Reference genomes and common file formats
|
|
|
- Emma Wade
- 6 years ago
- Views:
Transcription
1 Reference genomes and common file formats
2 Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF (gene annotation) Wiggle files, BEDgraphs, BigWigs (genomic scores)
3 Why do we need to know about reference genomes? Allows for genes and genomic features to be evaluated in their genomic context. Gene A is close to gene B Gene A and gene B are within feature C Can be used to align shallow targeted high-throughput sequencing to a pre-built map of an organism
4 Genome Reference Consortium (GRC) Most model organism reference genomes are being regularly updated Reference genomes consist of a mixture of known chromosomes and unplaced contigs called as Genome Reference Assembly Genome Reference Consortium: A collaboration of institutes which curate and maintain the reference genomes of 4 model organisms: Human - GRCh38.p9 (26 Sept 2016) Mouse - GRCm38.p5 (29 June 2016) Zebrafish - GRCz10 (12 Sept 2014) Chicken - Gallus_gallus-5.0 (16 Dec 2015) Latest human assembly is GRCh38, patches add information to the assembly without disrupting the chromosome coordinates Other model organisms are maintained separately, like: Drosophila - Berkeley Drosophila Genome Project
5 Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF (gene annotation) Wiggle files, BEDgraphs, BigWigs (genomic scores)
6 The reference genome A reference genome is a collection of contigs A contig is a stretch of DNA sequence encoded as A, G, C, T or N Typically comes in FASTA format: ">" line contains information on contig Following lines contain contig sequences
7 Unaligned sequences - FastQ Unaligned sequence files generated from HTS machines are mapped to a reference genome to produce aligned sequence FastQ (unaligned sequences) SAM (aligned sequences) FastQ: FASTA with quality "@" followed by identifier Sequence information "+" Quality scores encodes as ASCI
8 Unaligned sequences - FastQ header Header for each read can contain additional information HS _89 - Machine name 5 - Flowcell lane /1 - Read 1 or 2 of pair
9 Unaligned sequences - FastQ qualities Qualities come after the "+" line -log10 probability of sequence base being wrong Encoded in ASCII to save space Used in quality assessment and downstream analysis
10 Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF (gene annotation) Wiggle files, BEDgraphs, BigWigs (genomic scores)
11 Aligned sequences - SAM format SAM - Sequence Alignment Map Standard format for sequence data Recognised by majority of software and browsers SAM header SAM header contains information on alignment and contigs - Version number and sorting - Contig/Chromosome name and length of sequence
12 Aligned sequences - SAM format SAM aligned reads Contains read and alignment information and location Read name Sequence of read Encoded sequence quality
13 Aligned sequences - SAM format SAM aligned reads Chromosome to which the read aligns Position in chromosome to which 5' end of the read aligns Alignment information - "Cigar string" 100M - Continuous match of 100 bases 28M1D72M - 28 bases continuously match, 1 deletion from reference, 72 base match
14 Aligned sequences - SAM format SAM aligned reads Bit flag - TRUE/FALSE for pre-defined read criteria, like: is it paired? duplicate? Paired read position and insert size User defined flags Li H et al.,the Sequence Alignment/Map format and SAMtools. Bioinformatics Aug 15;25(16):
15 Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF (gene annotation) Wiggle files, BEDgraphs, BigWigs (genomic scores)
16 Summarised genomic features formats After alignment, sequence reads are typically summarised into scores over/within genomic intervals BED - genomic intervals with additional information Wiggle files, BEDgraphs, BigWigs - genomic intervals with scores GFF/GTF - genomic annotation with information and scores
17 BED format - genomic intervals BED3-3 tab separated columns Chromosome Start End Simplest format BED6-6 tab separated columns Chromosome, start, end Identifier Score Strand ("." stands for strandless)
18 Wiggle format - genomic scores Variable step Wiggle format Fixed step Wiggle format Information line Chromosome Step size (Span - default=1, to describe contiguous positions with same value) Each line contains: Start position of the step Score Information line Chromosome Start position of first step Step size (Span - default=1, to describe contiguous positions with same value) Each line contains: Score
19 bedgraph format - genomic scores BED-like format Starts as a 3 column BED file (chromosome, start, end) 4th column: score value
20 GFF - genomic annotation Stores position, feature (exon) and meta-feature (transcript/gene) information Columns: Chromosome Source Feature type Start position End position Score Strand Frame - 0, 1 or 2 indicating which base of the feature is the first base of the codon Semicolon separated attribute: ID (feature name);parent (meta-feature name)
21 Saving time and space - compressed file formats Many programs and browsers deal better with compressed, indexed versions of genomic files SAM -> BAM (.bam and index file of.bai) BED -> bigbed (.bb) Wiggle and bedgraph -> bigwig (.bw/.bigwig) BED and GFF -> (.gz and index file of.tbi)
