Forensic Science: DNA Evidence Unit

Transcription

1 Day 2 : Cooperative Lesson Topic: Protein Synthesis Duration: 55 minutes Grade Level: 10 th Grade Forensic Science: DNA Evidence Unit Purpose: The purpose of this lesson is to review and build upon prior knowledge of protein synthesis in order to further understand the function of DNA so that it can be examined as an essential tool for forensic investigations in the subsequent lesson. Materials/Preparation: Bodily/Kinesthetic Group Construction paper, markers, string, hole punch, tape, and scissors. See attached for exact preparation, setup, and handout. Verbal/Linguistic Group None, see attached handout. Visual/Spatial Group Construction paper or cardboard, scissors, markers, and tape. See attached for exact preparation, setup, and handout. District Core Outcomes: Explain how the sequence of bases along a DNA strand ultimately determines the structure of proteins that are synthesized within the body. Michigan High School Content Expectations: A4- Communicate scientific procedures and explanations. Day's Agenda: Introduction/Key Question (5 min) Protein Synthesis Discussion with Guided Notes (15 min) Cooperative Activity: Protein Synthesis Centers (20 min) Revisit Key Question (10 min) Homework Assignment (5 min) Objectives: Describe the process of Protein Synthesis Assessment of Objectives: Students will demonstrate understanding of Protein Synthesis by completing the activity at the learning centers, as well as by answering the questions on the worksheet. Anticipatory Set: The lesson will begin with the class being asked a key question: How can only 4 nucleotides code for all of the different proteins in our body? Input: Based on student responses, a brief discussion of suggestions may follow, leading into a short lecture on protein synthesis, describing how, much like during replication, the DNA molecule is unzipped so that the nucleotide bases are exposed. This time, however, it is RNA that replicates the strand. RNA is slightly different than DNA, and instead of having a thymine base (T), it has a uracil base (U) for a substitute. The replication process with RNA is called transcription, and the single stranded RNA molecule that results is called messenger RNA, or mrna. This mrna leaves the nucleus and heads into the cytoplasm; there it will take the message to a ribosome to be translated. It turns out that every three bases codes for one amino acid, so the bases on the mrna are read in groups of three, called codons. These codons are read by another type of RNA called transfer RNA, or trna. Each trna molecule is composed of three bases called the anticodon, which pairs with the three complementary bases on the codon of the mrna. Each different trna also carries an amino acid, so as the ribosome reads the mrna, it brings in the complimentary trna molecules, and connects their amino acids, forming the protein just as the DNA instructed. The board should be used to illustrate as

2 needed. The instructor should write out some DNA sequences to be transcribed by the students, as well as some mrna sequences to be translated, to check for understanding. Modeling: Protein Synthesis will be modeled by the students themselves through their group activities. Cooperative Components: Students will be placed at one of the three following learning centers based on learning profile: Bodily/Kinesthetic, Verbal/Linguistic, or Visual/Spatial. Each group can assign the following roles: administrator, recorder, reporter, and the remaining group members will be players. The Bodily/Kinesthetic group will work together to act out the process of protein synthesis. Starting with transcription, they will be given a segment of DNA to transcribe, and each will be assigned a different nucleotide to represent in order to create a strand of mrna by matching the correct base pairs. The DNA strand will be written out as a series of bases. There will be corresponding RNA bases as drawn on a paper with a string available for each student to wear around their neck as a name tag. The students, representing the different RNA bases, must line up with the DNA to be transcribed in the correct order to form the mrna strand by linking arms. Once the mrna is complete, the molecule must travel to the cytoplasm (aka to the teacher's current location,) to verify that the strand was created accurately. Next, the group must translate the mrna strand. The teacher will provide a longer mrna strand for translation. (See attached for setup, mrna sequence, trnas, and amino acids.) This time the students will represent trna molecules, each assigned a different anticodon to wear, and one student will act as the ribosome. First, each trna molecule must find the correct amino acid (labeled papers already placed throughout the room) that their anticodon represents, then they must return to the ribosome and find their corresponding codon on the mrna. The ribosome will be the director, calling in each trna molecule, one at a time, in the order the mrna calls for. As each trna brings in their amino acid, the ribosome collects it, connecting it to the previous one with tape, then sending the trna back on its way to fetch another amino acid. The protein is complete when the ribosome reads a stop codon. When the protein is complete, the students must use the internet to determine the name of the protein that they synthesized. The Verbal/Linguistic group will work together to solve a riddle using transcription and translation processes to produce a sentence, with each amino acid representing a word. The group will be presented with a riddle and the DNA sequence that represents the answer. The group must transcribe the DNA sequence into an mrna sequence, then translate the mrna into the amino acid sequence. Once they have the amino acid sequence, they can use a decoder to find out what word each amino acid represents to find the answer to the riddle. During transcription, each group member will be given a numbered portion of the DNA to transcribe to mrna, then they will combine the entire sequence. The member designated to record can write out the whole mrna sequence, then the member designated to report can bring it to the instructor to be checked for accuracy. Once the mrna is approved, the students must translate it by breaking the sequence into codons. The group member designated to be the administrator will assign each team member, including him/herself, one or two codons to translate. The codons are translated by converting the codon to an anticodon sequence for a trna molecule, then finding the amino acid belonging to that trna molecule by referring to a chart. The recorder then writes out the amino acid sequence and the administrator assigns each team member an amino acid to translate from the decoder to solve the riddle. The students must also use the internet to determine the name of the protein that they decoded. The Visual/Spatial group will work together to build a protein using transcription and translation processes. They will be provided a DNA sequence in the form of a strip of connected

