Site-directed Mutagenesis

Size: px

Start display at page:

Download "Site-directed Mutagenesis"

Jasmine Martin
6 years ago
Views:

1 Site-directed Mutagenesis

2 Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences in genome change sequence and see what happens Analyze regulatory regions in DNA or RNA

3 Subtilisin Used in laundry detergent Methionine required activity Bleach oxidizes methionine, inactivates subtilisin

4 Subtilisin Change Met to each amino acid and test activity of subtilisin Met à Ala retain 50% of activity, not oxidized by bleach AUG à GCG Met Ala

5 The architecture of the PTP1B active site Phosphotyrosine (Substrate) Gln262 Phe180 Q-loop ptyr-loop Tyr46 Asp181 WPD-loop PTP-loop Arg221 Cys215 or Courtesy of Dr. Robert Del. Vecchio

Mutation of Asp181 à Ala locks substrate in active site Reaction cannot go to completion. Question: What are the substrates of PTP1B? What does it do?

6 Mutation of Asp181 à Ala locks substrate in active site Reaction cannot go to completion. Question: What are the substrates of PTP1B? What does it do? Experiment: Express mutant in mammalian cells. Purify mutant PTP1B. Western blot show tyrosine phosphorylated protein copurifies with mutant PTP1B Flint A J et al. PNAS 1997;94: by National Academy of Sciences

7 Fluorescent proteins Trp67 His67 Tyr67 Tyr67 Tyr204 Change one or two amino acids, change color

8 Mutating a sequence Mutate the DNA Usually done in a plasmid Not all copies of the plasmid becomes mutated during procedure Produce high amounts of plasmid Transform plasmid into bacteria Purify plasmid Which bacteria have mutated plasmid DNA?

9 Where is my mutant? Phenotypic change in bacteria that take up mutant. Mutation changes restriction enzyme site Purify DNA from multiple colonies and test by RE digestion Sequence the DNA Purify DNA from multiple colonies and sequence using cycle sequencing

10 How do we mutate a sequence? Early methods: Random mutations induced with chemicals. Try to select version with properties you want. Site-directed using single-stranded DNA template Use oligo with mutated sequence Use primer and DNA polymerase to generate new strand of mutated DNA

11 Site directed mutagenesis - ssdna Start with a double-stranded plasmid - the parent. Make a single-stranded DNA containing just one strand of the plasmid.

12 Site directed mutagenesis - ssdna Mix ssdna with mutation-bearing Primer with an A Add DNA pol, dntps and make new second strand Transform into bacteria Still have Parental strand with a C A nick in new strand repaired in bacteria

13 Why not use PCR? Include mutation in primer Generate a lot of new mutated product Can you think of any problems using PCR to mutate DNA?

14 Problem with PCR? Low fidelity of Taq polymerase introduce unwanted mutations. Use high-fidelity polymerase Sequence all DNA generated by PCR Look for mutation Look for any other changes Wild-type template used for still there

15 Using PCR Use two primers with mutation (oligo 2 and 3) They are going to wrong way!

16 Make overlapping fragments Reaction 1 Reaction 2

17 Put it all together with overlapping fragments Mix products from Reaction 1 and Reaction 2 Run 3 rd PCR with outside primers

18 Overlapping PCR Cut with restriction enzymes Ligate into plasmid, transform Problem Low efficiency of overlapping PCR have significant proportion of original wild-type template, up to 90% or more Can be cut and ligated into the plasmid End up with many wild-type plasmids

19 A better way with PCR! Generate entire plasmid containing mutation Don t need to clone (ligate) mutated fragment into plasmid. Can mutate 1 3 bases at the same time Use high-fidelity polymerase to reduce unwanted mutations. Destroy wild-type template DNA Get rid of wild-type plasmids before transformation

20 Quickchange X X Mutant Strand Synthesis Perform thermal cycling to: 1) Denature DNA template 2) Anneal mutagenic primers containing desired mutation 3) Extend primers with PfuUltra DNA polymerase Dpn I Digestion of Template Digest parental methylated and hemimethylated DNA with Dpn I Transformation Transform mutated molecule into competent cells for nick repair

21 Remember strand displacement? Strand displacement would remove the primer with the mutation. Nick left in the new strand mutation here

22 DNA pol doesn t close nicks DNA Pol DNA ligase

23 Pfu polymerase High fidelity Does not displace DNA strand as it produces new DNA Will not push primer off Primer left in place, with mutation, on new strand Nick left in each strand backbone needs to be closed up

24 Nick in new strands Nick 3 -AACAGACCTTTCCAGACAACTCCGT GTCAAAGGCTGACGTGAGTTCGAAAGGTCTGTTGAGGCATCCGC

25 New mutant is nicked

26 Digest template with Dpn I Dpn I restriction endonuclease cuts this sequence when adenine is methylated one or both strands: CH GATC CTAG---- CH3 DNA from bacteria is methylated, new strand from PCR is not methylated

27 Quickchange X X Mutant Strand Synthesis Perform thermal cycling to: 1) Denature DNA template 2) Anneal mutagenic primers containing desired mutation 3) Extend primers with PfuUltra PFUTurbo DNA polymerase polymerase Dpn I Digestion of Template Digest parental methylated and hemimethylated DNA with Dpn I Transformation Transform mutated molecule into competent cells for nick repair >80% of colonies contain mutated plasmid

28 Primer design for mutagenesis Two complementary primers containing the mutation. Mutation results in mismatch with template Need complementary bases on both sides of mutation Total length bases TTCTCGGACACAAACTCGAGTATAACTATAACTCACACAATGTAT AAGAGCCTGTGTTTGAGCTCATGTTGATATTGAGTGTGTTACATA

29 Primer design for mutagenesis G/C content > 40% T m > 78 o C (long primers) Calculate T m : T m = (%GC) 675/N - % mismatch where N is the number of bases G or C at 3 end, GC clamp

30 Primer mismatch Single mutation TCGGACACAAACTCGAGTATAACTATAACTCACACAATG AAGAGCCTGTGTTTGAGCTCATGTTGATATTGAGTGTGTTACATA Two mutations TTCTCGGACACAATCTCGAGTATAACTATAACTCACACAATG AAGAGCCTGTGTTTGAGCTCATGTTGATATTGAGTGTGTTACATA

31 Incomplete primers will interfere Phosphoramidite method Synthesized 3 to 5 Not all copies are full length ~15-25% can be truncated oligos 5 -GTACCGATCCGATGACTGCCAT-3 5 -GACTGCCAT-3 5 -AT-3 5 -GTACCGATCCGATGACTGCCAT-3 5 -ATCCGATGACTGCCAT-3

32 Primer purity Primers should be purified by HPLC, PAGE Incomplete primers will interfere with PCR 3 TCGGACACAAACTCGAGTACAACTATAACTCACACAATG-5 can t bind 3 TCGGACACAAACTCG-5 AAGAGCCTGTGTTTGAGCTCATGTTGATATTGAGTGTGTTACATA

Some types of Mutagenesis

Some types of Mutagenesis Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine