REPRINT WITH PERMISSION ONLY

Size: px
Start display at page:

Download "REPRINT WITH PERMISSION ONLY"

Transcription

1 Reports An improved collagen zymography approach for evaluating the collagenases MMP-1, MMP-8, and MMP-13 Seniz Inanc, Didem Keles, and Gulgun Oktay Dokuz Eylul University, School of Medicine, Department of Medical Biochemistry, Izmir, Turkey BioTechniques 63: (October 2017) doi / Keywords: collagen zymography; MMP-1; MMP-8; MMP-13; type I collagen Supplementary material for this article is available at /article/ Collagen zymography is an SDS-PAGE based method for detecting both the proenzyme and active forms of collagenases. Although collagen zymography is used for assessment of the matrix metalloproteinases MMP-1 and MMP-13, it can be difficult to detect these collagenases due to technical issues. Moreover, it remains unclear whether the collagenase activity of MMP-8 can be detected by this method. Here, we present an improved collagen zymography method that allows quantification of the activities of MMP-1, MMP-8, and MMP-13. Activities of recombinant collagenases could be detected in collagen zymogram gels copolymerized with 0.3 mg/ml type I collagen extracted from rat tail tendon. This improved method is sensitive enough to detect the activity of as little as 1 ng of collagenase. We generated standard curves for the three collagenases to quantify the collagenolytic activity levels of unknown samples. To validate our improved method, we investigated MMP-1 activity levels in human thyroid cancer (8505C) and normal thyroid (Nthy-ori-3 1) cell lines, finding that the proenzyme and active MMP-1 levels were greater in 8505C cells than in Nthy-ori-3 1 cells. Taken together, our data show that collagen zymography can be used in both molecular and clinical investigations to evaluate collagenase activities in various pathological conditions. It has been well-documented that matrix metalloproteinases (MMPs), which are zinc-dependent endopeptidases, participate in proteolytic turnover and cleavage of several extracellular matrix (ECM) components and non-ecm molecules (1). MMP-1, MMP-8, and MMP-13 are major secreted collagenases capable of destroying type I, II, III, V, and IX collagen as well as native fibrillary collagen (2). These proteases play a significant role in tissue regeneration and organ development during ECM remodeling. It has been demonstrated that dysregulation of collagenases can lead to a wide range of pathological conditions, including rheumatoid arthritis (3), osteoarthritis (4), chronic ulcer (5), and tumor progression and metastasis (6). Therefore, detection of the activities of these enzymes could provide significant diagnostic and prognostic information, leading to optimal selection of treatment options. Substrate zymography is one of the most widely used techniques for detecting proteolytic activity (7). In this method, proteins are separated in an SDS-PAGE gel copolymerized with a specific substrate (e.g., gelatin, casein, or collagen) under non-reducing conditions and without heating. SDS induces non-proteolytic activation of the proenzyme, which triggers degradation of the substrate by the active enzyme. This phenomenon makes it possible to analyze both the proenzyme and the active form (8). When the gels are stained, the digested areas appear as clear bands against a dark background. Collagen zymography is the preferred method for evaluating collagenase 174 (MMP-1, MMP-8, and MMP-13) activities for the following reasons: (i) it is easy and inexpensive compared with techniques such as western blot, ELISA, and activity assays, and (ii) it allows for analyses of not only the proenzyme and active forms but also glycosylated isoforms. However, there are technical problems that need to be considered, including selection of the appropriate collagen type and concentration, determination of collagenase sensitivity, and identification of collagenases separately despite their similar molecular weights. Collagen zymography was developed by Gogly et. al. (9). Although the authors optimized their method to analyze MMP-1 activity, they did not investigate MMP-8 and MMP-13 activities. Here, we improve on the collagen zymography method for quantitative analysis of collagenases (MMP-1, MMP-8, REPRINT WITH PERMISSION ONLY METHOD SUMMARY Collagen zymography was optimized by using type I collagen extracted from rat tail tendon in order to evaluate glycosylated, latent, and active forms of human collagenases. In addition, standard curves were generated to quantify the collagenase activity of unknown samples.