22 Getting help and more information UCSC file formats IGV file formats Sanger file formats
23 Acknowledgement Tom Carroll
Reference genomes and common file formats
Reference genomes and common file formats Dóra Bihary MRC Cancer Unit, University of Cambridge CRUK Functional Genomics Workshop September 2017 Overview Reference genomes and GRC Fasta and FastQ (unaligned
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June Introduction
INTERNATIONAL ORGANISATION FOR STANDARDISATION ORGANISATION INTERNATIONALE DE NORMALISATION ISO/IEC JTC 1/SC 29/WG 11 CODING OF MOVING PICTURES AND AUDIO ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June
DATA FORMATS AND QUALITY CONTROL
HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)
Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
Sanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
Mapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010
Mapping Next Generation Sequence Reads Bingbing Yuan Dec. 2, 2010 1 What happen if reads are not mapped properly? Some data won t be used, thus fewer reads would be aligned. Reads are mapped to the wrong
Gene Expression analysis with RNA-Seq data
Gene Expression analysis with RNA-Seq data C3BI Hands-on NGS course November 24th 2016 Frédéric Lemoine Plan 1. 2. Quality Control 3. Read Mapping 4. Gene Expression Analysis 5. Splicing/Transcript Analysis
C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
Quantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
Introduction to Next Generation Sequencing
The Sequencing Revolution Introduction to Next Generation Sequencing Dena Leshkowitz,WIS 1 st BIOmics Workshop High throughput Short Read Sequencing Technologies Highly parallel reactions (millions to
NGS, Cancer and Bioinformatics. 5/3/2015 Yannick Boursin
NGS, Cancer and Bioinformatics 5/3/2015 Yannick Boursin 1 NGS and Clinical Oncology NGS in hereditary cancer genome testing BRCA1/2 (breast/ovary cancer) XPC (melanoma) ERCC1 (colorectal cancer) NGS for
10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
How to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
Genomic DNA ASSEMBLY BY REMAPPING. Course overview
ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation
NGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 What s Galaxy? Bringing Developers And Biologists Together. Reproducible Science Is Our Goal An open, web-based platform for data intensive
RNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
DNASeq: Analysis pipeline and file formats Sumir Panji, Gerrit Boha and Amel Ghouila
DNASeq: Analysis pipeline and file formats Sumir Panji, Gerrit Boha and Amel Ghouila Bioinforma>cs analysis and annota>on of variants in NGS data workshop Cape Town, 4th to 6th April 2016 DNA Sequencing:
Introduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
Introduction to bioinformatics (NGS data analysis)
Introduction to bioinformatics (NGS data analysis) Alexander Jueterbock 2015-06-02 1 / 45 Got your sequencing data - now, what to do with it? File size: several Gb Number of lines: >1,000,000 @M02443:17:000000000-ABPBW:1:1101:12675:1533
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
Bioinformatics for NGS projects. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics for NGS projects Guidelines genomescan.nl GenomeScan s Guidelines for Bioinformatics Services on NGS Data Using our own proprietary data analysis pipelines Dear
Introduc)on to Bioinforma)cs of next- genera)on sequencing. Sequence acquisi)on and processing; genome mapping and alignment manipula)on
Introduc)on to Bioinforma)cs of next- genera)on sequencing Sequence acquisi)on and processing; genome mapping and alignment manipula)on Ruslan Sadreyev Director of Bioinformatics Department of Molecular
BME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
Lecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
Basic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
Investigating Inherited Diseases
Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.
Small Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Bionano Access v1.1 Release Notes
Bionano Access v1.1 Release Notes Document Number: 30188 Document Revision: C For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved. Table
Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
ATAC-seq workshop. Katarzyna Kedzierska Center for Public Health Genomics University of Virginia. Jachranka, Poland September 2017
ATAC-seq workshop Katarzyna Kedzierska Center for Public Health Genomics University of Virginia Jachranka, Poland September 2017 Accessible chromatin If chromatin is open there s place for DNA-binding
QIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
RNA-Seq Module 2 From QC to differential gene expression.
RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes.
CrusView Manual CrusView is a tool for karyotype/genome visualization and comparison of crucifer species. It also provides functions to import new genomes. Contents System Requirement..........................................
