Application Note Detecting low copy numbers. Introduction. Methods A08-005B

Size: px

Start display at page:

Download "Application Note Detecting low copy numbers. Introduction. Methods A08-005B"

Rachel Bates
6 years ago
Views:

However all qpcr instruments should theoretically be able to detect a single copy of target amplified at 100% efficiency within 40 cycles.

1 Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template in a reaction due to non-specific events which may limit the sensitivity of the assay. However all qpcr instruments should theoretically be able to detect a single copy of target amplified at 100% efficiency within 40 cycles. This is the point at which the copy is amplified to such an extent that the fluorescent signal produced by the product exceeds the detection threshold of the instrument and can be determined above the background of the no template control samples. Methods In order to determine as accurately as possible the copy number of the sample, a template of known size was quantified using a sensitive fluorimetric assay. The template used was Lambda phage DNA (Promega, part code D150A) which has a genome size of bp. The number of copies of template can be calculated using the following formula: DNA (copies) = x (copies mol -1 ) x DNA amount (g) DNA length (bp) x 660 (g mol -1 bp -1 ) Therefore, each µg of Lambda DNA contains 1.88 x copies of the genome. The standard DNA was diluted in TE buffer to give a solution of 0.1ng/µl. A suitable fluorescent intercalating dye solution was also diluted in TE buffer to give a 2x solution. Various volumes of standard or sample were pipetted into wells of a 96-well PCR plate together with the indicated amounts of TE buffer and dye solution to give a range of standards ranging from 0 to 10ng DNA. The plate was sealed and the fluorescence measured in PrimeQ at 50 C. Each standard and sample was prepared in triplicate and the fluorescence read 10 times. DNA (ng) Vol. 0.1ng/µl standard (µl) Vol. TE (µl) Vol. 2x fluorescent dye (µl) UNK UNK Table 1: Preparation of standards and samples for quantification. A standard curve was constructed from the fluorescence values of the standards and used to calculate the concentration of the unknown Lambda DNA samples. PCR Lambda template DNA 10x primer mix GoTaq QPCR Master Mix (2x) (Promega, part code A6001) Nuclease-free water PrimeQHelp@bibby-scientific.com +44(01785)

2 The primers were designed using Primer-BLAST (1) to amplify a 155bp target of the Lambda DNA. Details of the primers are given in Table 2. Primer name Sequence (5-3 ) Product length (bp) Final conc. in assay Tm used Lambda 15 For TGCTGCCCTGCTGACGCTTC 0.3µM C Lambda 15 Rev GTGCAGACAGCTGGCGACGT 0.3µM Table 2: Lambda primers. The template concentration was adjusted to 0.2x10 7 copies/µl (5µl = 1x10 7 copies) based on the results of the fluorimetric assay and using the formula above to calculate the copy number. This was then serially diluted in 1 in 10 in nuclease-free water until reaching 0.2 copies/µl (5µl = 1 copy). Four separate master mixes were prepared, each sufficient for 12 replicates at each of 100 copies, 10 copies and 1 copy per well of the template DNA and 12 replicates of NTCs. 20µl reactions were used. The samples were amplified according to the thermal cycling program shown in Table 3. Stage Number of Cycles Step Temp Time Read/Filter Enzyme Activation 1 95 C 2 min Denaturation 94 C 15 sec Amplification 50 Anneal 65 C 20 sec Extend 72 C 20 sec FC02, FC04, Ramp 31 (0.5 C intervals) Ramp C 10 sec FC02 Table 3: Thermal cycling program for the Lambda qpcr assay. Following real-time PCR collection of data, the samples were run on 2% agarose gels to confirm the presence or absence of PCR products. Results The concentration of the Lambda phage DNA was determined using a quantitative fluorimetric assay. Standards and samples were read in a PCR plate using PrimeQ as a plate reader to obtain the fluorescence values. The standard curve is shown in Figure 1. Using this curve the concentration of Lambda DNA was determined and the number of copies calculated using the formula described above. DNA standard curve RFU y = x R² = ng DNA Figure 1: Fluorescence assay DNA standard curve. The fluorescence was measured by addition of intercalating dye solution to the standard DNA and detected in PrimeQ. Values are the average of triplicates, each read 10 times. Twelve replicates of 100 copies, 10 copies and 1 copy per well of the template DNA were subjected to 50 cycles of PCR. The real-time amplification curves and dissociation are shown in Figure 2. The amplification curves show that all the 100 and 10 copies per well samples amplified, with the 100 copies per well replicates all at very similar Cq values. Six of the 1 copy per well replicates amplified and the other six were negative, which is to be expected on PrimeQHelp@bibby-scientific.com +44(01785)