2 REPORTS and MMP-13) by creating standard curves for each collagenase. Materials and methods Extraction and purification of type I collagen from rat tail tendon Rat tails were obtained from 6 7-month-old Wistar rats (Dokuz Eylul University, Experimental Animals Laboratory) and stored at -20 C until the extraction procedure. The protocol was approved by the Ethics Committee at Dokuz Eylul University. Rat tails were incubated in 70% ethanol for 20 min at room temperature. After removing the skin, tendons were dissected out and minced with a scalpel under aseptic conditions. The tendons were transferred to 17 mm acetic acid (50 ml per tail) and stirred for 48 h at 4 C. The insoluble materials were centrifuged at 30,000 x g for 60 min at 4 C. The supernatant, which contained collagen, was neutralized to ph 7.0 with 0.1 M NaOH and then stirred for 90 min at 4 C. The precipitated collagen was centrifuged at 10,000 x g for 20 min at 4 C, and the pellet was dissolved in 17 mm acetic acid and stirred for 48 h at 4 C (10). The total collagen concentrations were measured by the BCA (bicinchoninic acid) assay (Thermo Fisher Scientific, Waltham, MA). SDS-PAGE The purity of the extracted type I collagen was evaluated by SDS-PAGE (11). Briefly, samples were mixed with 2 sample buffer (125 mm Tris, 4% SDS, 10% b-mercaptoethanol, 20% glycerol, 0.004% bromophenol blue, ph 6.8) and heated at 95 C for 5 min. Extracted collagens were separated by 5% resolving gels (110 V for 60 min) and stained with 0.5% Coomassie Blue R-250 (Sigma- Aldrich, Taufkirchen, Germany) (w/v) (40% methanol, 10% acetic acid). Protein molecular weight markers (4 250 kda) (SeeBlue Plus 2 Prestained Standard, Cat no. LC5925; Invitrogen Corporation, Carlsbad, CA) were used to calculate the relative molecular weights of purified type I collagen specific bands by LabWorks 4.6 Image Acquisition and Analysis Software (UVP Inc, Upland, CA). Preparation of commercial type I and II collagen Type I collagen from rat tail tendon and type II collagen from chicken sternal cartilage (Sigma-Aldrich) were reconstituted to 5 mg/ml in 0.01 M and M acetic acid, respectively. The solutions were stirred at 4 C for 48 h until the collagen dissolved. Collagen zymography Collagen zymography was standardized to analyze the proenzyme and active forms of the collagenases (MMP-1, MMP-8, and MMP-13) according to the method of Heussen and Dowdle (12). SDS-PAGE gels (10% polyacrylamide) were copolymerized with mg/ml of purified type I collagen, commercial type I collagen, or type II collagen. Recombinant human pro-collagenases (1 100 ng) (rh-prommp-1, rh-prommp-8, and rh-prommp-13) (R&D Systems, Minneapolis, MN) were mixed with non-reducing 2 sample buffer (0.625 M Tris, 20% glycerol, 4% SDS, 0.004% bromophenol blue, ph 6.8) and then electrophoresed at a constant voltage of 110 V for 2 h at 4 C. Gels were washed twice in 2.5% Triton X-100 (v/v) for 15 min to remove SDS and then incubated in developing buffer (50 mm Tris, 10 mm CaCl 2, 50 mm NaCl, 0.05% Brij 35 (Sigma-Aldrich), ph 7.6) at 37 C for 48 h. After incubation, gels were stained with 0.5% Coomassie Blue R-250 (w/v) and then destained in 40% methanol and 10% acetic acid solution. Collagenolytic activities were detected as clear bands against a Coomassie Blue stained gel background. Semiquantification of digested bands was performed with LabWorks 4.6 Image Acquisition and Analysis Software. Cell culture The SV40-transfected and immortalized normal human primary thyroid follicular epithelial cell line Nthy-ori 3 1 and the human undifferentiated anaplastic thyroid cancer cell line 8505C were purchased from the DSMZ - German Collection of Microorganisms and Cell Culture (DMSZ, Braunschweig, Germany). Nthy-ori 3 1 and 8505C cells were cultured in RPMI-1640 (Lonza, Basel, Switzerland) supplemented with 10% FBS, 2 mm L-glutamine, and 100 U/mL penicillin 100 µg/ml streptomycin. All cells were grown in a humidified incubator (5% CO 2 at 37 C). For zymographic analyses, 1x10 6 of the Nthy-ori 3 1 and 8505C cells were seeded into 25 cm 2 cell culture flasks and allowed to adhere overnight. 175 Figure 1. SDS-PAGE of type I collagen extracted from five different rat tail tendon samples. Lane 1: molecular weight marker (MW); Lanes 2 6: extracted type I collagen. Molecular weights for the collagen a 1, a 2, and b chains were calculated based on the retention factor (Rf) values for the corresponding gel bands. Subsequently, the cells were incubated in serum-free medium for 24 h. The conditioned medium was collected and concentrated with a 3-kDa Amicon Ultra Centrifugal Filter (EMD Millipore, Bedford, MA) according to manufacturer s instructions. Twenty-five micrograms of the conditioned medium and 10 ng of rh-prommp-1 were loaded on collagen zymogram gels containing 0.3 mg/ml extracted type I collagen, and collagen zymography was performed as previously described. Western blot One-hundred micrograms of conditioned medium and 10 ng of rh-prommp-1 were loaded onto the SDS-PAGE gel and electrophoresed at 4 C under denaturing conditions. Following electrophoresis, gels were transferred to the PVDF membranes and incubated at 4 C overnight. The membranes were blocked with 5% skim milk powder in TBS-T (w/v) for 1 h at room temperature and then treated with primary antibodies anti-mmp-1 (dilution 1:200) (Cat no. AB6002; EMD Millipore; RRID: AB_ ) and antib-actin (dilution 1:3000) (Cat no. 4967S; Cell Signaling Technology, Beverly, MA; RRID: AB_330288) overnight at 4 C. After washing, membranes were incubated with diluted HRP-conjugated secondary antibody (Cell Signaling Technology; AB_ ) for 1 h. The protein bands were detected by ECL reagent (Thermo Fisher Scientific), and images were captured using the KODAK 4000MM Imaging System (Carestream, Rochester, NY).

3 REPORTS A B C D E F Figure 2. Optimization of collagen zymography. Serial dilutions of rh-prommp-1, rh-prommp-8, and rh-prommp-13 were loaded into collagen zymogram gels containing 0.3 mg/ml extracted type I collagen. (A) Zymogram gel image of MMP-1. (B) Logarithmic standard curve for prommp-1 (n = 5). (C) Zymogram gel image of MMP-8. (D) Logarithmic standard curve for prommp-8 (n = 6). (E) Zymogram gel image of MMP-13. (F) Logarithmic standard curve for prommp-13 (n = 4). Results were represented as mean ± SEM. Determination of molecular weights and densitometric analysis of collagen zymograms The relative molecular weights of recombinant human pro-collagenases were determined by plotting a calibration curve of the molecular weight markers (4 250 kda) (SeeBlue Plus 2 Prestained Standard) and calculating retention factors (Rf). Densitometric analysis was carried out to quantify each collagenase proenzyme, and standard curves were plotted as optical density (OD) versus the amount of rh-prommp-1, rh-prommp-8, and rh-prommp-13 in nanograms). All analyses were done using LabWorks 4.6 Image Acquisition and Analysis Software. The graphs were created using GraphPad Prism 7.0 software (GraphPad Software, Inc, San Diego, CA). At least four independent collagen zymography experiments were performed, and the data were represented as mean ± SEM. Results and discussion Identification of Type I collagen by SDS-PAGE Type I collagen was extracted from rat tail tendon for use as a substrate in collagen zymography. SDS-PAGE was performed to confirm the identity and purity of the extracted collagen. Type I collagen is composed of b (215 kda), a 1 (130 kda), and a 2 (115 kda) chains (10). SDS-PAGE revealed the typical pattern for type I collagen, with bands at apparent molecular weights of 217 kda (b), 131 kda (a1), and 120 kda (a2), which were calculated using their Rf values (Figure 1). Optimization of collagen zymography To optimize collagen zymography, we first determined the most appropriate substrate for detecting all forms of the collagenases. We tested three different types of collagen as the substrate: (i) extracted type I collagen from rat tail tendon, (ii) commercial type I collagen from rat tail tendon, and (iii) commercial 176 type II collagen from chicken cartilage. As shown in Supplementary Figure S1 (Panels A C), we detected collagenase activity using both commercial and extracted type I collagens; however, we could not detect significant collagenase activity when using commercial type II collagen. Therefore, we performed the subsequent experiments with extracted type I collagen for three major reasons: (i) Collagenases cleave type I collagen at specific sites in the a-chain, leading to the formation of 1/4 C-terminal and 3/4 N-terminal fragments (13); (ii) type I collagen can be extracted with high purity and a significant yield (~ µg/ ml per rat tail); and (iii) the extraction procedure is easy to perform and more cost-effective than commercial alternatives. The use of three different concentrations of extracted type I collagen in SDS-PAGE gels was also examined (Supplementary Figure S1, D F). Recombinant collagenases were loaded into zymogram gels that were copoly-

