -solvent stable alkaline serine protease from Bacillus subtilis strain DM-04, Bioresour Technol, 100 (2009) Kumar C G, Purification and characterization of thermostable alkaline protease from alkalophilic Bacillus pumilus, Lett Appl Microbiol, 34 (2002) Oberoi R, Beg Q K, Puri S, Saxena R K & Gupta R, Characterization and wash performance analysis of an SDSstable alkaline protease from a Bacillus sp., World J Microbiol Biotechnol, 17 (2001) Joo H S, Kumar C G, Park G C, Paik S R & Chang C S, Bleach-resistant alkaline protease produced by a Bacillus sp. isolated from the Korean polychaete, Periserrula leucophryna, Process Biochem, 39 (2004) Anwar A & Saleemuddin M, Alkaline protease from Spilosoma oblique: potential application in bio-formulations, Biotechnol App Biochem, 31 (2000) Kumar C G & Takagi H, Microbial alkaline proteases: from a bioindustrial viewpoint, Biotechnol Adv, 17 (1999) Anwar A & Saleemuddin M, Alkaline ph acting digestive enzymes of the polyphagous insect pest Spilosoma obliqua: stability and potential as detergent additives, Biotechnol Appl Biochem, 25 (1997) Banerjee U C, Sani R K, Azmi W & Soni R, Thermostable alkaline protease from Bacillus brevis and its characterization as a laundry detergent additive, Process Biochem, 35 (1999) Rao C S, Sathish T, Ravichandra P & Prakasham R S, Characterization of thermo and detergent stable serine protease from isolated Bacillus circulans and evaluation of eco-friendly applications, Process Biochem, 44 (2009) 262.