PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA
|
|
- Shon Andrews
- 6 years ago
- Views:
Transcription
1 PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA
2 BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with computer science and information technology.in bioinformatics, main job is development of biosoftwares. Bioinformatics is an interdisciplinary research area which may be broadly defined as the interface between biological and computational sciences. Bioinformatics involves the solution of complex biological problems using computational tools and systems.
3 Bioinformatics includes the collection, organisation,storage and retrieval of biological information from databases. Before the era of Bioinformatics, only two ways of performing biological experiments were available: within a living organism (so-called invivo) or in an artificial environment (so-called invitro).
4 PCR PRIMER DESIGN Designing primers is the most critical parameter for successful PCR. Selective amplification of nucleic acid molecules, that are initially present in minute quantities, provides a powerful tool for analyzing nucleic acids.the polymerase chain reaction is an enzymatic reaction, which follows relatively simple, predictable and well understood mathematical principles. However the scientist often relies on intuition to optimise the reaction. To make PCR an efficient and cost effective tool, some components of PCR such as Taq DNA polymerase, assay buffer, deoxynucleoside triphosphates (dntps), stabilizing agents, DNA Template and oligonucleotide primers must be considered. Efficacy and sensitivity of PCR largely depend on the efficiency of primers.
5 The ability for an oligonucleotide to serve as a primer for PCR is dependent on several factors including: The kinetics of association and dissociation of primer-template duplexes at the annealing and extension temperatures. Duplex stability of mismatched nucleotides and their location. The efficiency with which the polymerase can recognize and extend a mismatched duplex. DNA template quality or purity is not particularly significant for amplification.
6 SELECTION OF PCR AMPLIFICATION PRIMERS For designing primers following parameters should be taken into consideration: I. Primer Length: a Hard Core Factor Specificity, temperature and time of annealing are at least partly dependent on primer length. The rule-of-thumb is to use a primer with a minimal length that ensures a denaturation temperature of 55-56oC. For general studies, primers of typically nucleotides in length are the best. Primers of nucleotides are accepted as best in being sequence specific if the annealing temperature of the PCR reactions is set within 5oC of the dissociation temperature of primer-template duplex.
7 Longer primers (28-35 nucleotides) are required only to discriminate homologous genes within different species or when a perfect complementary sequence to all the template is not expected. II.Terminal Nucleotides Make a Difference: Both the terminals of the primer are of vital importance for a successful amplification. The 3 -end position in the primer affects mispriming. Runs (3 or more) of C s or G s should be avoided as G+C rich sequence leads to mispriming. The primer should have a stable 5 end and an unstable 3 end. Stretches of A and T are also to be avoided as these will open up stretches of the primer-template complex. A G or C is desirable at the 3 end. This GC clamp reduces spurious secondary bands.
8 III. Melting Temperature (Tm): The optimal melting temperature for primers generally lies in the range of 52-58oC. Both of the oligonucleotide primers should be designed such that they have similar melting temperatures. A good working approximation of this value can be calculated using the formula of Wallace etal (1979), Tm = 2(A+T) + 4(G+C) IV. GC Content: GC% is an important characteristic of DNA and provides information about the strength of annealing. Primers should have a GC contents between 45 and 60 percent. GC contents, melting temperature and annealing temperature are strictly dependent on one another.
9 V. Dimers and False Priming Cause Misleading Results: Annealing between the 3 end of one primer molecule and the 5 end of another primer molecule and subsequent extension results in a sharp background product known as primer dimmer. If the primer binds anywhere else than the target site, the amplification specifically is reduced significantly. This leads to weak output or a smear. When some bases at 3 end of the primer bind to target sequence and achieve favorable chances of extension, it also leads to weak output or a smear. VI. Specificity Primer specificity is at least partly dependent on primer length. It is found that there are many more unique 24 base oligos than 15 base pair oligos. Primers must be chosen so that they have a unique sequence within the template DNA that is to be amplified. A primer designed with a highly repetitive sequence will result in a smear when amplifying genomic DNA.
10 VII. Complementary Primer Sequences: Primers need to be designed with absolutely no intra-primer homology beyond 3 base pairs. If a primer has such a region of self homology, snap back, partially double stranded structures, can occur which will interfere with annealing to the template.
11 SECONDARY STRUCTURE An Important factor to consider when designing a primer is the presence of secondary structures. This greatly reduces the number of primer molecules available for bonding in the reaction. The presence of hairpin loops reduces the efficiency by limiting the ability to bind to the target site. No experimental data is available to support the prediction of the thermodynamic properties of hairpin structures, an important factor to consider when designing a primer. Single stranded nucleic acid sequences may have secondary structures due to the presence of complementary sequences within the primer length e.g. hairpin loops.