4 REPORTS A B Figure 3. MMP-1 activity and expression levels in human thyroid cell lines. Conditioned media from the human thyroid cancer cell line 8505C and the human normal thyroid cell line Nthy-ori 3 1 were subjected to (A) collagen zymography and (B) western blotting. MW: molecular weight marker; rh-prommp-1: recombinant human prommp-1. merized with 0.15, 0.3, and 0.6 mg/ml collagen. Gels containing 0.15 mg/ml and 0.6 mg/ml collagen showed more weakly digested collagen bands compared with gels containing 0.3 mg/ml collagen. At the lowest collagen concentration tested (0.15 mg/ml), although all the forms of human collagenase can be visualized, the low staining capacity may lead to difficulty in the analysis of weak enzyme activity. At the highest collagen concentration tested (0.6 mg/ml), collagenases may not degrade all of the substrate during the incubation, and since the remaining substrate is stained, the proteolytic activity is barely discernible (14). Consequently, we carried out all further studies with 0.3 mg/ml of extracted type I collagen. Under these optimized conditions, even though we used recombinant human pro-collagenases, we observed additional bands, which might belong to either active or glycosylated forms of the enzyme (Figure 2). MMP-1 is secreted as 2 different glycosylated proenzymes (57 and 52 kda) from human skin fibroblasts, and cleavage of these peptides forms 2 active enzymes (47 and 42 kda) (15). Consistently, we calculated the molecular weights of the MMP-1 bands as glycosylated prommp-1 (60 and 56 kda) and as glycosylated active MMP-1 (51 and 49 kda), respectively (Figure 2A). MMP-8 is produced as two different types. The PMN (polymorphonuclear neutrophil)-type MMP-8 is highly glycosylated and secreted as preprommp-8 (80 kda), prommp-8 (75 kda), and active MMP-8 (65 kda). Fibroblast-type MMP-8 has two less-glycosylated forms: prommp-8 (55 kda) and active MMP-8 (45 kda) (16 18). In collagen zymogram gels, MMP-8 bands were observed at 83, 73, and 57 kda, which could potentially be the PMN-type MMP-8 (Figure 2C). We detected 2 distinct MMP-13 bands of 59 and 46 kda (Figure 2E), which correspond to prommp-13 (60 kda) and active MMP-13 (48 kda) (19). Previously, we reported that despite using rh-prommp-2 and rh-prommp-7 for gelatin and casein zymography, active forms of the recombinant proenzymes could be also observed (20). These results indicate that the commercial rh-prommps probably contain low amounts of other forms of MMPs that could be detected by highly sensitive zymographic techniques. Determining sensitivity and plotting standard curves Serial dilutions of recombinant pro-collagenases were evaluated under the given experimental conditions, and collagenase activity as low as 1 ng could be quantified (Figure 2). Accordingly, a range of ng of recombinant pro-collagenases was analyzed to generate standard curves. When the results were plotted as band density versus collagenase concentration, the curves for prommp-1 (Figure 2B), prommp-8 (Figure 2D), and prommp-13 Figure 4. Scheme of the optimized collagen zymography method. 178 (Figure 2F) were logarithmic. When the collagenase activities of the samples are out of the analyzable range, samples should be diluted or concentrated to obtain more accurate quantification. MMP-1 activity in 8505C and Nthy-ori 3-1 cells We investigated collagenolytic activity in the conditioned media of a human anaplastic thyroid cancer cell line (8505C) and a normal thyroid follicular epithelial cell line (Nthy-ori 3 1). We observed that both pro- and active MMP-1 levels were elevated in 8505C cells, whereas no collagenolytic activity was detected in Nthy-ori 3 1 control cells (Figure 3A). The specific activity of prommp-1 was found to be ~9.59 ng prommp-1/µg total protein in 8505C cells using the prommp-1 standard curve. We also performed western blotting to determine whether the collagenolytic activity was due to MMP-1. Consistent with the activity results, increased prommp-1 protein levels were found in 8505C cells compared with Nthy-ori 3 1 cells (Figure 3B). These results clearly indicate that MMP-1 in 8505C cells is secreted and activated in the extracellular space. Experimental studies have shown that MMP-1 is overexpressed at both the mrna and protein levels in thyroid cancer cell lines (21) and follicular thyroid carcinomas (22,23). However, researchers could not detect MMP-1 activity levels unambiguously in thyroid carcinoma. To our knowledge, this is the first report that shows increased MMP-1 activity levels in 8505C cells. Here, we demonstrated, for the first time, an optimized collagen zymography technique that enables the evaluation of all

