T and B cell gene rearrangement October 17, Ram Savan

Size: px
Start display at page:

Download "T and B cell gene rearrangement October 17, Ram Savan"

Transcription

1 T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28

2 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR Janeway Chapter 4 Part 2 (Today): Assembly of antigen receptor genes Janeway Chapter 5; through section 5-10 Part 3 (next Wednesday): Somatic diversification of BCRs: Hypermutation and class switch recombination Janeway Chapter Lecture #9 Slide 2 of 28

3 Generating diversity in the adaptive immune system There are ~ 2 trillion (2 x ) lymphocytes in an average adult human (B + T cells). Roughly equal to the mass of the brain or the liver. In principle, each one of these lymphocytes can have a unique receptor and a unique specificity for antigen. These antigen receptors are assembled in a completely anticipatory fashion, before they ever detect antigen. How in the world is this diversity achieved at the genetic level when we only have ~10 5 genes to work with? 441 Lecture #9 Slide 3 of 28

4 Ig light chain constant and variable domains Each domain consists of polypeptide strands running in opposite directions, arranged in sheets (antiparallel b sheets). The sheets are linked by a disulfide bond and folded (rolled) into b barrels. This domain is the Ig fold, very evolutionarily useful: >750 human genes have them (Heavy chain is similar) 441 Lecture #9 Slide 4 of 28

5 Hypervariable regions form the antigen binding sites Antigen binding site: 3 HV regions from heavy chain 3 HV regions from light chain (Two of these sites per Ab molecule) These regions are complementary to the antigen: complementarity determining regions (CDRs). 441 Lecture #9 Slide 5 of 28

6 Hypervariable regions CDR1 CDR2 CDR3 FR1 FR2 FR3 441 Lecture #9 Slide 6 of 28

7 Nomenclature Genes in multicellular organisms are made of exons and introns: Exons are spliced together into the mature mrna Introns are removed after transcription Open reading frames are the continuous sequences in mature mrnas that encode proteins Codons are units of three bases that encode a single amino acid; codons form the open reading frame Four DNA bases: G, C, A, T. G pairs with C A pairs with T 441 Lecture #9 Slide 7 of 28

8 Ig genes are rearranged in B cells germline DNA V Restriction enzyme site C B cell DNA V C Isolate and digest DNA Run digested DNA on a gel Transfer separated DNA fragments onto a membrane Hybridize radiolabeled V- and C-specific probes to the membrane Develop film B and T cells are the ONLY cells in the body that do this!!! Nobel Prize, 1987: Susumu Tonegawa. 441 Lecture #9 Slide 8 of 28

9 Ig light chain genes are rearranged in B cells Separate V (variable), J (joining), and C (constant) region gene segments. During B cell development, light chain genes are rearranged, bringing a V and a J together. The intron between the J and C segments is spliced out of the mrna during transcription. The light chain variable domain is encoded by V and J gene segments. 441 Lecture #9 Slide 9 of 28

10 Ig heavy chain gene rearrangements in B cells Separate V, D (diversity), J, and C (constant) region gene segments 1: D-J rearrangement occurs first 2: V DJ rearrangement occurs second 3: mrna splicing joins the VDJ to the constant region exons The heavy chain variable domain consists of V, D, and J gene segments 441 Lecture #9 Slide 10 of 28

11 Germline organization of the Ig loci Each of these loci is on a different chromosome Not drawn to scale: the Heavy Chain locus is over 2 million base pairs long Vs are all together, Ds are together, Js are together. Exception: l locus White boxes ahead of each V are leader sequences encoding signal peptides Constant region introns are left out of this diagram 441 Lecture #9 Slide 11 of 28

12 Gene segments enable combinatorial diversity There are many copies of V, D, and J segments in germline DNA Any V can pair with any J in light chains (190 k), (165 l) There are two light chain gene loci, Kappa (k) and Lambda (l) Any D can pair with any J in heavy chains (138) Any V can pair with any D-J in heavy chains (6348) Any light chain can pair with any heavy chain (355 x 6348) Start with 156 V, D, J gene segments Total theoretical diversity just by VDJ recombination: 2,253,540! 441 Lecture #9 Slide 12 of 28

13 The control of Ig gene rearrangement Ig gene rearrangement is very carefully controlled Recombination must take place at the precisely right location in the locus VDJ must occur at the correct stage of lymphocyte development (and only then!) Aberrant DNA recombination is responsible for lots of cancers (more on this in another lecture) Today: focus on control at the level of DNA Ig locus first, TCR locus second 441 Lecture #9 Slide 13 of 28

