BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
|
|
- Alison Stone
- 6 years ago
- Views:
Transcription
1 BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1
2 PC recap
3 typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15% Indels <0.1% Structural variants ~20 million bp affected Includes ~1000 large deletions ~150 copy number variants ~10 inversions global reference for human genetic variation, The 1000 Genomes Project Consortium, Nature (2015)
4 Pie area indicates the number of polymorphisms within populations
5 Decline in genome sequencing costs First generation sequencers Second (next) generation sequencers Wetterstrand K. DN Sequencing Costs: Data from the NHGRI Genome Sequencing Program (GSP) vailable at: ccessed Nov 14, 2017
6 Short reads: ~50-300bp per read Illumina sequencing
7 Illumina sequencing Illumina
8 DN adapters 1. Prepare genomic DN 2. ttach DN to surface 3. Bridge amplification 4. Fragments become double stranded 5. Denature the doublestranded molecules 6. Complete amplification Randomly fragment genomic DN and ligate adapters to both ends of the fragments pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
9 adapter DN fragment 1. Prepare genomic DN adapter dense lawn of primers 2. ttach DN to surface 3. Bridge amplification 4. Fragments become double stranded 5. Denature the doublestranded molecules 6. Complete amplification pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
10 1. Prepare genomic DN 2. ttach DN to surface 3. Bridge amplification 4. Fragments become double stranded 5. Denature the doublestranded molecules 6. Complete amplification pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
11 1. Prepare genomic DN 2. ttach DN to surface ttached terminus free terminus ttached terminus 3. Bridge amplification 4. Fragments become double stranded 5. Denature the doublestranded molecules 6. Complete amplification pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
12 ttached ttached 1. Prepare genomic DN 2. ttach DN to surface 3. Bridge amplification 4. Fragments become double stranded 5. Denature the doublestranded molecules 6. Complete amplification Denaturation leaves singlestranded templates anchored to the substrate pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
13 1. Prepare genomic DN 2. ttach DN to surface 3. Bridge amplification 4. Fragments become double stranded Clusters 5. Denature the doublestranded molecules 6. Complete amplification Several million dense clusters of double-stranded DN are generated in each channel of the flow cell pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
14 7. Determine first base 8. Image first base 9. Determine second base 10. Image second chemistry cycle 11. Sequencing over multiple chemistry cycles Laser 12. lign data The first sequencing cycle begins by adding four labeled reversible terminators, primers, and DN polymerase pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
15 7. Determine first base 8. Image first base 9. Determine second base 10. Image second chemistry cycle 11. Sequencing over multiple chemistry cycles 12. lign data fter laser excitation, the emitted fluorescence from each cluster is captured and the first base is identified pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
16 7. Determine first base 8. Image first base 9. Determine second base 10. Image second chemistry cycle 11. Sequencing over multiple chemistry cycles Laser 12. lign data The next cycle repeats the incorporation of four labeled reversible terminators, primers, and DN polymerase pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
17 7. Determine first base 8. Image first base 9. Determine second base 10. Image second chemistry cycle 11. Sequencing over multiple chemistry cycles 12. lign data fter laser excitation the image is captured as before, and the identity of the second base is recorded. pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
18 7. Determine first base 8. Image first base 9. Determine second base 10. Image second chemistry cycle 11. Sequencing over multiple chemistry cycles 12. lign data The sequencing cycles are repeated to determine the sequence of bases in a fragment, one base at a time. pevsnerlab.kennedykrieger.org/wiley/3e/chapter9/bfg_chapter09_ngs_v04.pptx
19 FSTQ format Raw sequencing reads: Basecalls and quality scores 4 lines per read Read ID Sequence Base quality } GCCTTGGCCTCCCGCTGCTGGGTT + } TGTCTGTCCTCTCTGGTCTTGCCGT + FFFFJJFJJJJJJJJJJJJJJJJJJJ Read 1 Read 2
20 FSTQ quality scores The FSTQ format uses Phred quality scores: a logarithmic function of base calling error (Pe) Q PHRED = 10 log 10 (P e )
21 FSTQ quality scores Stored as single SCII characters: GCCTTGGCCTCCCGCTGCTGGGTT + #FFFJJJJJJFJJJJJJJJJJJJJJJJ
22 ssembly vs lignment If no reference genome exists, assembly is required For most well-studied organisms, especially humans, high quality references do exist and we can instead align reads to the reference genome The current human reference is Genome Reference Consortium Human Build 38 (GRCh38) Simplified genome assembly Step 1 Step 2
23 Mapping/ligning reads to the reference genome Reference genome sequence Depth 100 bp Unknown sequence 100 bp Source: Wikimedia, file:mapping Reads.png
24 Visualizing reads aligned to a reference genome Non-reference variant Non-reference variant Integrative Genomics Viewer (IGV)
25 How to map reads to a reference genome? Comparing every read with every position in the genome is problematic: Very slow Won t allow for even slight mismatches Instead, we create an index of the reference genome sequence Index lookups are much faster than whole text search n example index:
26 SM/BM SM: Sequence lignment/map format. plain text file that contains reads, mapping positions, quality scores Read ID Chromosome Position (bp) Mapping quality BM: binary version of SM
27 Causes for mismatches between reads and the reference real variant Sequencing library generation error (i.e. error in amplifying original genomic DN) Base call error Mapping error (i.e. the read belongs somewhere else in the reference genome) Reference genome sequence error
28 How do we call SNPs? Heuristic methods based on hard thresholds: Reference T T T G= G=T G=?
29 SNP calling: Probabilistic methods We want to estimate the probability of each genotype, G, given the read data, D. P (G D) In this case: D =[T ] Let s consider: P (G = D) P (G = T D) (The other genotypes are very unlikely) T G=?
30 SNP calling: Probabilistic methods Use Bayes rule: Prior probability of genotype (e.g. use HWE) P (G D) = P (G, D) P (D) = P (D G)P (G) P (D) = P (D G)P (G) P i P (D G i)p (G i ) First assume no errors in reads: So: P (D G = ) =0 P (D G = T )= D =[T ] P (G = T D) = P (D G = T ) P (D G = T )+P (D G = ) =1 T G=?
31 SNP calling: Probabilistic methods Now let s allow for 1% sequencing error The probability of observing a given base is: Probability that base was present in the read and sequenced correctly plus the probability that another base was present but sequenced incorrectly. D =[T ] T G=?
32 SNP calling: Probabilistic methods Now let s allow for 1% sequencing error P (D G = ) = s 1 T P (D G = T )=5 ( ) 4 ( ) 0.16 So: P(real base is ) P (G = T D) P(correctly called) P(real base is T) =0.76 P(incorrectly called) D =[T ] T G=?
33 Importance of base quality scores Recall, FSTQ format: Pe=0.63 GCCTTGGCCTCCCGCTGCTGGGTTCGGCGTG + F#FJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJ Proprietary algorithms
34 Base Quality Score Recalibration Empirically adjust base quality scores based on actual observed error rates ssume non-reference bases in reads that are not present in dbsnp are errors Stratify by base position in read. Calculate adjustment as: - verage reported phred score, minus - verage empirical phred score lso stratify by other covariates: reference base, neighbor bases, reported quality score,
35 Calling structural variants e.g. Deletions: 4 types of evidence Denovo Read pairs too far apart SV class ssembly assembly Read pair Read depth Shallow read Split reads Split end Ref mapping Deletion Reads Contig ssemble lkan et al., Genome structural variation discovery and genotyping. Nat Rev Genet. May;12(5): (2011)
36 Variant Call Format (VCF) files ~100,000 rows per exome ~4 million rows per whole genome Used to generate per variant genotype counts for association testing
C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
More informationLecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
More informationData Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
More informationGenome 373: Mapping Short Sequence Reads II. Doug Fowler
Genome 373: Mapping Short Sequence Reads II Doug Fowler The final Will be in this room on June 6 th at 8:30a Will be focused on the second half of the course, but will include material from the first half
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationCSCI2950-C DNA Sequencing and Fragment Assembly
CSCI2950-C DNA Sequencing and Fragment Assembly Lecture 2: Sept. 7, 2010 http://cs.brown.edu/courses/csci2950-c/ DNA sequencing How we obtain the sequence of nucleotides of a species 5 3 ACGTGACTGAGGACCGTG
More informationAnalysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah
Analysis of structural variation Alistair Ward USTAR Center for Genetic Discovery University of Utah What is structural variation? What differentiates SV from short variants? What are the major SV types?