5 R REPORTS human collagenases (MMP-1, MMP-8, and MMP-13), including their latent, active, and glycosylated forms, and we created standard curves to facilitate analysis of activity levels of individual collagenases in unknown samples (Figure 4). Previously, Gogly et. al. described collagen zymography for examining both pro- and 4-aminophenylmercuric acetate (APMA) activated MMP-1 (9). They applied the zymography using gels that contained 0.5 mg/ml commercial calf skin type I collagen, whereas we extracted type I collagen from rat tail tendon with an affordable and easyto-implement procedure. In contrast to our current results, Gogly et al. could not distinguish glycosylated forms of MMP-1 under their assay conditions and did not determine the activity levels of the other collagenases, MMP-8 and MMP-13. Although Gogly et al. detected lower amounts of prommp-1 (sensitivity as low as 10 pg of prommp-1 and 0.1 pg of APMA-activated MMP-1) compared with our measurement limits, a lower detection limit can be achieved by extending incubation time. In addition, in cases where samples have low collagenase activity (<1 ng), the samples can be concentrated and/or activated with APMA to increase sensitivity. We believe that our optimized collagen zymography method will prove useful for both clinical and experimental applications. It should be noted that if a sample contains three collagenases at the same time, separation of individual collagenase bands can be a problem due to their narrow molecular weight distribution. However, this problem can be overcome using 2-D collagen zymography, where additional separation by isoelectric focusing is possible. Author contributions G.O. conceived of and designed the experiments. S.I. and D.K. designed experimental approaches, performed the experiments, and analyzed the data. S.I., D.K., and G.O. wrote the manuscript. Acknowledgments This research was supported in part by a grant (no KB.SAĞ.10) from the Dokuz Eylul University Scientific Research Project Coordination Unit. References 1. Apte, S.S. and W.C. Parks Metalloproteinases: A parade of functions in matrix biology and an outlook for the future. Matrix Biol : Ala-aho, R. and V.M. Kahari Collagenases in cancer. Biochimie 87: Sorsa, T., Y.T. Konttinen, O. Lindy, C. Ritchlin, H. Saari, K. Suomalainen, K.K. Eklund, and S. Santavirta Collagenase in synovitis of rheumatoid arthritis. Semin. Arthritis Rheum. 22: Billinghurst, R.C., L. Dahlberg, M. Ionescu, A. Reiner, R. Bourne, C. Rorabeck, P. Mitchell, J. Hambor, et al Enhanced TRANSFORMING RNA ANALYSIS WITH AUTOMATED SAMPLE QC. The Fragment Analyzer simultaneously quantifies and qualifies RNA samples, whether you re performing total RNA, mrna or small RNA analysis, or working with degraded materials like formalin fixed tissues. cleavage of type II collagen by collagenases in osteoarthritic articular cartilage. J. Clin. Invest. 99: Vaalamo, M., L. Mattila, N. Johansson, A.L. Kariniemi, M.L. Karjalainen-Lindsberg, V.M. Kahari, and U. Saarialho-Kere Distinct populations of stromal cells express collagenase-3 (MMP-13) and collagenase-1 (MMP-1) in chronic ulcers but not in normally healing wounds. J. Invest. Dermatol. 109: Egeblad, M. and Z. Werb New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2: Vandooren, J., N. Geurts, E. Martens, P.E. Van den Steen, and G. Opdenakker lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFP RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small R mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnr snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-dep ed RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Tot RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small RNA, mrna FFPE RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, sm RNA, mrna, JUST FFPE RNA, Total RNA, RIGHT ribo-depleted RNA, lnrna, snrna lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-depletedd RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFP RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small R mrna, FFPE RNA, Total FOR RNA, ribo-depleted QC RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnr snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-dep ed RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Tot RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small RNA, mrna FFPE RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, sm RNA, mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnrna, Total R mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-depleted RNA, lnr snrna, Micro RNA, small RNA, mrna, FFPE RNA, Total RNA, ribo-dep ed RNA, lnrna, snrna, Micro RNA, small RNA, mrna, FFPE RNA, Tot RNA, ribo-depleted RNA, lnrna, snrna, Micro RNA, small RNA, mrna Competing interests The authors declare no competing interests. More at AATI-US.COM

6 REPORTS Zymography methods for visualizing hydrolytic enzymes. Nat. Methods 10: Snoek-van Beurden, P. A. and J.W. Von den Hoff Zymographic techniques for the analysis of matrix metalloproteinases and their inhibitors. Biotechniques 38: Gogly, B., N. Groult, W. Hornebeck, G. Godeau, and B. Pellat Collagen z ymography as a sensitive and specific technique for the determination of subpicogram levels of interstitial collagenase. Anal. Biochem. 255: Oktay, G., G. Güner, and E. Wood Preparation of dermal equivalents from human dermal fibroblasts and rat tail collagen for studying events associated with wound healing. Turk J Biochem 23: Laemmli, U.K Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: Heus sen, C. a nd E.B. D owdle Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal. Biochem. 102: Aimes, R.T. and J.P. Quigley Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific 3/4and 1/4-length fragments. J. Biol. Chem. 270: Yasumitsu, H Serine protease zymography: low-cost, rapid, and highly sensitive rama casein zymography. Methods Mol. Biol. 1626: Wilhelm, S.M., A.Z. Eisen, M. Teter, S.D. Clark, A. Kronberger, and G. Goldberg Human fibroblast collagenase: glycosylation and tissue-specific levels of enzyme sy nthe sis. Pro c. N atl. Ac ad. Sci. USA 83: Hanemaaijer, R., T. Sorsa, Y.T. Konttinen, Y. Ding, M. Sutinen, H. Visser, V.W. van Hinsbergh, T. Helaakoski, et al Matrix metalloproteinase-8 is expressed in r heumatoid sy nov ial f ibroblasts a nd e ndothe lia l c e lls. Re gulation by tumor necrosis factor-alpha and doxycycline. J. Biol. Chem. 272: Arechavaleta-Velasco, F., D. Marciano, L. Diaz-Cueto, and S. Parry Matrix metalloproteinase-8 is expressed in human chorion during labor. Am. J. Obstet. Gynecol. 190: Kivelä-Rajamäki, M., P. Maisi, R. Srinivas, T. Ter vahar tiala, O. Teronen, V. Husa, T. Salo, and T. Sorsa Levels and molecular forms of MMP-7 (matrilysin-1) and MMP-8 (collagenase-2) in diseased human peri-implant sulcular fluid. J. Periodontal Res. 38: Knäuper, V., C. Lopez-Otin, B. Smith, G. Knight, and G. Murphy Biochemical characterization of human collagenase-3. J. Biol. Chem. 271: Hosgorler, F., D. Keles, S. TanriverdiAkhisaroglu, S. Inanc, M. Akhisaroglu, U. Cankurt, Z. Aydogdu, A.D. Ucar, et al Anti-inflammatory and anti-apoptotic ef fect of valproic acid and dox ycycline independent from MMP Inhibition in early radiation damage. Balkan Med. J. 33: Aust, G., A. Hofmann, S. Laue, A. Rost, T. Kohler, and W.A. Scherbaum Human thyroid carcinoma cell lines and normal thyrocytes: expression and regulation of matrix metalloproteinase-1 and tissue matrix metalloproteinase inhibitor-1 messenger-rna and protein. Thyroid 7: Mizrachi, A., R. Koren, T. Hadar, E. Yaniv, S. Morgenstern, and J. Shvero Expression of MMP-1 in invasive well-differentiated thyroid carcinoma. Eur. Arch. Otorhinolaryngol. 268: Buergy, D., T. Weber, G.D. Maurer, G. Mudduluru, F. Medved, J.H. Leupold, M. Brauckhoff, S. Post, et al Urokinase receptor, MMP-1 and MMP-9 are markers to dif ferentiate prognosis, adenoma and carcinoma in thyroid malignancies. Int. J. Cancer 125: Received 13 April 2017; accepted 07 September Address correspondence to Gulgun Ok tay, Dokuz Eylul University, School of Medicine, Depar tment of Medical Biochemistr y, Inciralti, Izmir, Turkey. gulgun.ok tay@deu.edu.tr To purchase reprints of this article, contact: biotechniques@fosterprinting.com The BioTechniques Mobile App Available Now for Apple and Android Devices Visit BioTechniques.com/Digital to learn more and BioTechniques.com/Subscribe to receive monthly issue alerts.

SensoLyte 520 MMP-1 Assay Kit *Fluorimetric*

SensoLyte 520 MMP-1 Assay Kit *Fluorimetric* SensoLyte 520 MMP-1 Assay Kit *Fluorimetric* Revision# 1.2 Last Updated: February 2017 Catalog # Kit Size AS-71150 100 Assays (96-well) or 250 Assays (384-well) Convenient Format: All essential assay components

More information

SensoLyte 490 MMP-1 Assay Kit *Fluorimetric*

SensoLyte 490 MMP-1 Assay Kit *Fluorimetric* SensoLyte 490 MMP-1 Assay Kit *Fluorimetric* Revision# 1.2 Last updated: February 2017 Catalog # Kit Size AS-71128 500 Assays (96-well plate) or 1250 assays (384-well) Convenient Format: All essential

More information

SensoLyte Plus 520 MMP-1 Assay Kit *Fluorimetric and Enhanced Selectivity*

SensoLyte Plus 520 MMP-1 Assay Kit *Fluorimetric and Enhanced Selectivity* SensoLyte Plus 520 MMP-1 Assay Kit *Fluorimetric and Enhanced Selectivity* Catalog # 72012 Kit Size 96 Assays in 96-well plate Optimized Performance: Optimal conditions for detecting MMP-1 activity in

More information

SensoLyte 570 Generic MMP Assay Kit *Fluorimetric*

SensoLyte 570 Generic MMP Assay Kit *Fluorimetric* SensoLyte 570 Generic MMP Assay Kit *Fluorimetric* Catalog # 72101 Kit Size 100 Assays (96-well plate) Optimized Performance: Optimal conditions for detection of generic MMP activity Enhanced Value: Less

More information

SensoLyte 490 MMP-1 Assay Kit *Fluorimetric*

SensoLyte 490 MMP-1 Assay Kit *Fluorimetric* SensoLyte 490 MMP-1 Assay Kit *Fluorimetric* Catalog # 71128 Unit Size Kit Size 1 kit 500 assays (96-well) or 1250 assays (384-well) This kit is optimized to detect MMP-1 activity using an Edans/ DabcylPlus

More information

SensoLyte 490 MMP-9 Assay Kit *Fluorimetric*

SensoLyte 490 MMP-9 Assay Kit *Fluorimetric* SensoLyte 490 MMP-9 Assay Kit *Fluorimetric* Revision#1.2 Last updated: February 2017 Catalog # Kit Size AS-71134 500 assays (96-well) or 1250 assays (384-well) Convenient Format: All essential assay components

More information

SensoLyte 490 MMP-3 Assay Kit *Fluorimetric*

SensoLyte 490 MMP-3 Assay Kit *Fluorimetric* SensoLyte 490 MMP-3 Assay Kit *Fluorimetric* Revision Number:1.1 Last Revised: October 2014 Catalog # Kit Size AS-71130 500 assays (96-well) Convenient Format: All essential assay components are included.

More information

Western Blot Tool Box

Western Blot Tool Box Western Blot Tool Box BOX12/BOX12-03 V1.1 Store at 2-8 C For research use only Introduction The Western Blot Tool Box is designed to conveniently provide reagents/buffers needed for Western blotting, from

More information

QuickZyme Human MMP-2 activity assay Version 2.0

QuickZyme Human MMP-2 activity assay Version 2.0 QuickZyme Human MMP-2 activity assay Version 2.0 June 2017 This package insert must be read in its entirety before using this product. FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES Introduction

More information

Anti-HB-EGF (Human) mab

Anti-HB-EGF (Human) mab Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Protein Electrophoresis EZ-Run Protein Gel Solution EZ-Run Protein Standards EZ-Run Gel Staining Solution Traditional SDS-PAGE Reagents

Protein Electrophoresis EZ-Run Protein Gel Solution EZ-Run Protein Standards EZ-Run Gel Staining Solution Traditional SDS-PAGE Reagents Protein Electrophoresis EZ-Run Protein Gel Solution EZ-Run Protein Standards EZ-Run Gel Staining Solution Traditional SDS-PAGE Reagents Reliability. Purity. Certainty. Introduction Sodium dodecyl sulfate

More information

Western blotting technique: principle, procedure and application

Western blotting technique: principle, procedure and application Western blotting technique: principle, procedure and application The term blotting refers to the transfer of biological samples from a gel to a membrane and their subsequent detection on the surface of