14 RSS control the location and order of Ig gene rearrangement Recognition of recombination signal sequences (RSS) starts rearrangement Each RSS is made of: A ~palindromic heptamer An AT-rich nonamer separated by spacer sequences that are either 12 or 23 bp long Recombination ONLY occurs between RSS elements with 12 and 23 bp spacers This restriction of recombination is called the 12/23 rule 441 Lecture #9 Slide 14 of 28

15 RSS control the location and order of Ig gene rearrangement 23 bp RSS are in purple, 12 bp RSS are in orange In each locus, all Vs, (Ds), and Js have the same type of RSS According to rule, V-J in the heavy chain is forbidden (also V-V, J-J ) 441 Lecture #9 Slide 15 of 28

16 Ig light chain V-J gene rearrangement Initial pairing between V1 and J brings the RSSs together Rearrangement mostly takes place between gene segments found on the same chromosome (not across chromosomes) Some V genes are in the opposite transcriptional orientation; don t worry about these 441 Lecture #9 Slide 16 of 28

17 Recombination overview Recombination occurs precisely at the ends of the RSS heptamer sequences This occurs by cutting the DNA and sealing it back together into two pieces: The signal joint (includes the RSSs) is sealed as a closed circle that is lost forever from the chromosome The coding joint is retained in the chromosome and contains the newly juxtaposed V and J segments What proteins accomplish this??? 441 Lecture #9 Slide 17 of 28

18 Recombination Activating Genes (RAG-1 and RAG2) RAG-1 and RAG-2 form a DNA endonuclease that recognizes the RSSs Expressed only in lymphocytes, and at specific times during their development RAG-1/2 are likely derived from a DNA transposon that disrupted an ancient antigen receptor gene This occurred in a common ancestor of all jawed vertebrates (all have RAGs) All of this antigen receptor diversity is likely derived from an old virus!!! 441 Lecture #9 Slide 18 of 28

19 Enzymatic steps in Ig light chain V-J rearrangement Two RAG1/2 complexes align the two RSS Blunt-ended DNA breaks are made between the heptamer and coding sequences The free 3 OH group at the end of each coding segment attacks the other strand, forming a closed hairpin Ku70/Ku80 binds to all of these DNA ends and holds them together. (These are general DNA repair molecules expressed in all cells) 441 Lecture #9 Slide 19 of 28

20 Resolving the signal joint (easy) After Ku70/Ku80 binding, no further modification of signal joint DNA occurs DNA ligase / XRCC4 is recruited by the Ku70/Ku80 proteins and the ends are ligated (sealed) The signal joint cannot replicate and is diluted out as cells divide 441 Lecture #9 Slide 20 of 28

21 Resolving the coding joint: Where all the action happens The DNA ends of the coding joint are covalently closed hairpins Ku70/Ku80 recruits DNA-PK, which brings along an nicking endonuclease called Artemis Artemis nicks the DNA near each end, opening the hairpins Terminal deoxynucleotidyl transferase (TdT) can add nucleotides randomly to the single-stranded DNA ends DNA ligase / XRCC4 complex joins the ends together The result: an imprecise coding joint that contains new (non-genome-encoded) sequence!! 441 Lecture #9 Slide 21 of 28

22 Details of the imprecise coding joint resolution heptamers RAG1/2 cleaves the DNA between the heptamers and the coding sequences These blunt ends form covalent hairpins Artemis nicks the DNA near each end, opening the hairpins These opened ends form the P nucleotides, which are palindromic (read the same backwards and forwards in dsdna) TdT adds random nucleotides (up to 20) to the ends of these ssdna segments this happens mostly in Ig Heavy chain genes The non-templated nucleotides are called N-nucleotides 441 Lecture #9 Slide 22 of 28

23 Details of the imprecise coding joint resolution The ssdna extensions made by TdT pair up to form regions of microhomology one to two base pairs Unpaired nucleotides are trimmed away by a DNA exonuclease (this is a general repair mechanism that occurs during DNA replication) The gaps are filled in by a DNA polymerase (also part of general repair) Ligase seals the strands The newly sealed coding joints are separated by P-N-P nucleotides that greatly increase possible diversity. 441 Lecture #9 Slide 23 of 28

24 The cost of random, imprecise coding joints The V(D)J junctional regions encode the CDR3s of each Ag receptor chain: This enables a massive increase in Ag receptor repertoire diversity BUT: the P/N nucleotide additions are random, and two out of every three of them encode a frameshift that disrupts the reading frame downstream Thus, 2/3 of all VDJ recombination events are non-functional, and millions of developing lymphocytes die every day in our bodies because they don t express a functional antigen receptor. All this diversity must be worth the energy of throwing away all these cells!!! 441 Lecture #9 Slide 24 of 28

25 The T cell receptor loci: similar rules TCRa locus looks similar to IgL locus (V-J-C) TCRb locus looks similar to IgH locus (V-D-J-C) No functional distinctions between Cb1 and Cb2 Constant region introns are left out of this diagram 441 Lecture #9 Slide 25 of 28

26 The T cell receptor loci: similar rules Similar to Ig loci, but more Ds and Js are shown here Remaining Js between the V-J and the C are removed by RNA splicing D-J occurs first, then V DJ second in the TCRb locus 441 Lecture #9 Slide 26 of 28

27 Mechanics of TCR gene rearrangements are the same (Don t worry about the gd T cells discussed in the book ) The 12/23 rule applies the same way to TCR chain loci Oddity: the Db gene segments have both 12 and 23 RSS, and Vb-Jb obey the 12/23 rule In TCRb locus, V-D-J, V-J, V-D-D-J are all possible (but not equally likely) The junctional diversity makes up the CDR3 of the TCRa and TCRb chains CDR3 sits right on top of the peptide!!! 441 Lecture #9 Slide 27 of 28

28 Adding up all the numbers V(D)J recombination + Junctional diversity = Astonishing theoretical diversity of lymphocyte antigen receptors!!! 441 Lecture #9 Slide 28 of 28

29 More diversity on Wednesday Even more diversity in B cell receptors that occurs after they meet antigen 441 Lecture #9 Slide 29 of 28

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy

More information

The generation of lymphocyte antigen receptors (Chapter 5):

The generation of lymphocyte antigen receptors (Chapter 5): The generation of lymphocyte antigen receptors (Chapter 5): 1. Ig Gene Rearrangement (somatic recombination). 2. Ig Somatic Hypermutation. 3. Ig Class Switching 4. T cell Receptor Gene Rearragement 1.

More information

IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS

IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig

More information

Immunoglobulins. Generation of Diversity

Immunoglobulins. Generation of Diversity Immunoglobulins Generation of Diversity Unfortunately, for this theory to be true the number of antibody genes would need to be 100-1000-fold greater than the entire human genome Introduction Immunologist

More information

Antibody Structure, and the Generation of B-cell Diversity. Chapter 4 5/1/17

Antibody Structure, and the Generation of B-cell Diversity. Chapter 4 5/1/17 Antibody Structure, and the Generation of B-cell Diversity B cells recognize their antigen without needing an antigen presenting cell Chapter 4 Structure of Immunoglobulins Structure and function Immunoglobulin

More information

GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D

GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of

More information

LECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:

LECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain

More information

Recombination Lecture, Dr. Aguilera 2/17/2014

Recombination Lecture, Dr. Aguilera 2/17/2014 Lymphocytes and Antigen Receptors Thymus T-Cells Lymph nodes Spleen } T+B-cells Paper Presentation: Bone Marrow Stem cells and B-cells Nat. Rev. Immunol. STEM CELL CLP Committed Lymphocyte Precursor T-cells

More information

Immunoglobulin's generation of diversity

Immunoglobulin's generation of diversity هللا مسب In this sheet, there are just the extra notes mentioned by the doctor, don't forget referring to slides. Immunoglobulin's generation of diversity Note that diversity is applied to T and B lymphocytes

More information

Atlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction

Atlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1

More information

Germ-line vs somatic-variation theories

Germ-line vs somatic-variation theories BME 128 Tuesday April 26 (1) Filling in the gaps Antibody diversity, how is it achieved? - by specialised (!) mechanisms Chp6 (Protein Diversity & Sequence Analysis) - more about the main concepts in this

More information

A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks

A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The

More information

Antibody Structure. Antibodies

Antibody Structure. Antibodies Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against

More information

Antibody Structure supports Function

Antibody Structure supports Function Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against

More information

Immunoglobulins Harry W Schroeder Jr MD PhD

Immunoglobulins Harry W Schroeder Jr MD PhD Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

بسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes

بسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes بسم هللا الرحمن الرحيم Today we're going to talk about the generation of diversity of the receptors of the lymphocytes The receptors of lymphocytes are : 1. B cells : immunoglobulins ; which are cell bound