3 A08-005B: Detecting low copy numbers the chance that a single copy will be present or absent in the well. Melting analysis of all the single copy replicates which did amplify indicated that these all had the same melting temperature (Tm) as the other samples. Some of the no template control (NTC) samples also showed some amplification. On studying the dissociation curves, the Tm of the peaks shown by the NTC products were either around 81.5 C or 89.4 C compared to 86.8 C of the positive samples. Therefore the amplification in the NTC samples was not contamination but rather some unidentified non-specific product(s) which were not amplified in any of the other samples. Figure 2: Amplification and dissociation curves for each of the Lambda DNA PCRs. The amplification curves are shown from cycle 20. Red = 100 copies/well; Green = 10 copies/well; Yellow = 1 copy/well; Blue = no template controls (NTC). The dissociation curves show product melting at 86.8 C together with non-specific products in the NTCs at 81.5 C or 89.4 C. To clarify the real-time fluorescence results, the samples were run on agarose gels to visualise the PCR products and these are shown in Figure 3. Figure 3: Gel analysis of the PCR products. Each gel shows the 12 replicates for each of the four master mixes containing none (NTC), 1 copy/well, 10 copies/well or 100 copies/well. The banding pattern corresponded exactly with the fluorescence amplification curves. The two NTC samples which gave a product with a high Tm, A1 and A4, gave a band which appeared on the gel to be slightly larger in size than the bands from the positive samples. Without further analysis it is uncertain what this product is. The very low PrimeQHelp@bibby-scientific.com +44(01785)

4 molecular weight bands in the other NTCs corresponded to the samples which gave the product with the low Tm value. These are most likely to be non-specific primer-dimer products. To determine the certainty with which it was possible to distinguish replicates containing a single copy of the Lambda DNA from replicates containing higher numbers of copies, the average and SDs of the Cq values for each replicate group were determined and are shown in Figure Average Cq Cq value Template copies per well Figure 4: Average Cq data for each replicate group plotted on a bar graph showing 1 SD error bars. A Student s t-test was performed to determine the significance between the results. The t-test compares the actual difference between the means of two sets of data in relation to the variation in the data expressed as the standard deviation of the difference between the means (2). Calculated results are shown in Table 4. Copies per well Average Cq SD t (9), p t (16), p t (22), p , < , < , < Table 4: Average Cq and SD for each of the replicate groups. A Student s t-test (2, 3) performed on neighbouring replicate groups indicates that the differences between the paired sets of samples are "very highly significant" with probability, p (of the difference being due to chance) <0.001 for each pair tested. The results indicate that the average Cq values from each replicate group are significantly different from each other. Conclusions The determination of initial copy number was based on a sensitive fluorimetric DNA assay using a purchased standard DNA and the copy number calculated using the molecular weight of the Lambda DNA template. The quantitative PCR results reflect what would be expected by diluting this DNA down to a theoretical single copy per reaction. Amplification of low copy numbers generally involves increasing the number of cycling steps and this, together with the lack of competition from target template in the reaction can increase the chance that products will be amplified in the NTC samples. Tm analysis can help to identify whether any NTC products are due to contamination, primer dimer amplification or non-specific amplification. The limit of detection (LOD) of qpcr assays is often determined by stochastic effects such as reaction efficiency and whether or not non-specific products are formed. The LOD is defined as the lowest concentration at which 95% of the positive samples are detected (4). In the tests performed here, the LOD would be below 10 copies per reaction since 100% of the 10 copies per well samples amplified. The lowest theoretical LOD per PCR is 3 copies; this PrimeQHelp@bibby-scientific.com +44(01785)

5 assumes a Poisson distribution of positive and negative results, a 95% chance of including at least 1 copy in the PCR and single-copy detection (4). The Poisson distribution predicts that in a large number of replicates containing an average of one copy of starting template, about 37% should actually have no copies, about 37% should contain one copy and about 18% should contain two copies (5). In the assay described in this application note, 50% of the single copy per well reactions amplified which may indicate slightly more than 1 copy per well on average. References (1) (2) (3) (4) Bustin SA, Benes V, et al. (2009) The MIQE Guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem, 55(4): (5) Profiling/PDFs.Par File.dat/Understanding%20Ct%20Application%20Note.pdf. Trademarks GoTaq is a registered trademark of Promega Corporation. PrimeQHelp@bibby-scientific.com +44(01785)

Guidelines for Developing Robust and Reliable PCR Assays

Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay