Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.
|
|
- Stuart Webster
- 6 years ago
- Views:
Transcription
1 Delicious DNA: Transcription and Translation Simulation Using an Edible Model Authors: Darcy Holoweski and Catherine Quist Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes. Objectives: SWBAT describe how the processes of gene transcription and translation result in phenotypic expression. Grade Level: Biology 1, 9 th -11 th grade Overview: Students will learn about the processes of transcription and translation and then simulate these processes using an edible DNA model that they created during a previous lesson. Learning Outcomes: * Learning Performances: At the end of this lesson, students will understand and be able to simulate the production of an mrna sequence and protein translation through a model they have made. They will understand that a cell is dynamic and that proteins, which function as the structure and the machinery of the cell, must be constantly manufactured in order to support the cell's life processes. They will also be able to make connections between the importance of protein synthesis and evolution. Students' Prior Knowledge: * A basic knowledge of DNA structure, function, and location, and that DNA contains heritable instructions for building and maintaining an organism. * A basic knowledge of the organization of the cell; that DNA is stored in the nucleus and that ribosomes in the cytoplasm make protein. * Students should understandd that genes code for proteins, which are the structure and machinery of the cell. * Students should know that proteins are made by ribosomes, which are located in the cytoplasm. * Students should understand the process of cell division, including mitosis.
2 Establishing Purpose: The purpose of this lesson is to convey to the students that the cell is not static. The proteins, which function as the structure and the machinery of the cell, must be constantly manufactured in order to support the cell's life processes. Through the processes of transcription and translation, described in this lesson, the genetic code in the cell is decoded in order to construct these proteins. During this lesson, the students will be introduced to the "big picture" of protein synthesis through a hands-on activity in which they transcribe an mrna sequence from a DNA sequence and translate a protein from that mrna sequence. Finally, they will explore the evolutionary and regulatory reasons for the processes described by the Central Dogma. The students have also been working with the edible DNA models for two days previously. Therefore, links will be made between what the students have learned about DNA already and how they will use that knowledge to help them transcribe and translate the DNA code into proteins. In addition, the connection between cell division and protein translation will be made, emphasizing that the production of new proteins is necessary for the creation of new cells. Instructional Strategies: This lesson will combine a teacher lecture, and students working in pairs with DNA models to simulate how DNA is transcribed and translated. Materials Needed: Paper models of DNA previously built when DNA replication was introduced Time required: 3 50-miniute classes Instructional Seqence: * Introducing the lesson using guided inquiry to activate students' prior knowledge and to establish purpose for lesson: Establish the motivation for the transcription and translation process. "What happens during the process of cell division?" Students should say that DNA is replicated and new structures are built. "What are new cell structures made out of?" Students should mention protein. "How do cells know how to make new proteins?" Students should answer that instructions are in DNA. "How do cells use DNA to make proteins?" Students shouldn't have an answer to this. Explain that today we are going to learn about transcription and translation, which is the process by which the genetic code stored in DNA gets turned into protein. Explain how understanding the transcription and translation possible makes genetic engineering possible. Next establish the need for mrna to carry the genetic code from the nucleus to the cytoplasm. "What makes protein?" Students should know that proteins are made by ribosomes.
3 "Where are ribosomes located in the cell?" Students should know that ribosomes are located in the cytoplasm. "Where are genes located in the cell?" Students should know that genes are located on DNA, which is located in the nucleus. "How does the genetic code get out of the nucleus?" Students should understand that DNA never leaves the nucleus, but somehow the genetic code gets out of the nucleus into the cytoplasm. Students should suggest mechanisms. Students may suggest that a molecule must transcribe the genetic code and then take it into the cytoplams to be translated into protein, but if not, their curiousity has been peaked and they are ready to learn about how this phenomena occurs. At this point, the conceptual relationship between DNA, mrna and protein has been established, and it is time to introduce the Central Dogma. * Body of the Lesson: o Introduce Central Dogma: Using Figure 1 below, explain that DNA in the nucleus is transcribed into a single-stranded molecule called messenger RNA (mrna). The mrna travels out of the nucleus into the cytoplasm, where it is translated by the Ribosome and transfer RNA (trna) molecules into a peptide sequence. Once the peptide sequence is translated, it folds into a three dimensional protein, which acts to do work or provide structure to the cell.
4 Figure 1: Central Dogma of Biology *Understanding the Central Dogma by Analogy: Using Figure 2, explain the students the Central Dogma in terms of things and processes that the students already understand. The goal is to help them build connections between the new material and their prior knowledge. These symbols that describe the functions of the biological molecules may help students understand them better. Figure 2: Central Dogma Analogy Key: 1. DNA = Blueprint of Tinkertoy Structure 2. mrna = Messenger 3. Ribosome = Toy Factory 4. trna = Wrench 5. Amino Acids = Tinkertoy Parts 6. Protein = Tinkertoy Ferris Wheel *Connecting to the big picture: *Regulatory Implications: Explain to the students that the cell is not static. Proteins degrade and are digested over time so that new proteins must be manufactured all the time in order to support the life processes of the cell. For each of the following facts about transcription, think of a potential advantage for the cell: 1. Fact: mrna is transcribed from a particular gene in different amounts at different times. Correct Response: Cells can regulate the amount of different proteins, turning genes on and off. This leads to different cell types. It also leads to different developmental stages.
5 2. Fact: mrna travels to different parts of the cell to be translated. Correct Response: Proteins are made where they are needed in the cell, making it more likely that the protein will be available to do the necessary work. + Evolutionary Implications: Explain to the students that the relationship between DNA, RNA, and protein probably evolved for a reason. Most scientists believed that RNA evolved before DNA. 1. Why might RNA have evolved first? Answer: RNA is single stranded and is able to do work. 2. Why might DNA have evolved? Answer: DNA is double stranded and is more stable. Transitioning into an exploration of the details of transcription and translation: The teacher will point out that they have only explored the overall process of transcription and translatin and that they have not yet learned the detail. The teacher will next complete a detailed example of transcription and translation happening from a 9 or 12 nucleotide DNA sample. The students will be asked to follow along and provide answers to the teacher's leading questions for what happens at each step. To complete the example, the teacher will introduce the students to the Genetic Code chart in their textbooks and how to read the semi-complicated chart. Now students are ready to complete their own transcription and translation activity. o Implementing the activity: The students have been working with paper DNA models for the past two days. The first day they created a DNA model using different colored pieces of paper. The second day they learned about DNA replication and simulated it using their model. In this activity, the paper models will be used again to demonstrate how transcription and translation occur. They have seen the processes of transcription and translation demonstrated by the teacher using Figure 1, and they have problem-solved the different roles that each of the biological molecules have in the processes, and now they are given the opportunity to simulate the processes themselves. Before doing the activity the teacher will ask the students how they could use the models from the past two days to model transcription and translation. This will help them construct their own understanding of the models. The following activity sheet will guide the students in creating proteins from their DNA models: (Activity Sheet not included in this link as it does not correspond to the prior knowledge portion of the RWT). * Concluding the lesson using review: First, ask the students if they have any questions following the activity. Next, write a DNA sequence AGACTTATC on the board and project the genetic code, which gives the relationship between codons and amino acids on a screen. Ask the students to help transcribe and translate this DNA sequence. First, walk through the DNA sequence and transcribe it into mrna one nucleotide at a time. The corresponding mrna is UCUGAAUAG. Next, walk through the mrna translating it into protein one codon at a time. The corresponding protein is Ser Glu Stop. Ask students about the function of the 'Stop' codon to check for
6 understanding. Ask students what would happen if the first C in the sequence was changed to a G. Then the protein sequence would be Gln Glu Stop. This is an example of a mutation. Tell the students that they will be learning about mutation in the next lesson. Assessing Student Understanding: The worksheet for homework will ask the students to practice the process of transcribing DNA to yield mrna and translating mrna to yield protein and then ask the students to diagram the Central Dogma, the process of transcription and translation. * Routine practice: For the first three problems, give the students a DNA sequence and ask them to provide the corresponding mrna and protein. * Ask the students to diagram the Central Dogma of biology, including the cell membrane, nuclear membrane, mrna, DNA, protein, amino acids, trna, and ribosome. * Ask the students to label a diagram of an mrna being transcribed. * Ask the students to label a diagram of a protein being translated. Student Resources: The course textbook Biology: The Dynamics of Life, published by McGraw Hill: Glencoe Science, copyright Cautions: Students should be reminded not to eat their edible models. The models have touched the lab benches, which may have been the site of a chemical spill.
Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationActivity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationStudent Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
More informationProtein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives
Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationDNA Structure, Nucleic Acids, and Proteins
DNA Structure, Nucleic Acids, and Proteins Strands Topic Primary SOL Related SOL Life at the Molecular and Cellular Level; Scientific Investigation Investigating DNA structure, nucleic acids, and protein
More information2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.
From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how
More informationIf Dna Has The Instructions For Building Proteins Why Is Mrna Needed
If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary
More informationCreate a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.
HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationTranscription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationFrom Gene to Protein Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More informationDNA/RNA. Transcription and Translation
DNA/RNA Transcription and Translation Review DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNA RNA Proteins Chromosomes contain several thousand
More informationNucleic Acids And Protein Synthesis Answer Key
And Protein Answer Key Free PDF ebook Download: And Answer Key Download or Read Online ebook nucleic acids and protein synthesis answer key in PDF Format From The Best User Guide Database Key ~. ' Date.
More informationFrom DNA to Protein Structure and Function
STO-106 From DNA to Protein Structure and Function Teacher information Summary: Students model how information in the DNA base sequences is transcribed and translated to produce a protein molecule. They
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationCentral Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationFrom Gene to Protein via Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationChapter 15 DNA and RNA
Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationNON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More information13.1 RNA. Lesson Objectives. Lesson Summary
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. Lesson Summary The Role of RNA RNA (ribonucleic acid) is a nucleic acid like DNA. It consists of a long chain of nucleotides.
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationGENETICS: BIOLOGY HSA REVIEW
GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationCBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:
CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA & Protein Synthesis #21
Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationDNA & DNA Replication
DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?
More information1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationFlow of Genetic Information
Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)
More informationDNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
More informationGene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationDNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationDNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationWritten by: Prof. Brian White
Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More information