Chapter 13 Chromatin Structure and its Effects on Transcription
|
|
- Roxanne Gardner
- 6 years ago
- Views:
Transcription
1 Chapter 13 Chromatin Structure and its Effects on Transcription
2 Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
3 Notes Do not attempt to interpret figure Figure The concentration of nucleosomes does not prevent the restriction enzyme from finding its cut sites in many molecules (in some the nucleosomes block the cut site).
4 Eukaryotes five different Histone Classes Histone size amino acids Molecular weight H2A ,000 H2B ,770 H ,400 H ,340 H1 (H5) ,500 Eukaryotes contain many copies of each histone gene in mice, 100X in Drosophila
5 Compaction Double helix Beads On A string solenoid Snake The Solenoid PR nm fiber Probably involve SARS
6
7 Nucleosome DNA Protein Core nucleosome contains 2X H2A, 2X H2B, 2X H3 & 2X H4
8 Beads on a string Beads on a string packing ratio 5
9 Histone H1 Outside of the core Easiest to remove by high salt extraction H2B H2A H3 H1 H4 H2B DNA
10 DNA Solenoid 27Å H1 histone Nucleosome core 30 nm solenoid 6 per turn Packing ratio of 8 57Å
11 Tetranucleosome Fig 13.7
12
13 45-80 kb loops
14
15 Evidence that histones help to regulate gene expression Xenopus laevis 5s rrna (20,000 copies) oocyte 5S rrna genes, expressed only in oocytes - 98% somatic 5S rrna genes, expressed in both oocytes and somatic cells - 2%
16 Chromatin is required for specificity With DNA, RNA polymerase III transcribes both well With oocyte chromatin, both expressed With somatic cell chromatin only somatic 5S rrna genes expressed.
17 Somatic cell chromatin Inactive oocyte genes contained all 5 histones* Active somatic genes contain only core histones Remove H1 & oocyte genes turn on. Add it back and they turn off. pg 369 Weaver 4th ed.
18 Nucleosome compete with transcription factors This is too simple to allow one to modulate expression or is it?
19 mrna encoding genes Class II genes transcribed by RNA polymerase II Core histones cause mild (4X) repression of gene expression Activators do not affect this H1 increases repression (25 to 100X) Activators can prevent this - similar to the 5S genes.
20 Laybourne & Kadonaga 1991 Chromatin form of the Drosophila Krüppel gene nuclear extract transcribes it at 25% of the maximum rate. This is 75% repression. Interpretation 1) 100% of the genes are transcribed at a 75% rate of transcription 2) 25% of the genes are transcribed at 100% of the rate. 25% of promoters unoccupied. How was this determined? pg 370 Weaver 4th ed
21 Histones can act as repressors Thus, via competition for binding sites, transcription factors can derepress (your book calls it antirepression. Histone H1 Nucleosome core
22 Histone antirepression With respect to histone repression, Gal4 acts as an antirepressor. In addition, it acts as an activator. SP1 acts as both a histone antirepressor and as an activator. GAGA factor seems to only act as a histone antirepressor.
23 De-repression or Anti-repression is the amount of transcription that you get when the histone is not interfering by hiding the promoter.
24 Histone antirepression With respect to histone repression, Gal4 acts as an antirepressor. In addition, it acts as an activator. SP1 acts as both a histone antirepressor and as an activator. GAGA factor seems to only act as a histone antirepressor.
25 Yaniv saw that some transcriptionally active SV40 virus DNAs had nucleosome free zones. Fig Weaver 3rd ed. Figure 13.17
26 Is the promoter region of an active gene a nucleosome free zone? EcoRI BamHI BglI Figure
27 BamHI BamHI BamHI BglII BglII BglII
28 DNase I hypersensitivity Transcribing SV40 virus isolated from infected monkey cell tissue culture. BamHI EcoRI BamHI EcoRI BglI BglI EcoRI DNAse I EcoRI
29 Two fragments Figure Gel electrophoresis & Southern Blotting This is a Southern Blot.
30 DNase I hypersensitivity in Chromatin lectures Is this caused by the promoter or something else near the promoter? Can this occur with the promoter at a different location? Try a modified SV40 that has a second promoter inserted. Does transcription cause this or is it caused by something else that binds the promoter? Do we need to have transcription for this to occur? Make a nuclear lysate that supports transcription & chromatin assembly. Then deplete it for RNA polymerase II. Or starve for nucleotides. Is this peculiar to the SV40 promoter. Try a plasmid with a completely different type of promoter. Does the promoter have to be active for this to happen? Try this with a promoter that can be turned on and off. eg. Tet-on. Why does the smaller band disappear? *Less intense because amount of probe that it can collect is smaller. Test w/2 probes of the same size. *Less abundant, because transcription is going that way and polymerarse might expand the nucleosome clear zone to the left. Test by reversing the direction of the plasmid. What is the origin of the 100% band. Does it confound our interpretation?
