EUKARYOTIC REGULATION C H A P T E R 1 3

Transcription

1 EUKARYOTIC REGULATION C H A P T E R 1 3

2 EUKARYOTIC REGULATION Every cell in an organism contains a complete set of DNA. But it doesn t use all of the DNA it receives Each cell chooses different DNA sequences to transcribe depending on the needs of that particular cell Your toenail cells don t need or care about the genes for building an ear drum. Eukaryotic cells have many more methods of regulating transcription than prokaryotic cells do Control of gene activity occurs in both the nucleus and cytoplasm, before and after transcription and translation.

3 EUKARYOTIC REGULATION Regulation occurs at four different levels Transcriptional Control: Which genes are transcribed, when, and how often? Posttranscriptional Control: Once the mrna is made, will it mature? Will any introns be cut out? Translational Control: How long does mrna take to be translated? How long does mrna exist in the cytoplasm before it is degraded? Posttranslational Control: Once the protein is made, does it need any alterations by the endoplasmic reticulum? Are cofactors present?

4 TRANSCRIPTIONAL CONTROL The first method of transcriptional control is the organization of the chromatin Chromatin is divided into two sections Genetically active euchromatin (lightly colored) Genetically inactive heterochromatin (dark colored) If a cell deems a particular set of DNA as unecessary for it s particular purpose, it will cram the DNA together and set it aside. This leaves more room for the DNA that the cell actually uses An example of heterochromatin is a Barr body

5

6 TRANSCRIPTIONAL CONTROL Barr Bodies If males only have one X chromosome, how can they produce the same amount of product as females with two X chromosomes (Think about the difficulties with extra DNA such as trisomy 21)? The answer: They don t. It turns out females only use half of their X chromosome product. Each cell in a female contains one active X chromosome in the euchromatin, and one inactive X chromosome in the heterochromatin Which chromosome (and thus, the genes on that chromosome) becomes the inactive chromosome is randomly chosen when the cell matures The inactive X chromosome is found in females only and is called a Barr body

7 TRANSCRIPTIONAL CONTROL Early in development each parent cell commits to one X-chromosome or another. As these cells undergo mitosis, their daughter cells contain the same Barr body. Instead of heterozygote organisms displaying 100% the dominant allele in all their cells, 50% of their cells show one allele and 50% show the opposite allele The dominant trait when the Barr body contains the recessive allele The recessive trait when the Barr body contains the dominant allele Example: calico cat coloring

8

9

10

11 TRANSCRIPTIONAL CONTROL Euchromatin, although active, still contain histones and nucleosomes Not nearly as many as when they form a chromosome These proteins limit transcription activity by not allowing enough space for polymerase Other factors Polytene chromosomes: Chromosomes that duplicate extra times other than the mitotic duplication, giving polymerase thousands of extra copies to transcribe if needed Gene amplification: Transcribing the genes that produce rrna and trna allow more genes to be translated simultaneously in the cell

12

13 TRANSCRIPTIONAL CONTROL Transcription Factors We have yet to find operons in eukaryotic cells, but we have found transcription factors (which have a similar role) Transcription factors increase and initiate transcription of eukaryotic DNA First, a transcription factor protein binds to a sequence of DNA called the enhancer Second, the factor loops the DNA back around and binds to another sequence of DNA called the promoter Only when both sites are bound to the transcription factor will RNA polymerase begin laying a primer

14

15 POSTTRANSCRIPTIONAL CONTROL Posttranscriptional control occurs once an mrna is transcribed and concerns introns and exons Before leaving the nucleus, introns are excised and the nucleotides are recycled. A single strand of DNA can be cut dozens of different ways by removing different combinations of introns Different strands of mrna take longer to exit the nuclear pore depending on the number of adenine/uracil vs guanine/cytosine Guanine and cytosine are held by three hydrogen bonds. The extra hydrogen bond holds them slightly closer to each other and can squeeze through the nuclear pore faster

16

17 TRANSLATIONAL CONTROL Translational control are methods of regulating the process of translation Masking Some mrna strands are meant for later in the cell s life, such as during mitosis. These strands hang out in the ER, then when needed exit to the cytoplasm, are activated, and rapidly undergo translation Hormone control Ribonuclease is the enzyme that breaks apart mrna strands Hormones, including estrogen and prolactin, can extend the life of mrna from hours/days to weeks by competitively inhibiting ribonuclease.

18 TRANSLATIONAL CONTROL Lifespan of mrna As long as mrna exists and is active, it can be translated into protein Ex. Red blood cells eject their nucleus shortly after interphase begins, yet they continue to translate hemoglobin genes. This shows that the mrna strands are still present after the nucleus is gone, continuously building hemoglobin At the 3 end of mrna are a string of adenines and uracils. At the 5 end are a string of guanines and cytosines Each of these groups serves as a cap (similar to telomeres on chromosomes) which blocks ribonuclease The longer the cap, the longer the life of the mrna

19

20 POSTTRANSLATIONAL CONTROL Posttranslational Control occurs once a protein has been synthesized. Activation Sometimes, other enzymes or the endoplasmic reticulum have to alter the shape or add lipids or carbohydrates to the protein for it to truly be an active enzyme Degradation Some proteins exist for only a short time, then are degraded. This task is carried out by proteasomes Cyclin, the protein that controls the cell cycle, is one example

21 NONFUNCTIONAL PROTEINS Cellular metabolic systems build on each other in a process called feedback and progression. One common example is the process of building melanin, which is as follows: Ea and Eb represent enzymes

22 NONFUNCTIONAL PROTEIN If each enzyme works properly, the cell is able to build melanin using phenylalanine as a precursor If Ea is not present or nonfunctional, phenylalanine builds up The result: mental deficiency due to phenylketonuria (PKU) If Eb is not present or nonfunctional, no melanin is produced The result: albinism

23 TRANSPOSONS The concept of genes being able to turn on or off was discovered by Barbara McClintock in 1944, but she wouldn t receive credit for another 30 years. Her discovery directly refuted the popular theory that genes occupied a permanent, fixed position Transposons (Transposable elements, or TE s) are DNA sequences that have the ability to activate/deactivate, and move within chromosomes. Approximately 50% of human genes are TE s. TE s can be an excellent method of randomizing genes for evolution, or can cause jumping gene mutations. These jumping genes have been discovered in nearly every organism, including humans. Hemophilia, Muscular Dystrophy, and Charcot-Marie-Tooth diseases are all due to TE s inserting themselves into functional genes, disrupting that gene s ability to undergo translation

24

25 RED: FUNCTIONAL GENE. BLUE: TRANSPOSON BLACK: NON-CODING (JUNK) DNA aaattatttcggctatcgatcgatacgatacgatcgctagctag cggctaagctagctagcgacgcatagctgcgatcgagcgat cgactgagctcgcggaaattatttcggctatcgatcgatacga tacgatcgctagctagcggctaagctagctagcgacgcata gctgcgatcgagcgatcgactgagctcgcggaaattatttcg gctatcgatcgatacgatacgatcgctagctagcggctaagc tagctagcgacgcatagctgcgatcgagcgatcgactgagc tcgcggaaattatttcggctatcgatcgatacgatacgatcgct agctagcggctaagctagctagcgacgcatagctgcgatcg agcgatcgactgagctcgcggaaattatttcggctatcgatcg atacgatacgatcgctagctagcggctaagctagctagcga cgcatagctgcgatcgagcgatcgactgagctcgcgg

26 RED: FUNCTIONAL GENE. BLUE: TRANSPOSON BLACK: NON-CODING (JUNK) DNA aaattatttcggctatcgatcgatacgatacgatcgctagctag cggctaacgcatagctgcgatcgagcgatcgactgagctcg cggaaattatttcggctatcgatcgatacgatacgatcgctag ctagcggctaagctagctagcgacgcatagctgcgatcgag cgatcgactgagctcgcggaaattatttcggctatcgatcgat acgatacgatcgctagctagcggctaagctagctagcgacg catagctgcgatcgagcgatcgactgagctcgcggaaattat ttcggctatcgatcgatacgatacgatcgctagctagcggcta agctagctagcgacgcatagctgcgatcgagcgatcgactg agctcgctagctagcgagcggaaattatttcggctatcgatcg atacgatacgatcgctagctagcggctaagctagctagcga cgcatagctgcgatcgagcgatcgactgagctcgcgg Result: The transposon has jumped, but functional gene is not disrupted. No mutation occurs.

27 RED: FUNCTIONAL GENE. BLUE: TRANSPOSON BLACK: NON-CODING (JUNK) DNA aaattatttcggctatcgatcgatacgatacgatcgctagctag cggctaacgcatagctgcgatcgagcgatcgactgagctcg cggaaattatttcggctatcgatcgatacgatacgatcgctag ctagcggctaagctagctagcgacgcatagctgcgatcgag cgatcgactgagctcgcggaaattatttcggctatcgatcgat acgatacgatcgctagctagcggctaagctagctagcgacg catagctgcgatcgagcgatcgactgagctcgcggaaattat ttcggctatcgatcgatacggctagctagcgaatacgatcgct agctagcggctaagctagctagcgacgcatagctgcgatcg agcgatcgactgagctcgcggaaattatttcggctatcgatcg atacgatacgatcgctagctagcggctaagctagctagcga cgcatagctgcgatcgagcgatcgactgagctcgcgg Result: The transposon has jumped and disrupted the functional gene. The gene can no longer be translated correctly. A mutation has occurred