AP Biology. Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA. Investigation 9: Restriction Enzyme Analysis
|
|
- Gwenda Horton
- 6 years ago
- Views:
Transcription
1 AP Biology Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA In this investigation, you will learn how to use restriction Learning Objectives enzymes and gel electrophoresis to create genetic profiles. You will use these profiles to help narrow the list of suspects in the hypothetical crime. Pearson Education, Inc., publishing as Person Benjamin Cummings College Board, AP Biology Curriculum Framework Copyright Rebecca Rehder Wingerden PreLab: Complete Bozeman Science- Molecular Biology Questions in CompBook (handout online) - PreLab: Complete Activity - A Process To Dye For: Gel Electrophoresis in CompBook (handout) - Read Introduction, Background & Experimental Overview - Complete Pre-Lab Activity 1- (# is a Table 1) - Copy Gel Drawing Worksheet (Figure 1) Lab: Complete Procedure steps 1-11 and collect data & draw gel BozemanScience.com: AP Biology Lab 6 - Molecular Biology (9:00 min.) Post Lab: Complete Post-Lab Questions 1-10
2 Electrophoresis Equipment Electrophoresis - Loading the Gel - Buffer Cathode Dyes Agarose gel Anode + Power supply and chamber- a source of negatively charged particles with a cathode and anode Buffer- a fluid mixture of water and ions Agarose gel- a porous material the DNA migrates through DNA ladder- mixture of DNA fragments of known lengths Loading dye- contains a dense material and allows visualization of DNA migration DNA Stain- allows visualization of DNA fragments after electrophoresis Power Supply Analysis: Collect data to complete Table 1: Gel Electrophorese Complete Fig. 1 Gel Drawing Table 1: Gel Electrophoresis Dye Name Dye Well # Malachite Green 1 Orange G 2 Safranin O 3 Alizarin Red S m-cresol Purple Migration Migration Direction (+/-) Dye Molecules Speed Ranking Unknown Sample letter? NA NA NA Post Lab: Complete Post-Lab Questions 1-10 Figure 1: Gel Drawing ? - + +
3 Background DNA Restriction enzymes found naturally in bacteria, can be used to cut DNA fragments at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary (sticky) ends. More than 200 restriction enzymes now available commercially, they are named after the bacterium in which they were first identified: - EcoRI was the first enzyme isolated from Escherichia coli - HindIII was the third enzyme isolated for Haemophilus influenzae (restriction enzyme we will be using in DNA Forensic Lab) How do restriction enzymes work? Each restriction enzyme digest (cuts) DNA at a specific sequence, called the restriction site. Sticky Ends - ligation is very specific Eco RI GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCA CCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGT GGCCTGCG AATTCCCGATCGAAGGCCCG AATTCTGGCCA CCGGACGCTTAA GGGCTAGCTTCCGGGCTTAA GACCGGT Blunt Ends - ligation is non-specific Hae III GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCA CCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGT GG CCTGCGAATTCCCGATCGAAGG CCCGAATTCTGG CCA CC GGACGCTTAAGGGCTAGCTTCC GGGCTTAAGACC GGT How do we visualize the DNA? Agarose Gel Electrophoresis is a method of separating molecules in an electrical field based on their and charge; DNA has an overall negative charge Agarose gel acts as a sieve for separating DNA fragments; smaller fragments travel faster than large fragments Concentration of the agarose gel affects DNA migration - Low Concentration = larger pores -- better resolution of larger DNA fragments - Higher Concentration = smaller pores -- better resolution of smaller DNA fragments 1% agarose 2% agarose
4 Agarose Gel Forensic DNA Fingerprinting Restriction Enzymes A A G C T T T T C G A A HindIII (Hin D Three) restriction enzyme DNA Fragments Standard Lambda/HindIII CS S1 S2 S3 S S Molecules are separated based on their and charge. DNA has an overall negative charge. PreLab Complete the following before conducting this investigation: I. Read Investigation 9: Biotechnology: Restriction Enzyme Analysis of DNA II. Answer the following PreLab questions in your Comp Book: 1. Summarize what you will be doing in this investigation. 2. What is the primary question you will be trying to answer in this investigation? Inv. 9: Biotechnology: Restriction Enzyme Analysis of DNA PreLab - Getting Started: Define: Restriction Enzyme, PCR, RFLP, and Gel Electrophoresis Activity I: Restriction Enzyme 2Q p. S113-S11 Activity II: DNA Mapping Using Restriction Enzymes Q p. S11-S11 (Note: There are a total of questions in the 2 bullets.) Activity III: Basic Principle of Gel Electrophoresis 1Q p. S11
5 Forensic DNA Fingerprinting Procedure: Lesson 1 Restriction Digestion Steps 1-8 Pipet 10 µl of each DNA sample from the stock tubes and transfer to corresponding colored micro centrifuge tubes. Make sure the samples transferred to the bottom of the tubes. Forensic DNA Fingerprinting Procedure: Lesson 1 Restriction Digestion Steps 1-8 Using a fresh tip for each DNA sample, pipet 10 µl of ENZ into the bottom of each tube. DNA ENZ HindIII (Hin D Three) restriction enzyme CS S1 S2 S3 S S CS S1 S2 S3 S S Forensic DNA Fingerprinting Procedure: Lesson 1 Restriction Digestion Steps 1-8 Forensic DNA Fingerprinting Procedure: Lesson 2 Agarose Gel Electrophoresis Steps 7-9 Tightly cap the tubes and mix the components by gently flicking the tubes with your finger. Place tubes in your labeled floating micro-centrifuge tube rack and give to instructor. S CS S1 S2 S3 S S Using a separate tip for each sample, load 10 µl of Standard and 20 µl of digested DNA samples in to the correct wells of gel. CS S1 S2 S3 S S S CS S1 S2 S3 S S
6 Loading Dye - DNA samples are loaded using the dry method. Samples are loading into the wells using a micro pipet. The presence of dyes in the DNA samples allows visualization while running the gel. The dyes must not be allowed to run off the gel. Designing and Conducting Your Investigation: The Disappearance of Ms. Mason: Your task is to design and conduct a procedure based on DNA evidence to determine whose blood is spattered on the classroom floor. - Purpose: What is the goal of this investigation? - Hypothesis: If (rational for the investigation), then (outcome that you would expect). - Procedure: Steps outlining the lab techniques that you will complete to test your hypothesis (Include the following techniques in your procedure: PCR, RFLP, and gel electrophoresis.) - Data: Table 1: Electrophoresis Data: DNA Fingerprints of Five Suspects - Approval by Instructor Table 1: Electrophoresis Data: DNA Fingerprints of Five Suspects Band Lambda/ HindIII Size Standard 1 23, ,16 3 6,7,361 2, ,027 Crime Scene Suspect 1 Ms. Mason Suspect 2 Mr. Gladson Suspect 3 Bobby Suspect Unknown A Suspect Unknown B Designing and Conducting Your Investigation: - Evidence collected: Crime Scene DNA- blood spatter in classroom (SC) Ms. Mason s DNA- saliva on her coffee cup (S1) Mr. Gladson s DNA- tissue with which he wiped his nose (S2) Bobby s DNA- bubble gum (S3) Unknown A DNA- blond hair (S) Unknown B DNA- brown hair (S)
7 DNA Fragment Size (#bp) Analyzing and Evaluating Results: Complete Graph 1: Standard Curve ~ Lambda/ HindIII Size Standard Complete Table 1: Electrophoresis Data: DNA Fingerprints of Five Suspects Conclusion: Write a conclusion which takes into account the DNA results at the crime scene. Your conclusion should address who-dun-it by including motive, means, opportunity, and the DNA evidence found in Ms. Mason s classroom. Evaluating Results: #1-2 (p. S122) Thinking About Your Results: #1- (p. S123) Analyzing Results: Calculating the Sizes of Restriction Fragment Length Polymorphisms (p. S120) base pair length is substituted for molecular weight when determining the of DNA fragments. Creating the Standard Curve: - Graph 1: Standard Curve - Table 1: DNA Fragment - Migration mm mm 1.00 mm * For this ideal gel, assume that these two bands appear as a single band instead of resolving into separate bands. ** These bands do not appear on the ideal gel and likely will not be seen. Graph 1: Standard Curve ~ Lambda/ HindIII Size Standard i.e. band #1 is 23,130 bp and it migrated 11 mm i.e. band #2 is 916 bp and it migrated 13 mm i.e. band #3 is 67 bp and it migrated 1 mm x10, 000 x1,000 x NOTE: The first fragment is too large to migrate properly in agarose and will not fit within your line of best fit, and should be discarded Migrated Complete Activity- Restriction Enzyme Cleavage of DNA (EDVOTEK 112) PreLab - Read Background Information and Experimental Procedure (p. -9) Copy data tables: Table 1: DNA Marker Standard Table 2: Lambda DNA cut with EcoRI Table 3: Lambda DNA (UNcut) Figure 1: Lambda DNA cut with EcoRI
8 Complete Activity- Restriction Enzyme Cleavage of DNA (EDVOTEK 112) Complete Procedure steps 1-6 (p.9) Collect Data: Table 1: DNA Marker Standard Table 2: Lambda DNA cut with EcoRI Table 3: Lambda DNA (UNcut) Analysis: Graph: Size Determination of DNA Restriction Fragments (p.10) Answer Study Questions #1-2 (p. DNA Ladder - known quantities of DNA Lambda DNA Lambda DNA 12) Lambda DNA cut with EcoRI Table 1: DNA Marker Standard - Lane 1 Fragment Migrated Length 1 (top) NOTE: The first fragment is too large to migrate properly in agarose and will not fit within your line of best fit, and should be discarded. Table 2: Lambda DNA cut w/ Eco RI - Lane 2 Fragment Migrated Length Table 3: Lambda DNA (UNcut) - Lane 3 Fragment 1 Migrated Length Use the best fit line on your graph (Determination of Unknown DNA Fragment Size) to determine the length of the DNA fragments in lanes 2 and 3. Figure 1: Lambda DNA cut with EcoRI
9 #1 = 18mm #2 =? mm #3 =? mm Lane 1: DNA Marker Standard Table 1: DNA Marker Standard - Lane 1 Fragment Migrated Length 1 (top) ? mm 916 3? mm NOTE: The first fragment is too large to migrate properly in agarose and will not fit within your line of best fit, and should be discarded. Graph 1: Determination of Unknown DNA Fragment Size DNA Fragment Size (#bp) x10, 000 x1,000 #1 =? mm #2 =? mm #3 =? mm Lane 2: Lambda DNA cut w/ Eco RI i.e. fragment #2 is 916 bp and it migrated 23 mm x Migrated
10 Table 2: Lambda DNA cut w/ Eco RI - Lane 2 Fragment Migrated Length 1? mm 2? mm 3? mm 6 #1 =? mm Lane 3: Lambda DNA (UNcut) Table 3: Lambda DNA (UNcut) - Lane 3 Fragment Migrated Length 1? mm Use the best fit line on your graph (Determination of Unknown DNA Fragment Size) to determine the length of the DNA fragments in lanes 2 and 3. Complete Activity- Restriction Enzyme Cleavage of DNA (EDVOTEK 112) Complete Procedure steps 1-6 (p.9) Collect Data: Table 1: DNA Marker Standard Table 2: Lambda DNA cut with EcoRI Table 3: Lambda DNA (UNcut) Analysis: Graph: Size Determination of DNA Restriction Fragments (p.10) Answer Study Questions #1-2 (p. 12) DNA Ladder - known quantities of DNA Lambda DNA Lambda DNA Lambda DNA cut with EcoRI
AP Biology: Unit 5: Development. Forensic DNA Fingerprinting: Using Restriction Enzymes Bio-Rad DNA Fingerprinting Kit
Forensic DNA Fingerprinting: Using Restriction Enzymes Bio-Rad DNA Fingerprinting Kit Background: Scientists working in forensic labs are often asked to perform DNA profiling or fingerprinting to analyze
More informationObjectives Introduction restriction endonucleases Examples: Hind III: Eco RI: Pst I:
Objectives Before doing this lab you should understand how gel electrophoresis separates DNA molecules present in a mixture and how restriction endonucleases function. After doing this lab you should be
More informationGroup Members: Lab Station: BIOTECHNOLOGY: Gel Electrophoresis
BIOTECHNOLOGY: Gel Electrophoresis Group Members: Lab Station: Restriction Enzyme Analysis Standard: AP Big Idea #3, SB2 How can we use genetic information to identify and profile individuals? Lab Specific
More informationMolecular Scissors: Lambda Digest Student Materials
Molecular Scissors: Lambda Digest Student Materials Introduction 2 Pre-Lab Questions. 5 Lab Protocol 6 Data Collection Worksheet. 9 Post-Lab Questions and Analysis.. 10 Plasmid Maps. 13 Last updated: August
More informationBio 160: DNA Fingerprinting Name:
Bio 160: DNA Fingerprinting DNA Fingerprinting Name: OBJECTIVES: To review the structure and function of DNA Understand and perform DNA digests To gain experience using the micropipettes and gel electrophoresis
More informationDNA Fingerprinting. Student Manual. Contents
DNA Fingerprinting Student Manual Contents Page Lesson 1 Introduction to DNA Fingerprinting...19 Lesson 2 Restriction Digests of DNA Samples...21 Lesson 3 Electrophoresis and Staining of DNA Samples...28
More informationBiotechnology Explorer
Biotechnology Explorer DNA Fingerprinting Kit Instruction Manual Catalog Number 166-0007-EDU www.explorer.bio-rad.com Lyophilized reagents can be stored at room temperature. Store DNA markers at 4 ºC,
More informationLambda (λ) DNA Restriction Digest and Electrophoresis Lab
Lambda (λ) DNA Restriction Digest and Electrophoresis Lab Procedure DAY ONE: restriction digestion Today we will be exposing the lambda DNA to restriction enzymes. For background knowledge, make sure you
More informationDNA RESTRICTION ANALYSIS
DNA RESTRICTION ANALYSIS In this experiment, DNA from the bacteriophage Lambda (48,502 base pairs in length) is cut with a variety of restriction enzymes and the resulting fragments are separated using
More informationMission (Im)possible: Plasmid Mapping Student Materials
Mission (Im)possible: Plasmid Mapping Student Materials Introduction... 2 Pre-Lab Questions... 6 Lab Protocol... 7 Data Collection Worksheet... 11 Post-Lab Questions and Analysis... 12 Last updated: August
More informationCRIME SCENE INVESTIGATOR: DNA Profiling
Bio101- LAB 8 Name: CRIME SCENE INVESTIGATOR: DNA Profiling OBJECTIVES: To review the structure and function of DNA Understand and perform DNA digests To gain experience using the micropipettes and gel
More informationLAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING
Name: Book # Per. Name: Name: Book # Book # LAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING PRELAB: 1. Approximately 28 drops of liquid, from a medicine dropper or disposable pipette, equals 1
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2017 Laboratory Safety: Lab coat, long pants, closed-toe shoes, safety goggles, and nitrile or latex gloves are required. Learning
More informationRFLP ANALYSIS OF DNA LABORATORY
RFLP ANALYSIS OF DNA LABORATORY BIG PICTURE You will be working with an essential research method widely used in genetics, conservation biology, and forensics. The lab is divided into three sections. Part
More informationDNA FINGERPRINTING & ORANGUTAN PARENTAGE
DNA FINGERPRINTING & ORANGUTAN PARENTAGE 1 DNA FINGERPRINTING & ORANGUTAN PARENTAGE DNA, or deoxyribonucleic acid, is found in all living organisms. DNA is a long chain of nucleotides, the order of which
More informationBIOLOGY 163 LABORATORY. RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017)
BIOLOGY 163 LABORATORY RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017) Physical mapping of genomes is an important part of modern molecular genetics. As it's name implies, physical mapping seeks
More informationRestriction Enzyme Cleavage of DNA and Electrophoresis (AP Biology Lab 6B)
The Biotechnology Education Company Revised and Updated Restriction Enzyme Cleavage of DNA and Electrophoresis (AP Biology Lab 6B) EDVO-Kit 112 See Page 3 for storage instructions. EXPERIMENT OBJECTIVE:
More information..C C C T C A T T C A T T C A T T C A T T C A..
Polymerase Chain Reaction Lab: a Forensic Application INTRODUCTION PCR (polymerase chain reaction) is a technique that scientists use to amplify particular segments of DNA. This process can produce large
More informationDNA FINGERPRINTING AND HEDGEHOG RE-COLONISATION OF EUROPE DNA, or deoxyribonucleic acid, is found in all
DNA FINGERPRINTING AND HEDGEHOG RE-COLONISATION OF EUROPE DNA, or deoxyribonucleic acid, is found in all living organisms. DNA is a long chain of nucleotides, the order of which differs from organism to
More informationStudent Manual. Pre-Lab Introduction to DNA Fingerprinting STUDENT MANUAL BACKGROUND
BACKGROUND Pre-Lab Introduction to DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will
More informationRestriction Enzyme Analysis of DNA- Student Handout
Restriction Enzyme Analysis of DNA- Student Handout How to set up a restriction enzyme reaction Restriction enzymes (or restriction endonucleases) cleave DNA in a very specific fashion. Type II restriction
More informationForensic DNA Fingerprinting
Forensic DNA Fingerprinting Day 1 Practice Using Micropipettes We recommend that you familiarize your students with proper pipetting techniques prior to Lesson 1. Have your students learn how to transfer
More informationDirections: Please Return!
Directions: Please Return! Electrophoresis Analysis: restriction enzyme cleavage of DNA Lab AP bio lab 9 (adapted from http://media.collegeboard.com/digitalservices/pdf/ap/bio-manual/bio_lab9-biorestrictionenzymeanalysisofdna.pdf
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2016 The Techniques of Molecular Biology: Forensic DNA Fingerprinting **Lab coat, eye goggles and gloves (nitrile or latex) are required for this lab. You will not be allowed to participate
More informationStudent Manual. Pre-Lab Introduction to DNA Fingerprinting STUDENT MANUAL BACKGROUND
BACKGROUND Pre-Lab Introduction to DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will
More informationDNA FINGERPRINTING & OTTER POPULATIONS
DNA FINGERPRINTING & OTTER POPULATIONS 1 DNA FINGERPRINTING AND OTTER POPULATIONS DNA, or deoxyribonucleic acid, is found in all living organisms. DNA is a long chain of nucleotides, the order of which
More informationMission (Im)possible: Determine the Identity of Unknown Plasmids. Student Materials. Introduction Lab Protocol... 5
Mission (Im)possible: Determine the Identity of Unknown Plasmids Student Materials Introduction... 2 Lab Protocol... 5 Data Collection Worksheet... 9 Pre-Lab Questions... 10 Post-Lab Questions and Analysis...
More informationHow Can Pieces of DNA Solve a Puzzle?
Introduction How Can Pieces of DNA Solve a Puzzle? One of the basic tools of modern biotechnology is DNA splicing: cutting DNA and linking it to other DNA molecules. The basic concept behind DNA splicing
More information10 Restriction Analysis of Genomic DNA
10 Restriction Analysis of Genomic DNA Objectives: A) To determine the rough location of restriction sites of an unknown restriction enzyme and B) to use this information to determine the identity of this
More informationLAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA
LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and
More informationLABORATORY 1.2: GEL ELECTROPHORESIS
LABORATORY 1.2: GEL ELECTROPHORESIS The purpose of this laboratory is to give you experience with gel electrophoresis, which is used to separate and identify a mixture of biomolecules including DNA; the
More informationCOLLEGE OF THE CANYONS INTRODUCTION TO BIOTECHNOLOGY: CUSTOM LAB
COLLEGE OF THE CANYONS INTRODUCTION TO BIOTECHNOLOGY: CUSTOM LAB GEL ELECTROPHORESIS AND DNA ANALYSIS LAB Version 7-5-12 One of the most basic and frequently used tools of the molecular biologist is electrophoresis.
More informationStudent Manual. Pre-Lab Introduction to DNA Fingerprinting BACKGROUND STUDENT MANUAL
BACKGROUND Pre-Lab Introduction to DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will
More informationDirections: Please Return!
Directions: Please Return! Gel Electrophoresis Analysis: Lab Directions AP bio lab 9 (adapted from http://media.collegeboard.com/digitalservices/pdf/ap/bio-manual/bio_lab9-biorestrictionenzymeanalysisofdna.pdf
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More informationAP Biology Lab 6 MOLECULAR BIOLOGY
AP Biology Laboratory Date: Name and Period: AP Biology Lab 6 MOLECULAR BIOLOGY OVERVIEW In this lab you will investigate some basic principles of molecular biology: 1. Plasmids containing specific fragments
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationRestriction Enzymes and Lambda DNA
Restriction Enzymes and Lambda DNA Computer 6B Restriction enzymes have become an indispensable tool of molecular researchers over the past fifty years. This unique group of enzymes function as molecular
More informationBio 121 LAB 11 INSTRUCTIONS - DNA II
Bio 121 LAB 11 INSTRUCTIONS - DNA II In the first part of today's lab we will demonstrate that the DNA which we extracted last week can create heritable changes in the phenotype of bacterial cells. We
More informationPreLab Activity I: Restriction Enzymes 1. What is the sequence of the complementary DNA strand? Draw it.