More information

Nori Rat MMP-13 ELISA Kit-DataSheet

Nori Rat MMP-13 ELISA Kit-DataSheet Matrix metalloproteinase 13 (MMP-13) also named collagenase 3 is an enzyme that in humans is encoded by the MMP13 gene.[1][2] and is a member of the MMP family. Like most MMPs, it is secreted as an inactive

More information

Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein. Application

Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein. Application Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein Application Petra Sebastian Meike Kuschel Stefan Schmidt Abstract This Application Note describes

More information

Western Blot Protocol

Western Blot Protocol Western Blot Protocol Western blotting (WB) is the most widely performed immunoassay and is the best initial validation technique used to identify proteins of interest within a tissue homogenate or cell

More information

KPL LumiGLO Ultra Western Blotting Substrate

KPL LumiGLO Ultra Western Blotting Substrate DESCRIPTION KPL LumiGLO Ultra contains an acridane-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Ultra offers several improvements over

More information

MMP1 (Human) ELISA Kit

MMP1 (Human) ELISA Kit MMP1 (Human) ELISA Kit Catalog Number KA0390 96 assays Version: 27 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...

More information

Checkpoint Kinase Activity Immunoblot Kit

Checkpoint Kinase Activity Immunoblot Kit Product Manual Checkpoint Kinase Activity Immunoblot Kit Catalog Number STA- 413 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a protein phosphatase responsible

More information

Protein Detection by SDS-PAGE & Western Blot

Protein Detection by SDS-PAGE & Western Blot Protein Detection by SDSPAGE & Western Blot Buffers Prepare buffers for SDSPAGE and Western Blot. See materials for different buffers below 10x SDS Running Buffer Dissolve 30.0 g of Tris base, 140 g of glycine,

More information

QuickZyme Human MMP-9 activity assay

QuickZyme Human MMP-9 activity assay QuickZyme Human MMP-9 activity assay This package insert must be read in its entirety before using this product. FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES QuickZyme human MMP-9 activity

More information

RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013)

RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013) RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013) WARNING: RNA Blue contains phenol and some other toxic components. After contact with skin, wash immediately with

More information

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

More information

Technical Data Sheet. Sensido Plus ECL Substrate (HRP) Description. Advantages

Technical Data Sheet. Sensido Plus ECL Substrate (HRP) Description. Advantages ECL Substrate (HRP) Catalog R13-VG08 Technical Data Sheet ADD: 7F, 72, Song-Te Rd., Taipei 110, Taiwan TEL : 886-2-2723-0886 www.recenttec.com Package Cat. Components Solution A (Substrate Solution) Solution

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

Human TGF-beta1 ELISA

Human TGF-beta1 ELISA K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic

More information

Human MMP-9 ELISA Kit (hmmp9-elisa)

Human MMP-9 ELISA Kit (hmmp9-elisa) Human MMP-9 ELISA Kit (hmmp9-elisa) Cat. No. EK0465 96 Tests in 8 x 12 divisible strips Background Matrix metalloproteinase-9 (MMP-9), a 92 kda type IV collagenase is also known as gelatinase, type V collagenase,

More information

Sensido Advance ECL Substrate (HRP) Solution A (Substrate Solution) Solution B (Peroxide Solution)

Sensido Advance ECL Substrate (HRP) Solution A (Substrate Solution) Solution B (Peroxide Solution) Sensido Advance ECL Substrate (HRP) ADD: 7F, 72, Song-Te Rd., Taipei 110, Taiwan TEL : 886-2-2723-0886 www.recenttec.com Order Info Cat. Components Volume Package R13-VG016-100 Solution A (Substrate Solution)

More information

KPL LumiGLO Reserve Chemiluminescent Substrate

KPL LumiGLO Reserve Chemiluminescent Substrate DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way

More information

Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005

Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005 INSTRUCTION MANUAL Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005 Highlights Fast protocol to purify Strep-tagged proteins from cell-free extracts Screen your recombinant colonies directly for

More information

His Tag Western and LumiBlot Reagents Sensitive detection of His Tag fusion proteins

His Tag Western and LumiBlot Reagents Sensitive detection of His Tag fusion proteins His Tag Western and LumiBlot Reagents Sensitive detection of His Tag fusion proteins The His Tag Reagents are kits containing optimized components for blot detection using the His Tag Monoclonal Antibody.

More information

Easy-WESTERN-II Super

Easy-WESTERN-II Super Easy-WESTERN-II Super Primary Antibody Detection Reagent for Western Blots User Manual for High Sensitivity and Strong Signal Detection Immediately after receiving the kit, read the section titled COMPONENTS

More information

Easy-WESTERN-II Quick

Easy-WESTERN-II Quick Easy-WESTERN-II Quick Primary Antibody Detection Reagent for Western Blots User Manual for Quick Antigen Detection or Multi Antigen Detection Immediately after receiving the kit, read the section titled

More information

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM Introduction: IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM IP/Western Blot Reagents and Procedures (patent pending) provide an improved method for the detection of immunoprecipitated

More information

Easy-WESTERN-II Super

Easy-WESTERN-II Super Easy-WESTERN-II Super Primary Antibody Detection Reagent for Western Blots User Manual for High Sensitivity and Strong Signal Detection Immediately after receiving the kit, read the section titled COMPONENTS

More information

Strep-Spin Protein Miniprep Kit Catalog No. P2004 & P2005

Strep-Spin Protein Miniprep Kit Catalog No. P2004 & P2005 INSTRUCTION MANUAL Strep-Spin Protein Miniprep Kit Catalog No. P2004 & P2005 Highlights Fast & Simple: Purify Strep-tagged proteins from cell-free extracts using a spin-column in 7 minutes High-Quality:

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human HER2 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

Preparation of Pneumococcal Proteins for Western Blot Analysis Maria João Frias *, José Melo-Cristino and Mário Ramirez *

Preparation of Pneumococcal Proteins for Western Blot Analysis Maria João Frias *, José Melo-Cristino and Mário Ramirez * Preparation of Pneumococcal Proteins for Western Blot Analysis Maria João Frias *, José Melo-Cristino and Mário Ramirez * Instituto de Microbiologia, Instituto de Medicina Molecular, Faculdade de Medicina,

More information

Thirupathi Kumara Raja. S, 1 Thiruselvi. T, 1 Asit Baran Mandal, 1 Gnanamani. A, 1* Adyar, Chennai Tamil Nadu, India

Thirupathi Kumara Raja. S, 1 Thiruselvi. T, 1 Asit Baran Mandal, 1 Gnanamani. A, 1* Adyar, Chennai Tamil Nadu, India Supplementary File ph and redox sensitive albumin hydrogel : A self-derived biomaterial Thirupathi Kumara Raja. S, 1 Thiruselvi. T, 1 Asit Baran Mandal, 1 Gnanamani. A, 1* 1 CSIR-CLRI Adyar, Chennai Tamil

More information

MMP Activity Assay Kit (Fluorometric - Red)

MMP Activity Assay Kit (Fluorometric - Red) ab112147 MMP Activity Assay Kit (Fluorometric - Red) Instructions for Use For detecting MMP activity in biological samples using our proprietary red fluorescence probe This product is for research use

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3

More information

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual FOR RESEARCH USE ONLY NOT FOR USE IN CLINICAL DIAGNOSTIC PROCEDURES [ PROPERTIES ] 1th Edition

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

LumiPico ECL Kit. ShineGene. User Manual. For Western Blot. Cat.Nos.ZK00901(12.5ml 2) ZK00902(50.0ml 2) LumiPico ECL Kits User Manual

LumiPico ECL Kit. ShineGene. User Manual. For Western Blot. Cat.Nos.ZK00901(12.5ml 2) ZK00902(50.0ml 2) LumiPico ECL Kits User Manual LumiPico ECL Kits User Manual ShineGene LumiPico ECL Kit For Western Blot User Manual Cat.Nos.ZK00901(12.5ml 2) ZK00902(50.0ml 2) USD44.46 USD175.20 Published 24 Feb 2007 ShineGene LumiPico ECL Kits User

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Purification and biochemical characterization of acid phosphatase-i from seeds of Nelumbo nucifera Sanaullah Khan a*, Shahnaz Asmat c, Sajida Batool a, Mushtaq Ahmed b a Department

More information

Protein electrophoresis: Introduction to SDS-PAGE

Protein electrophoresis: Introduction to SDS-PAGE Protein electrophoresis: Introduction to SDS-PAGE Aim: -Separation of proteins in an electric field by electrophoresis. Purposes: -Estimation of molecular masses -Relative abundances of major proteins

More information

Human ECM1 ELISA Pair Set

Human ECM1 ELISA Pair Set Human ECM1 ELISA Pair Set Catalog Number : SEK10362 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General ELISA

More information

Protocol(Research use only)

Protocol(Research use only) Immunohistochemistry (without pretreatment) p2 Immunohistochemistry (Microwave pretreatment) p3 Immunohistochemistry (Autoclave pretreatment) p4 Immunohistochemistry (Trypsin pretreatment) p5 Immunohistochemistry

More information

Human MMP-1 ELISA Kit

Human MMP-1 ELISA Kit OriGene Technologies, Inc 9620 Medical Center Dr., Suite 200, Rockville, MD 20850 Phone: 1.888.267.4436 Fax: 301-340-9254 Email: techsupport@origene.com Web: Human MMP-1 ELISA Kit Catalog No. EA100317

More information

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. User Protocol 122643 Rev. 12 May 2005 JSW Page 1 of 7 ProteoExtract Albumin/IgG Removal Kit, Maxi Cat. No. 122643 1. Introduction One of the major challenges in functional proteomics is the handling of

More information

Human Granulin / GRN / Progranulin ELISA Pair Set

Human Granulin / GRN / Progranulin ELISA Pair Set Human Granulin / GRN / Progranulin ELISA Pair Set Catalog Number : SEKA10826 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Rat) *Colorimetric* SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Rat) *Colorimetric* Revision number: 1.3 Last updated: 1/15/18 Catalog # AS-55550-R Kit Size One 96-well strip plate This kit is optimized to detect

More information

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

TURBO NEXT GEL * A Ready-to-Pour Acrylamide Gel for the Rapid Electrophoresis of Proteins in Standard Gels

TURBO NEXT GEL * A Ready-to-Pour Acrylamide Gel for the Rapid Electrophoresis of Proteins in Standard Gels TURBO NEXT GEL * A Ready-to-Pour Acrylamide Gel for the Rapid Electrophoresis of Proteins in Standard Gels Code Description Molecular Weight Separation Range Size M313-100ML M313-500ML M310-100ML M310-500ML

More information

Lecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry

Lecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

Ver.03. For Research Use Only

Ver.03. For Research Use Only Human collagen type1 ELISA Ver.03 For Research Use Only Contents Page Introduction... 2. Features... 2. Principle Competitive EIA... 2. Contents... 3. Preparation of equipments and reagents... 3. Preparation

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL1-beta in serum, plasma and cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

Protein molecular weight marker and anti-marker antibody for chemiluminescent detection on Western blots.

Protein molecular weight marker and anti-marker antibody for chemiluminescent detection on Western blots. Roti -Mark WESTERN Set (Art. No. 0947.1) and MINI-Set (Art. No. 0947.2) Roti -Mark WESTERN Marker (Art. No. 0948.1) Roti -Mark WESTERN HRP-Conjugate (Art. No. 0949.1) Protein molecular weight marker and

More information

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Rat IGF-1 ELISA Kit (rigf-1-elisa) Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

Isolation of splenocytes Method: Trypan blue dye exclusion test Reagents required: Method:

Isolation of splenocytes Method: Trypan blue dye exclusion test Reagents required: Method: Isolation of splenocytes Method: a) Mice were sacrificed and spleens were dissected out and washed in chilled PBS. b) With the help of clean forceps, spleen tissue was teased and then mashed between frosted

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

Western blotting transfer and detection procedure

Western blotting transfer and detection procedure Western blotting transfer and detection procedure March 2007 CONTENT I. REQUIRED REAGENTS AND EQUIPMENT 3 II. SAMPLE PREPARATION 4 III. ACRYLAMIDE GEL PREPARATION AND ELECTROPHORESIS 5 IV. ELECTROBLOTTING