3 puzzle pieces and they must transcribe the DNA by matching each piece with its fitting mrna piece. The mrna strand is then used to translate the protein by matching each three piece codon with the anticodon on the provided trna pieces. The amino acids connected to each trna piece are then put together in order to form the protein. The protein can be turned over to reveal its name and function, same as the bodily/kinesthetic group. When the protein is complete, the students must use the internet to determine the name of the protein that they synthesized. (See attached for setup and preparation of pieces.) Checking for Understanding: Students' understanding will be assessed verbally with questioning throughout the instruction, as well as during the cooperative activity. Guided Practice: Students will practice base pair translation and codon transcription on the board after each concept is covered in the discussion. Closure: The lesson will close with a brief discussion revisiting the key question. Independent Practice: The students will complete an assessment in the form of a worksheet (attached). Adaptations/Differentiation: Activities are modified by learning style to accommodate bodily/kinesthetic learners, visual/spatial learners, and verbal/linguistic learners. Handouts: Bodily/Kinesthetic, Verbal/Linguistic, and Visual/Spatial Group Handouts and Protein Synthesis Worksheet attached.

4 Preparation/Setup: Bodily/Kinesthetic Center Create 10 nucleotide name tags for transcription by punching a hole in each corner at the top of a piece of construction paper and tying each end of a 2 ft piece of string in each hole. Write a letter on each name tag to represent one of the four nucleotides, you will need 3 As, 3 Us, 2 Cs, and 2 Gs, preferably with corresponding colors. The name tags can be given a shaped edge by cutting the bottom with scissors so that the Gs and Cs fit together and the As fit with the Ts and the Us fit with the As. Students will be given the following DNA sequence to be transcribed: ATTCGCTAAG. The correct transcription is: UAAGCGAUUC. Nucleotide Name Tag: A Students will be given the following mrna sequence to be translated: AUGUGCUAUAUUCAGAACUGCCCCCUCGGGUAG. The correct protein synthesis should result in OXYTOCIN. Create 10 trna name tags in the same fashion, this time writing the following trna anticodons on each: UAC, ACG, AUA, UAA, GUC, UUG, GGG, GAG, CCC, and one RIBOSOME. Create the following amino acids to be dispersed throughout the room for the trna molecules to pick up, by writing the amino acid name and its (codon) on a piece of paper, then writing one [letter] of the name of the protein being transcribed on the back: a START codon (AUG), Cysteine (UGC) [O], Tyrosine (UAU) [X], Isoleucine (AUU) [Y], Glutamine (CAG) [T], Asparagine (AAC) [O], Cysteine (UGC) [C], Proline (CCC) [I], Leucine (CUC) [N], and Glycine (GGG) [A mammalian hormone that functions to produce uterine contraction during childbirth and also plays a role in bonding and empathy]. Provide the learning center with the handout, name tags, and tape, as well as the DNA sequence to be transcribed. Provide the mrna sequence to be translated after the transcription is complete. The amino acid pieces must be dispersed around the room prior to the lesson. Verbal/Linguistic Center Provide the learning center with the handout and the following DNA sequence to be transcribed: TACAC GATAT AAGTC TTGAC GGGGG AGCC CATC

5 Visual/Spatial Center Create the puzzle pieces out of paper or cardboard. You will need 33 DNA pieces and 33 mrna pieces, as follows: DNA: T ACACGAT AT AAGT CTTGACGGGGGAGCCCAT C mrna: AUGUGCUAUAUUCAGAACUGCCCCCUCGGGUAG The pieces can be made from the following templates: DNA Sequence A T C G U A G C mrna Sequence You will need 11 trna pieces with three letter anticodons and an amino acid, with one letter on the back, as follows: UAC ACG AUA UAA GUC UUG ACG GGG GAG CCC AUC Start Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop [O] [X] [Y] [T] [O] [C] [I] [N] [function] Meth Cys trna trna A U C A GC The amino acids should be detachable so that they can be put together to build the protein. Provide the learning center with the handout and puzzle pieces; the DNA pieces together in sequence.