12 Retrieving Protein Sequences
13
14
15
16
17 More advanced ways to retrieve protein sequences
18 Retrieving a list of related protein sequences
19
20
21
22
23 Retrieving nucleotide sequences
24
25
26
27 BLASTing Protein Sequences
28
29
30
31
32 Multiple protein sequence alignment with clustalw
33
34
35 Gene Runner
36 Primer 3 It is a software developed by Rozen ans Skaletsky. It is freely available on Internet. This software is provided by the Whitehead Institute as is and any express or implied warranties, including, but not limited to, the implied warranties of merchantability and fitness for a particular purpose are disclaimed. This software is freely available on Internet for designing PCR primers.
Factors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More information601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>
BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they
More informationOptimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
More informationPCR Amplifies Targeted Sequence
PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for
More informationPolymerase Chain Reaction-361 BCH
Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture
More informationExperiment (5): Polymerase Chain Reaction (PCR)
BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency
More information2. Pyrosequencing Assay Design
2. Pyrosequencing Assay Design 2.1 Guidelines for PCR set-up and primer design 2.1.1 PCR primer design Design of PCR primers follows standard rules, i.e. calculated Tm of 62-65 C, primer length of about
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationDNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents
DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationBINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR.
BINF 6350 ITSC 8350 Fall 2011 Biotechnology & Genomics Lab PCR http://webpages.uncc.edu/~jweller2 Polymerase Chain Reaction Paper 1988 Nobel: 1993 How do you make enough genetic material to characterize
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More informationPCR OPTIMIZATION AND TROUBLESHOOTING
PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,
More informationUNCC Biotechnology and Bioinformatics Camp. Dr. Jennifer Weller Summer 2010
UNCC Biotechnology and Bioinformatics Camp Dr. Jennifer Weller Summer 2010 PCR Topic: the Polymerase Chain Reaction (PCR) 1988, Saiki, Mullis et al. proposed using a heat stable polymerase to carry out
More information1. The AGI (Arabidospis Genome Initiative) convention gene names or AtRTPrimer ID should
We will show how users can select their desired types of primer-pairs, as we explain each of forms indicated by the blue-filled rectangles of Figure 1. Figure 1 Front-end webpage for searching desired
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationDNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases
1 DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases Adenine, Guanine, Cytosine and Thymine whereas in RNA
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationAppendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
More informationFAQs: PCR Polymerases from Takara Bio
FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationBasic PCR Technique. Presented by : Noorul Hidayah Badri
Basic PCR Technique Presented by : Noorul Hidayah Badri What is PCR? PCR is aninvitro technique which allow the amplification of a specific DNA region. PCR is like selecting a specific page from book and
More informationPolymerase chain reaction
Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain
More informationPCR settings, pitfalls and artefacts
De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en
More informationCHAPTER 3 PRIMER DESIGN CRITERIA
CHAPTER 3 PRIMER DESIGN CRITERIA In this chapter, we will discuss five basic elements of primer design criteria. The first section is melting temperature. In PCR experiment, there are three temperaturedependent
More informationMultiplex PCR Assay Kit Ver.2
Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex
More informationE-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA
E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department
More informationM1D2: Diagnostic Primer Design 2/10/15
M1D2: Diagnostic Primer Design 2/10/15 Announcements 1. Expanded office hours for this week: Wednesday, 3-5pm in 16-319 Friday, 3-5pm in 16-319 Sunday, 3-5pm in 16-319 2. Weekly office hours (starting
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationDETERMINATION OF THE Rh FACTOR BY PCR
DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationCat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da
For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationTB Green Premix Ex Taq (Tli RNaseH Plus)
Cat. # RR420A For Research Use TB Green Premix Ex Taq (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AK8101. See section V. Storage.
More informationTB Green Premix Ex Taq II (Tli RNaseH Plus)
Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus
Cat. # RR82LR For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. A1901A. See section
More informationPCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.
PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications
More informationTable of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...
Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk
Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. AK9104. See section IV.
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationThe Polymerase Chain Reaction
The Polymerase Chain Reaction B3 Summer Science Camp at Olympic High School Dr. Jennifer Weller PCR 2 Topic: the Polymerase Chain Reaction (PCR) In 1988 Saiki, Mullis et al. proposed using a heat stable
More informationPrimeSTAR Max DNA Polymerase
Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.
More informationStudent Exercise on Polymerase Chain Reaction (PCR) Prepared by the Office of Biotechnology, Iowa State University. Part I. Part III.