Building a platinum human genome assembly from single haplotype human genomes. Karyn Meltz Steinberg PacBio UGM December,
Building a platinum human genome assembly from single haplotype human genomes Karyn Meltz Steinberg PacBio UGM December, 2015 @KMS_Meltzy Single haplotype from hydatidiform mole Enucleated egg (no maternal
Ensembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
De Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
Training materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014
Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
SNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
VM origin. Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE
VM origin Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE NGS intro + Genome-Based Transcript Reconstruction and Analysis Using RNA-Seq Data Based on material
BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1
BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio
Introduc)on to Genomics
Introduc)on to Genomics Libor Mořkovský, Václav Janoušek, Anastassiya Zidkova, Anna Přistoupilová, Filip Sedlák h1p://ngs-course.readthedocs.org/en/praha-january-2017/ Genome The genome is the gene,c material
Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
An Introduction to the package geno2proteo
An Introduction to the package geno2proteo Yaoyong Li January 24, 2018 Contents 1 Introduction 1 2 The data files needed by the package geno2proteo 2 3 The main functions of the package 3 1 Introduction
Using the Genome Browser: A Practical Guide. Travis Saari
Using the Genome Browser: A Practical Guide Travis Saari What is it for? Problem: Bioinformatics programs produce an overwhelming amount of data Difficult to understand anything from the raw data Data
TECH NOTE Ligation-Free ChIP-Seq Library Preparation
TECH NOTE Ligation-Free ChIP-Seq Library Preparation The DNA SMART ChIP-Seq Kit Ligation-free template switching technology: Minimize sample handling in a single-tube workflow >> Simplified protocol with
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES.
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES. Table of Contents Examples 1 Sample Analyses 5 Examples: Introduction to Examples While these examples can be followed
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
NEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
SMAP File Format Specification Sheet
SMAP File Format Specification Sheet Document Number: 30041 Document Revision: E For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics Inc. All Rights Reserved Table
Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
MODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome
Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,
European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Read Complexity
Supplementary Figure 1 Read Complexity A) Density plot showing the percentage of read length masked by the dust program, which identifies low-complexity sequence (simple repeats). Scrappie outputs a significantly
Read Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
From reads to results. Dr Torsten Seemann
From reads to results Dr Torsten Seemann AGRF/EMBL Introduction to Bioinformatics - Monash University - Wed 1 Aug 2012 What I will cover * NGS Applications Sequences Sequence quality Read file formats
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
RNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
Illumina Sequencing Error Profiles and Quality Control
Illumina Sequencing Error Profiles and Quality Control RNA-seq Workflow Biological samples/library preparation Sequence reads FASTQC Adapter Trimming (Optional) Splice-aware mapping to genome Counting
RNAseq Applications in Genome Studies. Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford
RNAseq Applications in Genome Studies Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford RNAseq Protocols Next generation sequencing protocol cdna, not RNA sequencing
axe Documentation Release g6d4d1b6-dirty Kevin Murray
axe Documentation Release 0.3.2-5-g6d4d1b6-dirty Kevin Murray Jul 17, 2017 Contents 1 Axe Usage 3 1.1 Inputs and Outputs..................................... 4 1.2 The barcode file......................................
Supplementary Information Supplementary Figures
Supplementary Information Supplementary Figures Supplementary Figure 1. Frequency of the most highly recurrent gene fusions in 333 prostate cancer patients from the TCGA. The Y-axis shows numbers of patients.
Package geno2proteo. December 12, 2017
Type Package Package geno2proteo December 12, 2017 Title Finding the DNA and Protein Sequences of Any Genomic or Proteomic Loci Version 0.0.1 Date 2017-12-12 Author Maintainer biocviews
Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
![Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]](/thumbs/75/71877651.jpg "Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]")
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
UAB DNA-Seq Analysis Workshop. John Osborne Research Associate Centers for Clinical and Translational Science
+ UAB DNA-Seq Analysis Workshop John Osborne Research Associate Centers for Clinical and Translational Science ozborn@uab.,edu + Thanks in advance You are the Guinea pigs for this workshop! At this point
Introduction to human genomics and genome informatics
Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
Francisco García Quality Control for NGS Raw Data
Contents Data formats Sequence capture Fasta and fastq formats Sequence quality encoding Quality Control Evaluation of sequence quality Quality control tools Identification of artifacts & filtering Practical
Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
Biol4230 Thurs, March 22, 2018 Bill Pearson Pinn 6-057
BEDTools Genome Arithmetic Biol4230 Thurs, March 22, 208 Bill Pearson wrp@virginia.edu 4-288 Pinn 6-057 Borrowed from Aaron Quinlan, BEDTools author Genome file types/formats format types BED files Overview
L3: Short Read Alignment to a Reference Genome
L3: Short Read Alignment to a Reference Genome Shamith Samarajiwa CRUK Autumn School in Bioinformatics Cambridge, September 2017 Where to get help! http://seqanswers.com http://www.biostars.org http://www.bioconductor.org/help/mailing-list
Introduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
Analytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
Bionano Access 1.1 Software User Guide
Bionano Access 1.1 Software User Guide Document Number: 30142 Document Revision: B For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved.