2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?

Transcription

1 2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first DNA strand synthesis. Only the polyadenylated mrnas will anneal to the primers. 3. Redraw Figure 10-6 with the goal of adding one EcoRI end and one Xhol end. Below is the Xhol recognition sequence. Recognition sequence:... CTCGAG GAGCTC... After cut:... CTCGAG GAGCTC...

2 Answer:.s '... ccc; JIJI.7'.7'c GJJc;c1'ccc;.._s,! second round of PCR 5'GCGAATTC.S... CC'~,. ~1'2>c 5 ' GCGAA.TTC 3'CGCTTtG 5'AATTC 3 'G GJJc;crcc,.. "'"'5 GAGCTCCG-5'! Further rounds of PCR C~CGAGCC-3' GAGCTCCG- S' l oigest with EcoRitand.J.xhoi -= c-3' ~======~~====~~-- GAGCT-5'

3 6. In Figure 10-15, why does DNA migrate to the anode (+ pole)? Answer: DNA moves toward the positive pole in agarose gel electrophore because it is negatively charged. 7. In Figure (a), why are DNA hgments of different length and all emlint an A residue synthesized? Answer: As DNA is synthesized in the sequencing reaction, the e randomly insert either datp or ddatp across fiom T residues. I selected, then the chain will terminate, as there is no 3'OH available for ad of the next nucleotide. As a result, the reaction will include fragments that terminated at every position where an A is required.

4 10. In Figure 10-26, why do only plant cells that have T-DNA inserts in their chromosomes grow on the agar plates? Do all of the cells of a transgenic plant grown from one clump of cells contain T-DNA? Justify your answer. Answer: The T-DNA carries the kanamycin resistance gene; therefore, only cells that have acquired T-DNA inserts will grow on the agar plates containing the drug that selects for KanR.

5 18. In at-dna transformation of a plant with a transgene from a fungus (not found in plants), the presumptive transgenic plant does not express the expected phenotype of the trans gene. How would you demonstrate that the trans gene is in fact present? How would you demonstrate that the transgene was expressed? Answer: You could isolate DNA from the suspected transgenic plant and probe for the presence of the trans gene by Southern hybridization.

6 20. Why was edna and not genomic DNA used in the commercial cloning of the human insulin gene? Answer: The commercial cloning of insulin was into bacteria. Bacteria are not capable of processing introns. Genomic DNA would include the introns, while edna is a copy of processed (and thus intron-free) mrna.

7 23. In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of the haploid fungus Neurospora crass a (n = 7) moves slowly but eventually forms seven bands, which represent DNA fractions that are of different sizes and hence have moved at different speeds. These bands are presumed to be the seven chromosomes. How would you show which band corresponds to which chromosome? Answer: Size, translocations between known chromosomes, and hybridization to probes of known location can all be useful in identifying which band on a PFGE gel corresponds to a particular chromosome. 24. The protein encoded by the cystic-fibrosis gene is 1480 amino acids long, yet the gene spans 250 kb. How is this difference possible? Answer: Conservatively, the amount of DNA necessary to encode this protein of 445 amino acids is 445 x 3 = 1335 base pairs. When compared with the actual amount of DNA used, 60 kb, the gene appears to be roughly 45 times larger than necessary. This "extra" DNA mostly represents the introns that must be correctly spliced out of the primary transcript during RNA processing for correct translation. (There are also comparatively very small amounts of both 5' and 3' untranslated regions of the final mrna that are necessary for correct translation encoded by this 60-kb of DNA.)

8 27. A cloned fragment of DNA was sequenced by using the dideoxy chaintermination method. A part of the autoradiogram of the sequencing gel is represented here. dda ddg ddt ddc a. Deduce the nucleotide sequence of the DNA nucleotide chain synthesized from the primer. Label the 5' and 3' ends. b. Deduce the nucleotide sequence of the DNA nucleotide chain used as the template strand. Label the 5' and 3' ends. c. Write out the nucleotide sequence of the DNA double helix (label the 5' and 3' ends). d. How many of the six reading frames are "open" as far as you can tell?

9 Answer: a. The gel can be read from the bottom to the top in a 5 '-to-3' direction. The sequence 1s 5' TTCGAAAGGTGACCCCTGGACCTTTAGA 3' b. By complementarity, the template was 3' AAGCTTTCCACTGGGGACCTGGAAATCT 5' c. The double helix is 5' TTCGAAAGGTGACCCCTGGACCTTTAGA 3' 3' AAGCTTTCCACTGGGGACCTGGAAATCT 5' d. Open reading frames have no stop codons. There are three frames for each strand, for a total of six possible reading frames. For the strand read from the gel, the transcript would be 5' UCUAAAGGUCCAGGGGUCACCUUUCGAA 3' And for the template strand 5' UUCGAAAGGUGACCCCUGGACCUUUAGA 3' Stop codons are in bold and underlined. The two stop codons in the mrna read from the template strand are both in the same reading frame. There are a total of four open reading frames of the six possible.