6 Bodily/Kinesthetic Activity First, assign the following roles: Administrator Recorder Reporter everyone else is a Player Transcription As a group, you must transcribe the provided DNA sequence, the Administrator can act as the director. Each group member takes a nucleotide name tag to wear, and must represent that nucleotide in the mrna strand. Work together to form the mrna strand by linking arms in the correct order. Your bases must be complimentary. Remember RNA has a U nucleotide instead of a T, but it is still complimentary with the A nucleotide! When you have formed the correct mrna molecule, you can travel to the cytoplasm (have your sequence reviewed by the instructor). 1. The Recorder should write down the DNA sequence and the complimentary mrna sequence below: Translation The Reporter should acquire a new mrna sequence from the instructor to translate. This time each group member gets a trna name tag to wear, with the Administrator acting as the director, and the Ribosome. Each trna molecule must first collect his or her amino acid, which is somewhere in the room, before the Ribosome can build the protein. The Ribosome must call for each trna molecule in the correct order as the mrna sequence instructs, making sure the bases are complimentary. 2. The Record should write the trna sequence and the corresponding amino acid sequence below: Each trna gives their amino acid to the Ribosome, who will connect them all to build the protein. Connect each amino acid, in order, end to end, with the tape. When the Ribosome reaches a stop codon, the protein is finished. 3. Use the internet to find out the name of your protein, and record it below:

7 Verbal/Linguistic Activity First, assign the following roles: Administrator Recorder Reporter everyone else is a Player Now, you will use the process of protein synthesis to answer the following riddle: Why is your neighbor angry with you? Your DNA sequence holds the answer. Transcription The Administrator assigns each group member one of the seven segments of the DNA to transcribe into mrna. 1. The Recorder should write the transcribed mrna below, in order: The Reporter should report the transcribed mrna to the ribosome (instructor) before translating. Translation The Administrator should divide the mrna into codons (3 bases), and assign one or two to each group member to translate. Each team member must convert their codon(s) into trna anticodons. 2. The Recorder should write the trna anticodons below, in order: Each team member must translate their trna into amino acids. Refer to the table on the next page to translate the trna into amino acids:

8 UAC Methionine GAG Leucine UAA Isoleucine CAA Valine AGA Serine GGG Proline GUC Glutamine UUG Asparagine UUC Lysine CUA Aspartate CUU Glutamate GUA Histidine UGA Threonine CGA Alanine AUA Tyrosine GCA Arginine AAA Phenylalanine ACG Cysteine ACC Tryptophan CCC Glycine AUC Stop 3. The Recorder should write the amino acid sequence below: Each team member must decode their amino acids. Refer to the table to decode the amino acid message: Methionine Your Leucine The Isoleucine Been Valine Cat Proline Under Glutamine Chasing Asparagine Her Lysine Runs Aspartate Phone Glutamate Yells Histidine His Threonine Was Alanine Never Tyrosine Has Arginine Garage Phenylalanine Is Serine Does Cysteine Dog Tryptophan My Glycine Fence 4. The Recorder should write the decoded message below: 5. Use the internet to find out the real name of the protein that matches the amino acid sequence you decoded and record it below:

9 Visual/Spatial Activity First, assign the following roles: Administrator Recorder Reporter Everyone else is a Player Transcription The Administrator should act as the director and make sure the group stays on task. Working as a group, transcribe the DNA puzzle piece sequence provided into mrna by matching the complimentary base pairs. The complimentary pieces should fit together. The Reporter should report the mrna sequence to the ribosome (instructor) before translating. 1. The Recorder should write the complimentary mrna sequence below: Translation Separate your mrna molecule from the DNA molecule. Now, using the trna puzzle pieces, match each three piece codon on the mrna with its trna anticodon. The amino acids from each trna piece will join together to create the protein. 2. The Recorder should write down the trna anticodon sequence and the amino acid sequence below: 3. Use the internet to find the name of the protein you synthesized and record the name of the protein below:

10 Name Date Protein Synthesis Worksheet 1. What is the difference between DNA and RNA? 2. Where in the cell does transcription occur? 3. Where does messenger RNA take the instructions to be translated? 4. What is a codon? 5. What molecule brings the amino acids for translation? 6. What does a chain of amino acids form? 7. What codon signals the end of an amino acid chain? 8. Transcribe the following DNA sequence into mrna: ATTCGCTAACCG 9. Translate the following mrna into amino acids, using the table in your book: AUGCCUUAUUGCCGGUGA