PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA

Size: px
Start display at page:

Download "PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA"

Transcription

1 PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA

2 BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with computer science and information technology.in bioinformatics, main job is development of biosoftwares. Bioinformatics is an interdisciplinary research area which may be broadly defined as the interface between biological and computational sciences. Bioinformatics involves the solution of complex biological problems using computational tools and systems.

3 Bioinformatics includes the collection, organisation,storage and retrieval of biological information from databases. Before the era of Bioinformatics, only two ways of performing biological experiments were available: within a living organism (so-called invivo) or in an artificial environment (so-called invitro).

4 PCR PRIMER DESIGN Designing primers is the most critical parameter for successful PCR. Selective amplification of nucleic acid molecules, that are initially present in minute quantities, provides a powerful tool for analyzing nucleic acids.the polymerase chain reaction is an enzymatic reaction, which follows relatively simple, predictable and well understood mathematical principles. However the scientist often relies on intuition to optimise the reaction. To make PCR an efficient and cost effective tool, some components of PCR such as Taq DNA polymerase, assay buffer, deoxynucleoside triphosphates (dntps), stabilizing agents, DNA Template and oligonucleotide primers must be considered. Efficacy and sensitivity of PCR largely depend on the efficiency of primers.

5 The ability for an oligonucleotide to serve as a primer for PCR is dependent on several factors including: The kinetics of association and dissociation of primer-template duplexes at the annealing and extension temperatures. Duplex stability of mismatched nucleotides and their location. The efficiency with which the polymerase can recognize and extend a mismatched duplex. DNA template quality or purity is not particularly significant for amplification.

6 SELECTION OF PCR AMPLIFICATION PRIMERS For designing primers following parameters should be taken into consideration: I. Primer Length: a Hard Core Factor Specificity, temperature and time of annealing are at least partly dependent on primer length. The rule-of-thumb is to use a primer with a minimal length that ensures a denaturation temperature of 55-56oC. For general studies, primers of typically nucleotides in length are the best. Primers of nucleotides are accepted as best in being sequence specific if the annealing temperature of the PCR reactions is set within 5oC of the dissociation temperature of primer-template duplex.

7 Longer primers (28-35 nucleotides) are required only to discriminate homologous genes within different species or when a perfect complementary sequence to all the template is not expected. II.Terminal Nucleotides Make a Difference: Both the terminals of the primer are of vital importance for a successful amplification. The 3 -end position in the primer affects mispriming. Runs (3 or more) of C s or G s should be avoided as G+C rich sequence leads to mispriming. The primer should have a stable 5 end and an unstable 3 end. Stretches of A and T are also to be avoided as these will open up stretches of the primer-template complex. A G or C is desirable at the 3 end. This GC clamp reduces spurious secondary bands.

8 III. Melting Temperature (Tm): The optimal melting temperature for primers generally lies in the range of 52-58oC. Both of the oligonucleotide primers should be designed such that they have similar melting temperatures. A good working approximation of this value can be calculated using the formula of Wallace etal (1979), Tm = 2(A+T) + 4(G+C) IV. GC Content: GC% is an important characteristic of DNA and provides information about the strength of annealing. Primers should have a GC contents between 45 and 60 percent. GC contents, melting temperature and annealing temperature are strictly dependent on one another.

9 V. Dimers and False Priming Cause Misleading Results: Annealing between the 3 end of one primer molecule and the 5 end of another primer molecule and subsequent extension results in a sharp background product known as primer dimmer. If the primer binds anywhere else than the target site, the amplification specifically is reduced significantly. This leads to weak output or a smear. When some bases at 3 end of the primer bind to target sequence and achieve favorable chances of extension, it also leads to weak output or a smear. VI. Specificity Primer specificity is at least partly dependent on primer length. It is found that there are many more unique 24 base oligos than 15 base pair oligos. Primers must be chosen so that they have a unique sequence within the template DNA that is to be amplified. A primer designed with a highly repetitive sequence will result in a smear when amplifying genomic DNA.

10 VII. Complementary Primer Sequences: Primers need to be designed with absolutely no intra-primer homology beyond 3 base pairs. If a primer has such a region of self homology, snap back, partially double stranded structures, can occur which will interfere with annealing to the template.

11 SECONDARY STRUCTURE An Important factor to consider when designing a primer is the presence of secondary structures. This greatly reduces the number of primer molecules available for bonding in the reaction. The presence of hairpin loops reduces the efficiency by limiting the ability to bind to the target site. No experimental data is available to support the prediction of the thermodynamic properties of hairpin structures, an important factor to consider when designing a primer. Single stranded nucleic acid sequences may have secondary structures due to the presence of complementary sequences within the primer length e.g. hairpin loops.

12 Retrieving Protein Sequences

13

14

15

16

17 More advanced ways to retrieve protein sequences

18 Retrieving a list of related protein sequences

19

20

21

22

23 Retrieving nucleotide sequences

24

25

26

27 BLASTing Protein Sequences

28

29

30

31

32 Multiple protein sequence alignment with clustalw

33

34

35 Gene Runner

36 Primer 3 It is a software developed by Rozen ans Skaletsky. It is freely available on Internet. This software is provided by the Whitehead Institute as is and any express or implied warranties, including, but not limited to, the implied warranties of merchantability and fitness for a particular purpose are disclaimed. This software is freely available on Internet for designing PCR primers.

Factors affecting PCR

Factors affecting PCR Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the

More information

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>> BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

PCR Amplifies Targeted Sequence

PCR Amplifies Targeted Sequence PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

Experiment (5): Polymerase Chain Reaction (PCR)

Experiment (5): Polymerase Chain Reaction (PCR) BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency

More information

2. Pyrosequencing Assay Design

2. Pyrosequencing Assay Design 2. Pyrosequencing Assay Design 2.1 Guidelines for PCR set-up and primer design 2.1.1 PCR primer design Design of PCR primers follows standard rules, i.e. calculated Tm of 62-65 C, primer length of about

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR.

BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR. BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR http://webpages.uncc.edu/~jweller2 Polymerase Chain Reaction Paper 1988 Nobel: 1993 How do you make enough genetic material to characterize

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

PCR OPTIMIZATION AND TROUBLESHOOTING

PCR OPTIMIZATION AND TROUBLESHOOTING PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,

More information

UNCC Biotechnology and Bioinformatics Camp. Dr. Jennifer Weller Summer 2010

UNCC Biotechnology and Bioinformatics Camp. Dr. Jennifer Weller Summer 2010 UNCC Biotechnology and Bioinformatics Camp Dr. Jennifer Weller Summer 2010 PCR Topic: the Polymerase Chain Reaction (PCR) 1988, Saiki, Mullis et al. proposed using a heat stable polymerase to carry out

More information

1. The AGI (Arabidospis Genome Initiative) convention gene names or AtRTPrimer ID should

1. The AGI (Arabidospis Genome Initiative) convention gene names or AtRTPrimer ID should We will show how users can select their desired types of primer-pairs, as we explain each of forms indicated by the blue-filled rectangles of Figure 1. Figure 1 Front-end webpage for searching desired

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases

DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases 1 DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases Adenine, Guanine, Cytosine and Thymine whereas in RNA

More information

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Appendix A DNA and PCR in detail DNA: A Detailed Look

Appendix A DNA and PCR in detail DNA: A Detailed Look Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or

More information

FAQs: PCR Polymerases from Takara Bio

FAQs: PCR Polymerases from Takara Bio FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Basic PCR Technique. Presented by : Noorul Hidayah Badri

Basic PCR Technique. Presented by : Noorul Hidayah Badri Basic PCR Technique Presented by : Noorul Hidayah Badri What is PCR? PCR is aninvitro technique which allow the amplification of a specific DNA region. PCR is like selecting a specific page from book and

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

PCR settings, pitfalls and artefacts

PCR settings, pitfalls and artefacts De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en