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationChapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationIllumina Sequencing Overview
Illumina Sequencing Overview Part # 15045845_Rev.C 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cbot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic
More informationThe Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,
More informationWhole Human Genome Sequencing Report This is a technical summary report for PG DNA
Whole Human Genome Sequencing Report This is a technical summary report for PG0002601-DNA Physician and Patient Information Physician name: Vinodh Naraynan Address: Suite 406 222 West Thomas Road Phoenix
More informationVariant Callers. J Fass 24 August 2017
Variant Callers J Fass 24 August 2017 Variant Types Caller Consistency Pabinger (2014) Briefings Bioinformatics 15:256 Freebayes Bayesian haplotype caller that can call SNPs, short CNVs / duplications,
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationAnalysis of structural variation. Alistair Ward - Boston College
Analysis of structural variation Alistair Ward - Boston College What is structural variation? What differentiates SV from short variants? What are the major SV types? Summary of MEI detection What is an
More informationQuality assurance in NGS (diagnostics)
Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product
More informationNextGen Sequencing Technologies Sequencing overview
Outline Conventional NextGen High-throughput sequencing (Next-Gen sequencing) technologies. Illumina sequencing in detail. Quality control. Sequence coverage. Multiplexing. FASTQ files. Shendure and Ji
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationDATA FORMATS AND QUALITY CONTROL
HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationVariant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016
Variant Finding UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Types of Variants Adapted from Alkan et al, Nature Reviews Genetics 2011 Why Look For Variants? Genotyping Correlation with
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationSequencing techniques
Sequencing techniques Workshop on Whole Genome Sequencing and Analysis, 2-4 Oct. 2017 Learning objective: After this lecture, you should be able to account for different techniques for whole genome sequencing
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Read Complexity
Supplementary Figure 1 Read Complexity A) Density plot showing the percentage of read length masked by the dust program, which identifies low-complexity sequence (simple repeats). Scrappie outputs a significantly
More informationComparing a few SNP calling algorithms using low-coverage sequencing data
Yu and Sun BMC Bioinformatics 2013, 14:274 RESEARCH ARTICLE Open Access Comparing a few SNP calling algorithms using low-coverage sequencing data Xiaoqing Yu 1 and Shuying Sun 1,2* Abstract Background:
More informationDipping into Guacamole. Tim O Donnell & Ryan Williams NYC Big Data Genetics Meetup Aug 11, 2016
Dipping into uacamole Tim O Donnell & Ryan Williams NYC Big Data enetics Meetup ug 11, 2016 Who we are: Hammer Lab Computational lab in the department of enetics and enomic Sciences at Mount Sinai Principal
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationPrioritization: from vcf to finding the causative gene
Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for
More informationChang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang
Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John
More informationWhole Genome Sequencing. Biostatistics 666
Whole Genome Sequencing Biostatistics 666 Genomewide Association Studies Survey 500,000 SNPs in a large sample An effective way to skim the genome and find common variants associated with a trait of interest
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationNormal-Tumor Comparison using Next-Generation Sequencing Data
Normal-Tumor Comparison using Next-Generation Sequencing Data Chun Li Vanderbilt University Taichung, March 16, 2011 Next-Generation Sequencing First-generation (Sanger sequencing): 115 kb per day per
More informationOverview of Next Generation Sequencing technologies. Céline Keime
Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationWe begin with a high-level overview of sequencing. There are three stages in this process.
Lecture 11 Sequence Assembly February 10, 1998 Lecturer: Phil Green Notes: Kavita Garg 11.1. Introduction This is the first of two lectures by Phil Green on Sequence Assembly. Yeast and some of the bacterial
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationDNA Sequencing and Assembly
DNA Sequencing and Assembly CS 262 Lecture Notes, Winter 2016 February 2nd, 2016 Scribe: Mark Berger Abstract In this lecture, we survey a variety of different sequencing technologies, including their
More informationDNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.
DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationSEQUENCING. M Ataei, PhD. Feb 2016
CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,
More information4. Analysing genes II Isolate mutants*
.. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationNext Generation Sequencing. Tobias Österlund
Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationAssignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationGenomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
More informationFunctional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationVariant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD
Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Type Alkan et al, Nature Reviews Genetics 2011 doi:10.1038/nrg2958 Variant Type http://www.broadinstitute.org/education/glossary/snp
More informationBST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1
BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio
More informationThe goal of this project was to prepare the DEUG contig which covers the
Prakash 1 Jaya Prakash Dr. Elgin, Dr. Shaffer Biology 434W 10 February 2017 Finishing of DEUG4927010 Abstract The goal of this project was to prepare the DEUG4927010 contig which covers the terminal 99,279
More informationRead Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 QA&I should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical
More informationStructural variation analysis using NGS sequencing
Structural variation analysis using NGS sequencing Victor Guryev NBIC NGS taskforce meeting April 15th, 2011 Scale of genomic variants Scale 1 bp 10 bp 100 bp 1 kb 10 kb 100 kb 1 Mb Variants SNPs Short
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationFrequently asked questions
Frequently asked questions Affymetrix Mouse Diversity Genotyping Array The Affymetrix Mouse Diversity Genotyping Array features more than 623,000 single nucleotide polymorphisms (SNPs) and more than 916,000
More informationRADseq Data Analysis Workshop 3 February 2017
RADseq Data Analysis Workshop 3 February 2017 Introduction to Galaxy (thanks to Simon Gladman for slides) What is Galaxy? A web-based scalable workflow platform for genomic analysis Designed for biologists
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationGenome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression
Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing
More informationCourse summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.
Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, March 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 1: Introduction into high-throughput
More informationyou can see that if if you look into the you know the capability kilobases per day, per machine kind of calculation if you do.
Functional Genomics Professor S Ganesh Department of Biological Sciences & Bioengineering Indian Institute of Technology Kanpur Lecture No 11 DNA Sequencing Methods Part 2 So welcome back to this course
More informationGet to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
More informationVariant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012
+ Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools
More informationSupplementary Information for:
Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationGenome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall
Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with
More informationA Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationAaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop
Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10
More information14 March, 2016: Introduction to Genomics
14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser
More information