31 Histone acetylation amino groups of lysine side chains unacetylated histones tend to repress transcription acetylated histones tend to activate transcription Histone acetyl transferase (HAT) - see Figure for how to detect them. Histone deacetylase
32 Histone acetylation First discovered by Vincent Allfrey in 1964 takes till 1996 (Brownell & Allis) to purify a HAT Tetrahymena has heavily acetylated histones. Take macronuclei extracts. SDS gel electrophoresis in gel impregnated with histones. Soak in radiolabeled acetyl-coa. Wash. Fluorography. You don t have this slide.
33 How to purify a HAT Acetylates histones What do you know about it? heated chemical inactivation BSA no histones no protein What does this knowledge provide you? A way to assay for its presence What is the advantage of using a gel? Demonstrates that one is detecting the presence of a single enzyme. Tells you the relative size of the enzyme.
34 Now purify it. Standard biochemical techniques to purify p55. Can use the assay to tell where it is. Once pure get partial amino acid sequence. Very small number of amino acids.
35 Degenerate PCR KGWMDIM NMVTMMV mrna DNA
36 Degenerate PCR KGWMDIM NMVTMMV mrna DNA
37 Degenerate PCR KGWMDIM NMVTMMV mrna AAAAAAA REVERSE TRANSCRIBE TO DNA
38 Degenerate PCR KGWMDIM NMVTMMV Codon Usage by amino acid. F L S Y C W P H Q R TTT TTA TCT TAT TGT TGG CCT CAT CAA CGT TTC TTG TCC TAC TGC CCC CAC CAG CGC CTT TCA CCA CGA CTC TCG CCG CGG CTA AGT AGA CTG AGC AGG I M T N K V A D E G ATT ATG ACT AAT AAA GTT GCT GAT GAA GGT ATC ACC AAC AAG GTC GCC GAC GAG GGC ATA ACA GTA GCA GGA ACG GTG GCG GGG
39 Degenerate PCR KGWMDIM NMVTMMV UPPER STRAND Primer cocktail K G W M D I M 5' AA(AG) GG(N) TGG ATG GA(TC) AT(TCA) ATG 3' 2 X 4 X 1 X 1 X 2 X 3 X 1 = 48 A 21 mer primer with 48 fold degeneracy.
40 Degenerate PCR KGWMDIM NMVTMMV LOWER STRAND Primer cocktail N M V T M M V 5' AA(TC) ATG GT(N) AC(N) ATG ATG GT(N) 3' Take the reverse complement for the lower strand. The reverse complement is merely the opposite strand in a DNA helix also written in the 5' to 3 direction. 5' (N)AC CAT CAT (N)GT (N)AC CAT (AG)TT 3' 4 X 1 X 1 X 4 X 4 X 1 X 2 = 128
41 Degenerate PCR LOWER STRAND Primer cocktail N M V T M M V 5' AA(TC) ATG GT(N) AC(N) ATG ATG GT(N) 3' Take the reverse complement for the lower strand. The reverse complement is merely the opposite strand in a DNA helix also written in the 5' to 3 direction. 5' (N)AC CAT CAT (N)GT (N)AC CAT (AG)TT 3' 4 X 1 X 1 X 4 X 4 X 1 X 2 = 128 If we wish to have a less degenerate cocktail what can we do? Let's shave off the 5' end by one base to reduce the degeneracy to 32 fold. 5' AC CAT CAT (N)GT (N)AC CAT (AG)TT 3' Degeneracy is 1 X 1 X 1 X 4 X 4 X 1 X 2 = 32 fold degeneracy.
42 Degenerate PCR D N F N R Q K Q K L G G E D L F M T E E Q K K Y Y N A M K K L G S K K GAYAAYTTYAAYMGNCARAARCARAARYTNGGNGGNGARGAYYTNTTYATGACNGARGARCARAARAARTAYTAYAAYGCNATGAARAARYTNGGNWSNAARAARG L G G E D L F YTNGGNGGNGARGAYYTNTTY = 4608 D N F N R Q K...K K Y Y N A M GAYAAYTTYAAYMGNCARAAR...AARAARTAYTAYAAYGCNATG = = 128 Ambiguous Bases A-adenine B-not A C-cytosine G-guanine H-not G K-G or T M-A or C N-A, C, G or T R-A or G S-C or G T-thymine U-uracil=T V-not T W-A or T Y-C or T - = gap
43 Screen a cdna library DNA copies of every mrna made by a cell are produced and cloned into a bacterial vector. Screening. Google.