More information

CHAPTER 3 PRIMER DESIGN CRITERIA

CHAPTER 3 PRIMER DESIGN CRITERIA CHAPTER 3 PRIMER DESIGN CRITERIA In this chapter, we will discuss five basic elements of primer design criteria. The first section is melting temperature. In PCR experiment, there are three temperaturedependent

More information

Multiplex PCR Assay Kit Ver.2

Multiplex PCR Assay Kit Ver.2 Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex

More information

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department

More information

M1D2: Diagnostic Primer Design 2/10/15

M1D2: Diagnostic Primer Design 2/10/15 M1D2: Diagnostic Primer Design 2/10/15 Announcements 1. Expanded office hours for this week: Wednesday, 3-5pm in 16-319 Friday, 3-5pm in 16-319 Sunday, 3-5pm in 16-319 2. Weekly office hours (starting

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

DETERMINATION OF THE Rh FACTOR BY PCR

DETERMINATION OF THE Rh FACTOR BY PCR DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

Guidelines for Developing Robust and Reliable PCR Assays

Guidelines for Developing Robust and Reliable PCR Assays Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay

More information

TB Green Premix Ex Taq (Tli RNaseH Plus)

TB Green Premix Ex Taq (Tli RNaseH Plus) Cat. # RR420A For Research Use TB Green Premix Ex Taq (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AK8101. See section V. Storage.

More information

TB Green Premix Ex Taq II (Tli RNaseH Plus)

TB Green Premix Ex Taq II (Tli RNaseH Plus) Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.

More information

SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus

SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Cat. # RR82LR For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. A1901A. See section

More information

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications

More information

Table of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...

Table of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation... Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8

More information

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. AK9104. See section IV.

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

The Polymerase Chain Reaction

The Polymerase Chain Reaction The Polymerase Chain Reaction B3 Summer Science Camp at Olympic High School Dr. Jennifer Weller PCR 2 Topic: the Polymerase Chain Reaction (PCR) In 1988 Saiki, Mullis et al. proposed using a heat stable

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

Student Exercise on Polymerase Chain Reaction (PCR) Prepared by the Office of Biotechnology, Iowa State University. Part I. Part III.

Student Exercise on Polymerase Chain Reaction (PCR) Prepared by the Office of Biotechnology, Iowa State University. Part I. Part III. Student Exercise on Polymerase Chain Reaction (PCR) Prepared by the Office of Biotechnology, Iowa State University Part I. Segment of interest (02) Original-2 5' 3' 1. The purpose of PCR is to make copies

More information

SureStart Taq DNA Polymerase

SureStart Taq DNA Polymerase SureStart Taq DNA Polymerase INSTRUCTION MANUAL Catalog #600280 (100 U), #600282 (500 U), #600284 (1000 U) Revision A.01 For in Vitro Use Only 600280-12 LIMITED PRODUCT WARRANTY This warranty limits our

More information

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline

More information

Lecture 1 Sunday, 4 March :24 pm

Lecture 1 Sunday, 4 March :24 pm Lecture 1 Sunday, 4 March 2018 10:24 pm Amino acid side chains can be Hydrophobic, hydrophilic Positive, negatively charged Movement of information OH removed from 2' carbon to make the end more stable

More information

Designing Real-Time Assays on the SmartCycler II System

Designing Real-Time Assays on the SmartCycler II System Designing eal-time Assays on the SmartCycler II System Cepheid Technical Support Overview This document provides general guidelines for the design of real-time experiments on the Cepheid SmartCycler II

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR 1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. To understand principle of 2. Types 3. Applications 2. Lay Out 3 Types of Qualitative

More information

BENG 183 Trey Ideker (the details )

BENG 183 Trey Ideker (the details ) BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary

More information

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003 PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction = multiple rounds of in vitro DNA replication = a region of DNA lying between two regions of known sequence is amplified hundreds of millions of time within a matter of several

More information

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture... Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.

More information

SpeedSTAR HS DNA Polymerase

SpeedSTAR HS DNA Polymerase Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...

