Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
|
|
- Bryan Bradley
- 6 years ago
- Views:
Transcription
1 Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof.,
2 Deoxyribonucleic Acid DNA Groton Public Schools Space-filling model of the DNA double helix. James D. Watson and Francis Crick, who discovered the structure of DNA in 1953.
3 Chromosomes & Genes Chromosome 1 Access the National Health Museum (left) National Center for Biotechnology Information (right)
4 Eukaryotic Gene Regulation Evolution-textbook.org; Modified from Seet, BT et al. Nat. Rev. Mol. Cell. Biol. 7: , 2006
5 Overview of Compounds Studied Casado-Vela, J. Screening of protein-protein and protein-dna interactions using microarrays: applications in biomedicine. Advances in Protein Chemistry and Structural Biology, Volume 95, 2014
6 DNA Microarrays Images courtesy of Affymetrix
7 Array Structure Images courtesy of Affymetrix
8 Capability Measurement of tens of thousands of genes at a time. It is possible to obtain near-comprehensive expression data for individual, tissues, or organs in various states. Comparisons are possible for transcriptional activity across different tissues in the same organism, across neighboring cells of different types in the same tissue, across groups of patients with and without a particular disease or with two different diseases. Direct measurement of the activity of the genes involved in a particular mechanism or system.
9 Formats Microarray analysis allows simultaneous study of genes and gene products, including DNA, mrna and proteins. There are basically two formats: cdna microarrays (clone-based): A cdna microarray is an orderly arrangement of spots of cdna clones (from a library) printed onto a solid matrix such as glass, nylon or silicon. Oligonucleotide-based microarrays : Photolithographic in situ synthesis. Used for gene expression, genotyping (single nucleotide polymorphisms or SNPs), and resequencing.
10 Resequencing The Resequencing Array is used for identifying DNA in a sample. Resequencing means that when the DNA is sequenced, it can be compared with an already established sequence database for the DNA of interest. The probes that are used are made of segments of DNA 25 bases long, but the probes are used to basically sequence the DNA in the sample rather than identify a specific RNA or SNP.
11 Gene Expression Gene expression microarrays are tools that tell how much RNA (if any) a gene is making. They use the natural chemical attraction, or hybridization, between DNA on the array and RNA target molecules from the sample based on complimentary base pairs. Only RNA target molecules that have exact complementary base pairs will bind to the probes. Microarrays can measure the expression of every known human gene.
12 Single Nucleotide Polymorphisms Small differences in a DNA sequence can have major impact on health. Using microarrays, it is possible to scan the whole genome and look for genetic similarities among a group of people who share the same disease. A genotyping microarray may look for up to 100,000 SNPs or more. DNA samples from the patient may be obtained from any biological sample, since DNA is the same in all cells of the body (unlike the RNA sampling for gene expression).
13 Oligonucleotide Microarray Methodology RNA is extracted from a sample using PCR, allowing it to be more easily detected on the array. When the RNA is copied, biotin caps are attached to each strand that will later act to bind fluorescent molecules that are washed over the array. Note that different cells in the body have different amounts of RNA.
14 Hybridization The sample is washed over the array for hours to allow hybridization to occur. This process allows the chemical bonding of the DNA probes with the matching RNA fragment. Images courtesy of Affymetrix
15 Fluorescence Measurement The amount of fluorescence in a given feature correlates with the amount of RNA that was present in the original sample. If there is no fluorescence over a feature, then there is no matching RNA present. Lighter areas represent increased expression. Image courtesy of Affymetrix
16 Output The Affymetrix Scanner work station and GeneChip Array output is data from an experiment showing the expression of thousands of genes on a single GeneChip: Images courtesy of Affymetrix
17 Fabrication of Microarrays Images courtesy of Affymetrix
18 Silanation of Silicon Surface Image courtesy of Affymetrix
19 Probe Synthesis Images courtesy of Affymetrix
20 Inspection, Dicing and Packaging Images courtesy of Affymetrix
21 Polymerase Chain Reaction An in vitro method of replicating small DNA sequences into millions of copies over a short period of time. Nanomolar quantities of DNA can be replicated within a few hours. PCR may be used for genetic testing in disease diagnosis, monitoring response to treatment, and tissue typing. A typical PCR requires: Two oligonucleotide primers; A thermally stable DNA polymerase; Supply of free nucleotides; and A small amount of DNA sample that contains the sequence of interest. The DNA fragment of interest must be known, so that short DNA primer fragments can be synthesized in advance, and are complimentary to the 3 end of each sample stand.
22 Denaturing and Annealing Steps A. Desired sequence or target region to amplify. B. Denaturing by heating 95 C C. Annealing by cooling to 60 C, and binding of primers. Carey, FA, Advanced Organic Chemistry 5 th Ed., 2002
23 Synthesis and Denaturing D. End of Cycle 1 The primer is extended in its 3 direction as it adds nucleotides that are complementary to the original DNA strand. E. Denature again and prime. Carey, FA, Advanced Organic Chemistry 5 th Ed., 2002
24 Elongation and Sequence Amplification F. Elongation of the primed polynucleotide fragments completes the second cycle and gives 4 DNAs. End of Cycle 2 G. Among the eight DNAs formed in the third cycle are two having the structure shown. This structure increases disproportionately in the succeeding cycles. Carey, FA, Advanced Organic Chemistry 5 th Ed., 2002
25 DNA Amplification Results Cycle Number Total Number of DNAs Number of DNAs Containing Only the Target Region ,024 1, ,048,566 1,048, ,073,741,824 1,073,741,746 Carey, FA, Advanced Organic Chemistry 5 th Ed., 2002
26 A CMOS IC qpcr LOC for POC Norian, H. et al., An integrated CMOS qualitative-polymerasechain-reaction lab-on-a-chip for point-of-care diagnostics Lab Chip, 2014, 14,
27 Utilizes a Single-Photon Avalanche Diode The cross-section of a SPAD CMOS sensor Albert H. Titus, et al. CMOS Photodetectors in Photodiodes - World Activities in Ed. by Park, JW, pub. by InTech, 2011.
28 Heaters and Sensors Norian, H. et al., An integrated CMOS qualitative-polymerasechain-reaction lab-on-a-chip for point-of-care diagnostics Lab Chip, 2014, 14,
29 Fully Encapsulated PCR Chip Norian, H. et al., An integrated CMOS qualitative-polymerasechain-reaction lab-on-a-chip for point-of-care diagnostics Lab Chip, 2014, 14,
30 qpcr Thermal Cycling Profile Norian, H. et al., An integrated CMOS qualitative-polymerasechain-reaction lab-on-a-chip for point-of-care diagnostics Lab Chip, 2014, 14,
31 Characterization of the SPAD Norian, H. et al., An integrated CMOS qualitative-polymerasechain-reaction lab-on-a-chip for point-of-care diagnostics Lab Chip, 2014, 14,
32 Real-Time Quantitative PCR Data Norian, H. et al., An integrated CMOS qualitative-polymerasechain-reaction lab-on-a-chip for point-of-care diagnostics Lab Chip, 2014, 14,
33 A PCR + Microarray Device Petralia, S et al., In-Check system: a highly integrated silicon lab-on-chip for sample preparation, PCR amplification and microarray detection of nucleic acids directly from biological samples. Sensors and Actuators B 187 (2013)
34 Lab-on-a-Chip Cross-Section Petralia, S et al., In-Check system: a highly integrated silicon lab-on-chip for sample preparation, PCR amplification and microarray detection of nucleic acids directly from biological samples. Sensors and Actuators B 187 (2013)
35 Process Petralia, S et al., In-Check system: a highly integrated silicon lab-on-chip for sample preparation, PCR amplification and microarray detection of nucleic acids directly from biological samples. Sensors and Actuators B 187 (2013)
36 Summary (1) Chromosomes, genes and gene regulation. (2) DNA Microarrays (3) Methodology (4) Fabrication (5) Polymerase Chain Reaction (6) A CMOS IC qpcr LOC for POC (7) A PCR + Microarray Device
Deoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationProteomics and Protein Microarrays
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationBiotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationHuman Genomics. 1 P a g e
Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationHuman Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationAppendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationUnit 3c. Microbial Gene0cs
Unit 3c Microbial Gene0cs Microbial Genetics! Gene0cs: the science of heredity Genome: the gene0c informa0on in the cell Genomics: the sequencing and molecular characteriza0on of genomes Gregor Mendel
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationPolymerase chain reaction
Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain
More informationZoo-342 Molecular biology Lecture 2. DNA replication
Zoo-342 Molecular biology Lecture 2 DNA replication DNA replication DNA replication is the process in which one doubled-stranded DNA molecule is used to create two double-stranded molecules with identical
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationCovalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.
Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested
More informationSTSs and ESTs. Sequence-Tagged Site: short, unique sequence Expressed Sequence Tag: short, unique sequence from a coding region
STSs and ESTs Sequence-Tagged Site: short, unique sequence Expressed Sequence Tag: short, unique sequence from a coding region 1991: 609 ESTs [Adams et al.] June 2000: 4.6 million in dbest Genome sequencing
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationBIO 311C Spring Lecture 34 Friday 23 Apr.
BIO 311C Spring 2010 1 Lecture 34 Friday 23 Apr. Summary of DNA Replication in Prokaryotes origin of replication initial double helix origin of replication new growing polynucleotide chains Circular molecule
More information7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes
Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationDNA and genetic information
DNA and genetic information DNA carries plans for the primary structure of nucleic acids (DNA, RNA) and proteins. DNA of single cell has capacity over 1 million pages of text (900 copies of our textbook!)
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationPolymerase Chain Reaction-361 BCH
Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More informationChapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Genetics Genome Chromosome Gene Protein Genotype Phenotype 2 Terms and concepts gene Fundamental unit of heredity
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationExperiment (5): Polymerase Chain Reaction (PCR)
BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationThe Structure of DNA
The Structure of DNA Questions to Ponder 1) How is the genetic info copied? 2) How does DNA store the genetic information? 3) How is the genetic info passed from generation to generation? The Structure
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationAppendix A. Introduction to PCR
Appendix A Introduction to PR In 1983, Kary Mullis at etus orporation developed the molecular biology technique that has since revolutionized genetic research, earning him the Nobel Prize in 1993. This
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationProposed Models of DNA Replication. Conservative Model. Semi-Conservative Model. Dispersive model
5.2 DNA Replication Cell Cycle Life cycle of a cell Cells can reproduce Daughter cells receive an exact copy of DNA from parent cell DNA replication happens during the S phase Proposed Models of DNA Replication
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More information