More information

MSD MULTI-SPOT Assay System

MSD MULTI-SPOT Assay System MSD MULTI-SPOT Assay System Human MMP 2-Plex Ultra-Sensitive Kit 1-Plate Kit 5-Plate Kit 25-Plate Kit K15033C-1 K15033C-2 K15033C-4 17335-v5-2012Mar 1 MSD Biomarker Assays Human MMP 2-Plex Ultra-Sensitive

More information

Human Fibronectin ELISA

Human Fibronectin ELISA K-ASSAY Human Fibronectin ELISA For the quantitative determination of Fibronectin in human cell culture supernates, serum and plasma (heparin, EDTA, citrate) Cat. No. KT-1269 For Research Use Only. Not

More information

Zymogram: Study of an Active Enzyme with Electrophoresis

Zymogram: Study of an Active Enzyme with Electrophoresis PR106 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Zymogram: Study of an Active Enzyme with Electrophoresis Teachers Handbook (Cat. #

More information

Week 1: Protein isolation and quantification

Week 1: Protein isolation and quantification Week 1: Protein isolation and quantification Objective The objective of this lab exercise is to obtain protein samples from fruit fly larvae, BCS and FBS, all of which are then quantitated in the preparation

More information

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

Copyright TopoGEN, Inc., All rights reserved.

Copyright TopoGEN, Inc., All rights reserved. Copyright TopoGEN, Inc., 2011. All rights reserved. User Manual Topoisomerase I Drug Screening Kit (plasmid based). Catalog Number Catalog Number TG1018-1 100 Reaction Set TG1018-2 250 Reaction Set Lot

More information

WESTERN BLOT. BCH462- Practical

WESTERN BLOT. BCH462- Practical WESTERN BLOT BCH462- Practical What is Antigen [Ag]? What is Antibody [Ab]? Immunoassay: is a test that uses the highly specific and selective antigen-antibody reactions forming antibody and antigen complexes

More information

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34. BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21

More information

For quantitative detection of mouse IGF-1 in serum, body fluids, tissue lysates or cell culture supernatants.

For quantitative detection of mouse IGF-1 in serum, body fluids, tissue lysates or cell culture supernatants. Mouse IGF-1 ELISA Kit (migf-1-elisa) Cat. No. EK0378 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

For Research Use Only

For Research Use Only CodeACB-EC1-E105-EX Human collagen type1 ELISA Ver.03 For Research Use Only TOYO 2CHOME, KOTO-KU, TOKYO, 135-0016, JAPAN http://www.cosmobio.co.jp e-mail : export@cosmobio.co.jp Phone : +81-3-5632-9617

More information

Western blot troubleshooting guide

Western blot troubleshooting guide Specializing in Secondary Antibodies and Conjugates Western blot troubleshooting guide Optimize your Western blotting with Jackson ImmunoResearch Secondary antibodies Troubleshooting for better blots Western

More information

Tumor tissues or cells were homogenized and proteins were extracted using

Tumor tissues or cells were homogenized and proteins were extracted using SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined

More information

SMART PROTEIN LAYERS. Quantitative and standardized protein gel and Western blot analysis

SMART PROTEIN LAYERS. Quantitative and standardized protein gel and Western blot analysis SMART PROTEIN LAYERS Quantitative and standardized protein gel and Western blot analysis The challenge There is an increasing demand for quantitative, sensitive and reliable 1D gel and Western blot (WB)

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

IR-Blot Secondary antibodies Rev01

IR-Blot Secondary antibodies Rev01 0 About us Cyanagen is a biotech company located in Bologna, dedicated to research, development and production of reagents for molecular diagnostic since 2003 and one of the leading companies in the field

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Electrophoresis. Ready-to-Run Buffers and Solutions

Electrophoresis. Ready-to-Run Buffers and Solutions Electrophoresis Ready-to-Run Buffers and Solutions Bio-Rad is a premier provider of buffers and premixed reagents for life science research. We offer a variety of different products for all your protein

More information

Human Serum Albumin (HSA) ELISA Quantitation Kit. Manual

Human Serum Albumin (HSA) ELISA Quantitation Kit. Manual Human Serum Albumin (HSA) ELISA Quantitation Kit Manual Catalog number: 40-288-10067F For the quantitative determination of human serum albumin levels in plasma or other biological samples. This kit is

More information

DuoSet IC. Human Total p21. Catalog Number DYC Catalog Number DYC Catalog Number DYC1047E

DuoSet IC. Human Total p21. Catalog Number DYC Catalog Number DYC Catalog Number DYC1047E DuoSet IC Human Total p21 Catalog Number DYC1047-2 Catalog Number DYC1047-5 Catalog Number DYC1047E For the development of sandwich ELISAs to measure p21 in cell lysates. This package insert must be read

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

Human IgG ELISA Quantitation Set

Human IgG ELISA Quantitation Set Human IgG ELISA Quantitation Set Cat. No. E80-104 Components Supplied Affinity purified Goat anti-human IgG-Fc Coating Antibody A80-104A, 1 ml at 1 mg/ml Human Reference Serum, RS10-110-4, 0.1 ml HRP Conjugated

More information

Universal Protease Activity ELISA

Universal Protease Activity ELISA Universal Protease Activity ELISA Cat. No.: 30516103 Quantification of protease activity (based on HtrA1 as standard enzyme and ß-Casein as substrate) For screening and evaluation of protease inhibitors

More information

Human IL-6 ELISA. For the quantitative determination of IL-6 in human cell culture supernates, serum and plasma (heparin, EDTA, citrate)

Human IL-6 ELISA. For the quantitative determination of IL-6 in human cell culture supernates, serum and plasma (heparin, EDTA, citrate) K-ASSAY Human IL-6 ELISA For the quantitative determination of IL-6 in human cell culture supernates, serum and plasma (heparin, EDTA, citrate) Cat. No. KT-1348 For Research Use Only. Not for diagnostic

More information

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60

More information

IR-Blot Secondary antibodies Rev00

IR-Blot Secondary antibodies Rev00 0 About us Cyanagen is a biotech company located in Bologna, dedicated to research, development and production of reagents for molecular diagnostic since 2003 and one of the leading companies in the field

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of mouse Interleukin 6 (IL6) concentrations in serum, plasma and cell culture supernatants. general information Catalogue Number

More information