More information

AMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature

AMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature AMPLIFICATION BY PCR Target 5 3 2. Anneal primers 3 5 1. Denature Two copies of target 3. Extend primers 1. Denature 2. Anneal primers 3. Extend primers Four copies of target PCR: First 4 Cycles PCR: Completed

More information

Primer Design Ameer Effat M. Elfarash

Primer Design Ameer Effat M. Elfarash Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing

More information

LabQ Taq DNA Polymerase

LabQ Taq DNA Polymerase LabQ Taq DNA Polymerase SHIPPING: on dry ice / blue ice LOT: see vial PACK SIZES LQ-92TDP500U: 500 Units LabQ DNA Polymerase KIT COMPONENTS 500 U LabQ DNA Polymerase (5 U / µl) 2x 1.5 ml 10X LabQ Buffer

More information

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire 2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic

More information

Appendix A. Introduction to PCR

Appendix A. Introduction to PCR Appendix A Introduction to PR In 1983, Kary Mullis at etus orporation developed the molecular biology technique that has since revolutionized genetic research, earning him the Nobel Prize in 1993. This

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

Bio Rad PCR Song Lyrics

Bio Rad PCR Song Lyrics Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.

More information

QUICK-Clone TM User Manual. cdna

QUICK-Clone TM User Manual. cdna QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

KAPA HiFi HotStart ReadyMix PCR Kit

KAPA HiFi HotStart ReadyMix PCR Kit KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,

More information

PlantDirect TM Multiplex PCR System

PlantDirect TM Multiplex PCR System PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Basic Steps of the DNA process

Basic Steps of the DNA process As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed

More information

SYBR Advantage qpcr Premix User Manual

SYBR Advantage qpcr Premix User Manual SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

A critical review of PCR primer design algorithms and crosshybridization

A critical review of PCR primer design algorithms and crosshybridization Biochemistry 218 A critical review of PCR primer design algorithms and crosshybridization case study F. John Burpo Department of Chemical Engineering, Stanford University, CA 94305 Submitted August 11,

More information

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

LAMP User Guide Assay Design & Primers

LAMP User Guide Assay Design & Primers Contents Page Page Content 2 Assay Design overview 3 Assay Design Custom Design Service 4 Assay Design - Software 5 Assay Design Target Sequence 7 Primers Primer Concentrations 9 Primers Preparing Primer

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

DNA amplification and analysis: minipcr TM Food Safety Lab

DNA amplification and analysis: minipcr TM Food Safety Lab Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

M1D1: Context Setting and Primer Design 2/8/13

M1D1: Context Setting and Primer Design 2/8/13 M1D1: Context Setting and Primer Design 2/8/13 Module 1 Overview & Outline for lab today (2) Design primers to increase sensitivity or specificity (1) M1D1 starts here (3) Real world context (1) M1D1 Starts

More information

Associate Professor Chatchawan Srisawat MD. Ph.D

Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION In vitro technique for amplification of the specified DNA sequences. It enables us to produce enormous

More information

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect

More information

SNPWizard User Guide

SNPWizard User Guide SNPWizard User Guide About SNPWizard There are many situations in which one wishes to amplify a small segment of DNA where otherwise identical strands may differ. Such segments may consist of a single

More information

Amplify RP. Assay Design Help Book. Discover what AmplifyRP can do for you. Discovery Kits. Page 1

Amplify RP. Assay Design Help Book. Discover what AmplifyRP can do for you. Discovery Kits. Page 1 Amplify RP Discovery Kits Assay Design Help Book Discover what AmplifyRP can do for you. Page 1 Table Contents Permitted Use of Product 3 Storage of Product 3 Warranty Information 3 AmplifyRP Overview

More information

Loop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization

Loop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization Loop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization Tony Rockweiler, Diagnostic Research Scientist, Lucigen March, 2018 www.lucigen.com Agenda LAMP Overview Review the mechanics

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Human Genomics. Higher Human Biology

Human Genomics. Higher Human Biology Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information