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Andrea s SI Session PCB 3233

Andrea s SI Session PCB 3233 Practice Test Test 2 1. A pathogen invades a tissue. Which cell of the immune system is more likely to respond first? a. Neutrophil b. T Cell c. B Cell d. Macrophage 2. The receptor for C3b is? a. CR1

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Lecture 3. Used anti B cell marker antibodies to deplete in mice

Lecture 3. Used anti B cell marker antibodies to deplete in mice Lecture 3 V-Gene Rearrangement and Expression Used anti B cell marker antibodies to deplete in mice Rat anti mouse CD19, anti mouse B220, and anti mouse CD22. Mice were then injected with a secondary antibody

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

produces an RNA copy of the coding region of a gene

produces an RNA copy of the coding region of a gene 1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Fun with DNA polymerase

Fun with DNA polymerase Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase

More information

Immunological Techniques

Immunological Techniques Midterm Extra Office Hours Take Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina,

More information

Chapter 4. Antigen Recognition by B-cell and T-cell Receptors

Chapter 4. Antigen Recognition by B-cell and T-cell Receptors Chapter 4 Antigen Recognition by B-cell and T-cell Receptors Antigen recognition by BCR and TCR B cells 2 separate functions of immunoglobulin (Ig) bind pathogen & induce immune responses recruit cells

More information

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

TEMA 7. LA GENERACIÓN DE LA DIVERSIDAD

TEMA 7. LA GENERACIÓN DE LA DIVERSIDAD TEMA 7. LA GENERACIÓN DE LA DIVERSIDAD Ehrlich's side-chain theory. Ehrlich proposed that the combination of antigen with a preformed B-cell receptor (now known to be antibody) triggered the cell to produce

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Genetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination

Genetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Chapter 9 - Microbial Genetics Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Genetics Genome (The sum total of genetic material of a cell is referred to as the genome.) Chromosome

More information

How to Use This Presentation

How to Use This Presentation How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Basic principles of IG sequence analysis: Immunogenetic analysis: in vitro

Basic principles of IG sequence analysis: Immunogenetic analysis: in vitro IMMUNOGENETICS IN CLL IN THE NGS ERA Rotterdam, The Netherlands, November 24 th 2017 Basic principles of IG sequence analysis: Immunogenetic analysis: in vitro Lesley Ann Sutton Dept. of IGP, Uppsala University,

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA

DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Requirements for the Genetic Material

Requirements for the Genetic Material Requirements for the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell-generation to generation. 2. Information Storage Biologically useful information in a stable

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Syllabus for GUTS Lecture on DNA and Nucleotides

Syllabus for GUTS Lecture on DNA and Nucleotides Syllabus for GUTS Lecture on DNA and Nucleotides I. Introduction. DNA is the instruction manual for how to build a living organism here on earth. The instructions in DNA are propagated to future generations

More information

Chapter 13: Biotechnology

Chapter 13: Biotechnology Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

The Genetic Material. Unit 6: DNA & Protein Synthesis

The Genetic Material. Unit 6: DNA & Protein Synthesis Unit 6: DNA & Protein Synthesis The Genetic Material How was DNA discovered to be the chemical unit of heredity? Scientists already knew that chromosomes played a role in heredity, but the chemical composition

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Gene Expression: From Genes to Proteins

Gene Expression: From Genes to Proteins The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Answer Additional guidance Mark

Answer Additional guidance Mark 1(a) Additional guidance 1. idea that DNA (molecule){ unwinds / unzips / uncoils / eq} (DNA) strands separate ; 1. AL W description e.g. breaking of hydrogen bonds 2. (RNA mono) nucleotides {line up against

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it.

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it. * GEL ELECTROPHORESIS : its a technique aim to separate DNA in agel based on size, in this technique we add a sample of DNA in a wells in the gel, then we turn on the electricity, the DNA will travel in

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Immunoglobulins. Harper s biochemistry Chapter 49

Immunoglobulins. Harper s biochemistry Chapter 49 Immunoglobulins Harper s biochemistry Chapter 49 Immune system Detects and inactivates foreign molecules, viruses, bacteria and microorganisms Two components with 2 strategies B Lymphocytes (humoral immune

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Protein Synthesis: From Gene RNA Protein Trait

Protein Synthesis: From Gene RNA Protein Trait Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Figure A summary of spontaneous alterations likely to require DNA repair.

Figure A summary of spontaneous alterations likely to require DNA repair. DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information