44 5 -RACE Figure 4.16
45 HAT type A Have bromodomain Binds aceylated lysines. So HAT A s can recoginze partially acetylated histone tails. Examples p55, Gcn5p CBP/p300, TAF250
46 Acetylation continued Acetylation of histone tails neutralizes some of the positive charge, causing them to relax their grip on the DNA. Reduces nucleosome cross-linking. That is; the interaction between histones in neighboring nucleosome. eg. basic n- terminal tail of H4 in one nucleosome and an acidic pocket in H2A-H2B dimer in the next nucleosome
47 Acetylation continued Also some TFs recognize acetylated histones. eg. TAFII250 has a double bromodomain and recognizes low level acetylated histones. Once bound it is a HAT and increases acetylation. low level acetylation of histones occurs in inactive chromatin.
48 EN D
49
50 Take home The presence of nucleosomes can interfere with the binding of TFs to enhancers and with the preinitiation complex to the promoter. = Repression When other proteins (simple TFs) are bound to the DNA they can prevent the histones from binding. This is competitive inhibition of histone binding. Called de-repression or antirepression in your book.
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationPromoter 1. Promoter 2. Enhancer 2
Essays 1. An animal normally has two copies of the Xan gene. The protein made by this gene helps the animal clear petroleum-based pollutants from its body. Tine Xan What we know about the Xan gene is shown
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationExpression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
More informationChromatin Structure and its Effects on Transcription
Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationTable S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes
Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationMolecular Level of Genetics
Molecular Level of Genetics Most of the molecules found in humans and other living organisms fall into one of four categories: 1. carbohydrates (sugars and starches) 2. lipids (fats, oils, and waxes) 3.
More informationA Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,
TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,
More informationChapter 3: Information Storage and Transfer in Life
Chapter 3: Information Storage and Transfer in Life The trapped scientist examples are great for conceptual purposes, but they do not accurately model how information in life changes because they do not
More informationSUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationMCB421 FALL2005 EXAM#3 ANSWERS Page 1 of 12. ANSWER: Both transposon types form small duplications of adjacent host DNA sequences.
Page 1 of 12 (10pts) 1. There are two mechanisms for transposition used by bacterial transposable elements: replicative (Tn3) and non-replicative (Tn5 and Tn10). Compare and contrast the two mechanisms
More informationSupplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
More informationBioInformatics and Computational Molecular Biology. Course Website
BioInformatics and Computational Molecular Biology Course Website http://bioinformatics.uchc.edu What is Bioinformatics Bioinformatics upgrades the information content of biological measurements. Discovery
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationCHE-3H84: Protein Engineering Past Exam Papers
CHE-3H84: Protein Engineering Past Exam Papers Sorted by Topic then Year Knowledge-Based Engineering of Proteins, Large Scale Production of Recombinant Proteins, and Protein Purification Dr. Hemmings 2006/7
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Coding and noncoding transcription at the vg locus. (a,b) qpcr analysis of developmental and tissue-specific vg mrna (a) and PRE/TRE (b) transcription, shown as percentage of TBP
More informationLezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationCauses and Effects of N-Terminal Codon Bias in Bacterial Genes. Mikk Eelmets Journal Club
Causes and Effects of N-Terminal Codon Bias in Bacterial Genes Mikk Eelmets Journal Club 21.2.214 Introduction Ribosomes were first observed in the mid-195s (Nobel Prize in 1974) Nobel Prize in 29 for
More information1.) Draw the structure of guanine. Indicate where the hydrogen bonds form with cytosine. (4pts)
Name Student ID# p 1.) Draw the structure of guanine. Indicate where the hydrogen bonds form with cytosine. (4pts) hydrogen bonds form at these sites O HN HN H N N R Microbial Genetics BIO 410/510 Fall
More informationSupporting Information
upporting Information hiota et al..73/pnas.159218 I Materials and Methods Yeast trains. Yeast strains used in this study are described in Table 1. TOM22FLAG, a yeast haploid strain for expression of C-terminally
More information-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and
Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and
More informationPhosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease
Supplemental Information Molecular Cell, Volume 42 hosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an AT- Driven Ribonuclease Elif Sarinay Cenik, Ryuya Fukunaga, Gang Lu, Robert Dutcher,
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.
More informationSupplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.
arbitrary At1g02813 unit expressed protein Relative mrna amount 5.0 4.0 3.0 (X3.7) (X118) (X1.7) 5.6% act At1g06990 GDSL-motif lipase 3.0 (X2.2) /hydrolase (X39) (X1.3) 2.8% act At1g23590 expressed protein
More informationSupplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
More informationYeast BioBrick Assembly (YBA)
Yeast BioBrick Assembly (YBA) Standardized method for vector assembly of BioBrick devices via homologous recombination in Saccharomyces cerevisiae Martin Schneider, Leonard Fresenborg, Virginia Schadeweg
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More information