Student Exercise on Polymerase Chain Reaction (PCR) Prepared by the Office of Biotechnology, Iowa State University Part I. Segment of interest (02) Original-2 5' 3' 1. The purpose of PCR is to make copies
More informationSureStart Taq DNA Polymerase
SureStart Taq DNA Polymerase INSTRUCTION MANUAL Catalog #600280 (100 U), #600282 (500 U), #600284 (1000 U) Revision A.01 For in Vitro Use Only 600280-12 LIMITED PRODUCT WARRANTY This warranty limits our
More informationPOLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence
POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline
More informationLecture 1 Sunday, 4 March :24 pm
Lecture 1 Sunday, 4 March 2018 10:24 pm Amino acid side chains can be Hydrophobic, hydrophilic Positive, negatively charged Movement of information OH removed from 2' carbon to make the end more stable
More informationDesigning Real-Time Assays on the SmartCycler II System
Designing eal-time Assays on the SmartCycler II System Cepheid Technical Support Overview This document provides general guidelines for the design of real-time experiments on the Cepheid SmartCycler II
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More informationPolymerase Chain Reaction PCR
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. To understand principle of 2. Types 3. Applications 2. Lay Out 3 Types of Qualitative
More informationBENG 183 Trey Ideker (the details )
BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and
More informationPolymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary
More informationPCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003
PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed
More informationPolymerase Chain Reaction
Polymerase Chain Reaction = multiple rounds of in vitro DNA replication = a region of DNA lying between two regions of known sequence is amplified hundreds of millions of time within a matter of several
More informationTable of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...
Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.
More informationSpeedSTAR HS DNA Polymerase
Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...
More informationAMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature
AMPLIFICATION BY PCR Target 5 3 2. Anneal primers 3 5 1. Denature Two copies of target 3. Extend primers 1. Denature 2. Anneal primers 3. Extend primers Four copies of target PCR: First 4 Cycles PCR: Completed
More informationPrimer Design Ameer Effat M. Elfarash
Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing
More informationLabQ Taq DNA Polymerase
LabQ Taq DNA Polymerase SHIPPING: on dry ice / blue ice LOT: see vial PACK SIZES LQ-92TDP500U: 500 Units LabQ DNA Polymerase KIT COMPONENTS 500 U LabQ DNA Polymerase (5 U / µl) 2x 1.5 ml 10X LabQ Buffer
More information2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire
2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic
More informationAppendix A. Introduction to PCR
Appendix A Introduction to PR In 1983, Kary Mullis at etus orporation developed the molecular biology technique that has since revolutionized genetic research, earning him the Nobel Prize in 1993. This
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationKAPA HiFi HotStart ReadyMix PCR Kit
KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationSYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationA critical review of PCR primer design algorithms and crosshybridization
Biochemistry 218 A critical review of PCR primer design algorithms and crosshybridization case study F. John Burpo Department of Chemical Engineering, Stanford University, CA 94305 Submitted August 11,
More informationPlatinum II Taq Hot-Start DNA Polymerase for high-throughput PCR
WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationLAMP User Guide Assay Design & Primers
Contents Page Page Content 2 Assay Design overview 3 Assay Design Custom Design Service 4 Assay Design - Software 5 Assay Design Target Sequence 7 Primers Primer Concentrations 9 Primers Preparing Primer
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationDNA amplification and analysis: minipcr TM Food Safety Lab
Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationM1D1: Context Setting and Primer Design 2/8/13
M1D1: Context Setting and Primer Design 2/8/13 Module 1 Overview & Outline for lab today (2) Design primers to increase sensitivity or specificity (1) M1D1 starts here (3) Real world context (1) M1D1 Starts
More informationAssociate Professor Chatchawan Srisawat MD. Ph.D
POLYMERASE CHAIN REACTION Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION In vitro technique for amplification of the specified DNA sequences. It enables us to produce enormous
More information7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes
Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect
More informationSNPWizard User Guide
SNPWizard User Guide About SNPWizard There are many situations in which one wishes to amplify a small segment of DNA where otherwise identical strands may differ. Such segments may consist of a single
More informationAmplify RP. Assay Design Help Book. Discover what AmplifyRP can do for you. Discovery Kits. Page 1
Amplify RP Discovery Kits Assay Design Help Book Discover what AmplifyRP can do for you. Page 1 Table Contents Permitted Use of Product 3 Storage of Product 3 Warranty Information 3 AmplifyRP Overview
More informationLoop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization
Loop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization Tony Rockweiler, Diagnostic Research Scientist, Lucigen March, 2018 www.lucigen.com Agenda LAMP Overview Review the mechanics
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationMarker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA
Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationHuman Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More information