PreLab Activity I: Restriction Enzymes 1. What is the sequence of the complementary DNA strand? Draw it. 2. Assume you cut this fragment with the restriction enzyme EcoRI. The restriction site for EcoRI
More informationA. Introduction. Figure 1 Figure 2
Varsity Biology Molecular Biotechnology Lab Decode the Candy Dye Essential Questions: How can we use Gel electrophoresis to separate molecules? How do we use the equipment (which will be important in the
More informationName: Date: Virtual Student Guide http://www.phschool.com/science/biology_place/labbench/index.html AP Biology Laboratory 6 Part II DNA Electrophoresis Introduction In this laboratory you will use some
More informationCOC Biotechnology Program
COC Biotechnology Program DNA FINGERPRINTING: VERSION B In the time it takes you to complete this lab, your DNA could be extracted, amplified, analyzed and compared. Everything from a criminal past to
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationLab 9 Restriction Enzyme Analysis
Name Assignment # Lab 9 Restriction Enzyme Analysis http://www.phschool.com/science/biology_place/labbench/lab6/concepts2.html 1) Define restriction enzyme 2) Define recognition sequence 3) Label the images
More informationExercise 20 GEL ELECTROPHORESIS OF DNA SAMPLES (Plasmids, PCR products & Restriction Fragments)
Exercise 20 GEL ELECTROPHORESIS OF DNA SAMPLES (Plasmids, PCR products & Restriction Fragments) Introduction Gel electrophoresis is a technique or procedure allowing DNA fragments to be separated on the
More informationWhose DNA Was Left Behind?
Edvo-Kit #S-51 Whose DNA Was Left Behind? S-51 Experiment Objective: This experiment explores the principles of DNA fi ngerprinting for the analysis of crime scene DNA. After performing agarose gel electrophoresis
More informationRestriction Digest Basics MiniLab
Restriction Digest Basics MiniLab Student s Guide Cat# M6050 Version 071918 5 TTTTTTGATATCTTTTTTT 3 3 AAAAAACTATAGAAAAAAA 5 5 TTTTTTGAT 3 5 ATCTTTTTTT 3 3 AAAAAACTA 5 3 TAGAAAAAAA 5 Table of Contents Objectives
More informationDNA Profiling with PCR
Name: DNA Profiling with PCR OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes, thermocycler,
More informationLesson 1 Introduction to Restriction Analysis
Lesson 1 Introduction to Restriction Analysis Consideration 1. How Does DNA Become Fragmented Into Pieces? DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds. These
More information1. Why do DNA restriction fragments and plasmids separate when analyzed by gel electrophoresis?
INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the insulin gene. To do so, they use restriction enzymes to create DNA fragments
More informationBASIC ELECTROPHORESIS
Ref. ELECBASICA (4 practices) 1. EXPERIMENT OBJETIVE BASIC ELECTROPHORESIS The aim of this experiment is to introduce students to the knowledge of electrophoretic theory and to familiarize themselves with
More informationGenetic Diagnosis. electrophoresis. During the lab, genetic testing was done for the cystic fibrosis gene in a young
Meyers 1 Keya Meyers Genetic Diagnosis Abstract: In this lab two processes were observed: restriction fragment polymorphism and gel electrophoresis. During the lab, genetic testing was done for the cystic
More informationLab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue
Lab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue Notebook Lab Objectives Develop an understanding of the basic techniques used to study genetic polymorphisms encoded in DNA Gain familiarity
More informationElectrophoresis 101 Student Worksheet
1 Electrophoresis 101 Student Worksheet Experiment Objective To develop an understanding of electrophoresis principles. To analyze results and to calculate the sizes of unknown charged molecules from given
More informationCOC Biotechnology Program
COC Biotechnology Program DNA FINGERPRINTING: VERSION C In the time it takes you to complete this lab, your DNA could be extracted, amplified, analyzed and compared. Everything from a criminal past to
More informationCHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID. CHAPTER 4A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID 55 INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the human insulin gene.
More informationStudent Manual. Restriction Digestion and Analysis of Lambda DNA Kit
Student Manual Restriction Digestion and Analysis of Lambda DNA Kit Contents Overview Lesson 1 Lesson 2 Lesson 3 Introduction to Restriction Analysis Restriction Digestion (Laboratory Procedure) Review
More informationMolecular Scissors: Lambda Digest Teacher Materials
Molecular Scissors: Lambda Digest Teacher Materials Students will conduct a restriction digest of lambda DNA using two unknown enzymes. They will use the results of gel electrophoresis to identify the
More informationStudent Manual. Pre-Lab Introduction to DNA Fingerprinting STUDENT MANUAL BACKGROUND
BACKGROUND Pre-Lab Introduction to DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will
More informationADVANCED ELECTROPHORESIS
Ref. ELECAVANZADA (4 practices) 1. EXPERIMENT OBJETIVE ADVANCED ELECTROPHORESIS The aim of this experiment is to introduce students to the knowledge of electrophoretic theory and to familiarize themselves
More informationLeft at the Scene of the Crime: An Introduction to Forensic Science
Left at the Scene of the Crime: An Introduction to Forensic Science Thomas Cynkar Edvotek www.edvotek.com Follow @Edvotek EDVOTEK The Biotechnology Education Company Celebrating 30 years of science education!
More informationAgenda (Monday-Wednesday)
Agenda (Monday-Wednesday) Chapter 12 Recombinant DNA Technology Recombinant DNA Techniques DNA Fingerprinting and Forensic Science DNA Fingerprinting Techniques Pre-lab 8 activities Tomorrow: Day One of
More informationBiotechniques (Biol 410) 13. DNA Extraction & Gel Electrophoresis
Biotechniques (Biol 410) 13. DNA Extraction & Gel Electrophoresis Laboratory Objectives Extract DNA from cells using an alternative to Column purification Learn to prepare and pour gel DNA Electrophoresis
More informationRestriction Analysis of Purified para-r
Restriction Analysis of Purified para-r INTRODUCTION The restriction analysis will provide final proof that the cells transformed during Laboratory 6, cloned overnight in LB/amp and purified in Lab 10
More informationCSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION
CSI TEST Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE This practice introduces students to using DNA and PCR to simulate how DNA obtained from a hair or saliva sample from a crime scene can
More informationRestriction Analysis of Lambda DNA Miriam Golbert, College of the Canyons, Santa Clarita, CO
INTRODUCTION To close the yellow note, click once to select it and then click the box in the upper left corner. To open the note, double click (Mac OS) or right click (Windows) on the note icon. Restriction
More informationLeft at the Scene of the Crime: An Introduction to Forensic Science
Left at the Scene of the Crime: An Introduction to Forensic Science Kelly Barford, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK The Biotechnology Education Company Celebrating 30 years of science
More informationLet s Move It! Gel Electrophoresis Using Food Dye Student Guide
Let s Move It! Gel Electrophoresis Using Food Dye Student Guide Purpose This lab explores the principle of electrophoresis, an important technique used in biochemistry and molecular biology. You will:
More informationPrinciples and Practice of Agarose Gel Electrophoresis
Edvo-Kit #101 Principles and Practice of Agarose Gel Electrophoresis Experiment Objective: The objective of this experiment is to develop a basic understanding of electrophoretic theory, and to gain "hands-on"
More informationBIOTECHNOLOGY: RESTRICTION ENZYME ANALYSIS OF DNA*
Genetics and Information Transfer Big Idea 3 INVESTIGATION 9 BIOTECHNOLOGY: RESTRICTION ENZYME ANALYSIS OF DNA* How can we use genetic information to identify and profile individuals? THE SCENARIO OMG!
More informationAgarose Gel Electrophoresis of DNA. By: Sahar alsubaie
Agarose Gel Electrophoresis of DNA By: Sahar alsubaie principle : Agarose Gel Electrophoresis uses electrical field to separate macromolecules (DNA and Protein) that differ in size, charge and configuration.
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationUnit 4-DNA Analysis Review Guide
Name: KEY Match the term on the right with the definition on the left. Unit 4-DNA Analysis Review Guide 1. A procedure used to determine the order of the base pairs that make up a DNA molecule E 2. These
More information10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA
Biol/Chem 475 S07 Study problems for quiz 1 See also questions posed in lab handouts including ligase handout Answers to questions 1&2 included at the end of this document. 1. You plan to clone a 1.0 kb
More informationAnalysis of Precut Lambda DNA. Evaluation copy
Analysis of Precut Lambda DNA Computer 6B Restriction enzymes are a special class of proteins that cut DNA at specific sites and have become an indispensable tool in molecular biology. Restriction enzymes,
More informationRestriction Analysis of DNA MiniLab
Restriction Analysis of DNA MiniLab Student s Guide Cat# M6053 Version 030619 Table of Contents Objectives 2 Laboratory Safety 2 Introduction 3 Instructions 6 Results and Analysis 10 Appendix A - Gel Electrophoresis
More informationRAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS. STANDARDS 3.1.7, , Westminster College 3.3.7, , 3.3.
RAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS STANDARDS 3.1.7, 3.1.10, 3.1.12 Westminster College 3.3.7, 3.3.10, 3.3.12 INTRODUCTION This laboratory will demonstrate the basics of electrophoresis and
More informationLearning Basic Laboratory Skills
How to use a micropipette? Plunger/ Volume adjustment Tip ejector Volume display Clockwise: decrease volume Anti-clockwise: increase volume nd stop Rest To adjust volume Do NOT over turn the plunger! To
More informationElectrophoresis 101 MiniLab
Electrophoresis 101 MiniLab Student s Guide Cat# M3001 Version 020718 Table of Contents Laboratory Safety 2 Objectives and Background 3 Instructions 4 Results and Analysis 7 Appendix A - TBE Concentrate
More informationTechniques for Biotechnology!
Techniques for Biotechnology! Quantities for Molecular Biology: unlike other labs where we might measure volume in milliliters and mass in grams, in molecular biology / biotech labs, we use MUCH smaller
More informationCyber DNA Extraction and Gel Electrophoresis
Cyber DNA Extraction and Gel Electrophoresis Contributors Adam Fleming Graduate Student Georgia Southern University, GA Cheri Alderman Partner Teacher Effingham High School, GA Intended Audience K-4 5-8
More informationBasic Biotechnology Kit
Basic Biotechnology Kit GEL ELECTROPHORESIS OF DYES Partnership for Biotechnology and Genomics Education Barbara Soots Linda Curro Education Coordinator University of California Davis Assistant Education
More informationBIO 121 LAB 10 - DNA I
BIO 121 LAB 10 - DNA I All cellular organisms store their hereditary information as the precise sequence of nucleotides in DNA, just as written information is stored as the precise sequence of letters
More informationDNA FINGERPRINTING & JAPANESE KNOTWEED
DNA FINGERPRINTING & JAPANESE KNOTWEED 1 DNA FINGERPRINTING AND JAPANESE KNOTWEED DNA, or deoxyribonucleic acid, is found in all living organisms. DNA is a long chain of nucleotides, the order of which
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationHow does electrophoresis work? The gel is made from agarose, DNA is a negative molecules, Molecules sort based on: Charge, Size, shape.
Lab six:. Gel Electrophoresis: What is Gel Electrophoresis? Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Agarose gel electrophoresis is routinely used
More informationExploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION
Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Purpose: In this laboratory, we will set up a polymerase chain reaction to amplify the region of the caffeine
More informationLAB 1: DNA PRECUT BY RESTRICTION ENZYMES
LAB 1: DNA PRECUT BY RESTRICTION ENZYMES Why would anyone want to study DNA? Scientists have learned that the incredible amount of information stored in DNA can answer many questions and solve problems
More informationAGAROSE GEL ELECTROPHORESIS OF DNA
AGAROSE GEL ELECTROPHORESIS OF DNA Why would anyone want to study DNA? Scientists have learned that the incredible amount of information stored in DNA can answer many questions and solve problems, which
More informationDNA Technology Outline
I) Tools of DNA technology A. PCR (Polymerase Chain Reaction): method of copying DNA sequences 1. DNA is copied in a similar way to natural replication in our cells, but much faster. 2.PCR consists of
More informationExperiment 5. Restriction Enzyme Digest and Plasmid Mapping. VY NGUYEN 26 February 2016
Experiment 5 Restriction Enzyme Digest and Plasmid Mapping VY NGUYEN 26 February 2016 ABSTRACT 1. Understand the use of restriction enzymes as biotechnology tools 2. Become familiar with the principles
More information