Supplemental Materials and Methods:
|
|
- Juliet Joseph
- 6 years ago
- Views:
Transcription
1 Supplemental Materials and Methods: Cloning: Oligonucleotides used in the subcloning steps are listed in Supplemental Table 1. Human FANCI (isoform 1, KIAA1794) was subcloned from pcmv6-xl4 [FANCI] in two steps: PCR primers with a 5 BamHI linker (FIN-BamHI F) and a 3 SalI linker (FIN-SalI R) were used to amplify FANCI N-terminal coding sequence (codons 1-439) and ligated with BamHI, SalI-digested pfastbacht(b) (Invitrogen). C-terminal FANCI coding sequence was added to this construct as a NotI-NsiI fragment from pcmv-xl4[fanci] to generate full-length FANCI with an N-terminal 6xHis epitope. The FANCI K523R mutation was generated by Quickchange mutagenesis using primers FANCI K523R F and FANCI K523R R. Human FANCL was subcloned from pmieg3his/flag-fancl by PCR with primers FANCL TopoF and FANCL TopoR. The PCR product was inserted into pentr/d-tev-topo, and then transferred into pdest20 by site-specific recombination with LR Clonase (Invitrogen) to generate FANCL with an N-terminal GST epitope. The FANCL C307A mutation was generated by Quickchange mutagenesis using primers FANCL C307A F and FANCL C307A R. Bacmids harboring the expression constructs above were derived from all plasmids in DH10Bac cells according to the manufacturer s instructions (Invitrogen). Sf9 insect cells (Invitrogen) were transfected with bacmids to produce baculoviruses, as well as to amplify the baculoviral titer. Human UBE2T was subcloned from potb7-hube2t (ATCC, Manassas, VA). The PCR product was restricted with BamHI and NotI and ligated with BamHI-, NotIrestricted pgex-6p-1 (GE Healthcare) to generate UBE2T with an N-terminal GST epitope. pgex-6p-1-hube2t was used as a template for Quickchange mutagenesis with primers UBE2T C86A F and UBE2T C86A R to generate the UBE2T C86A mutation. Two C-terminal fragments of FANCI (FIΔN1: codons , and FIΔN2: codons ), were generated by PCR using oligonucleotides FANCI 985 F and FANCI 965 F, respectively, with FANCI NotI R. The BamHI-NotI-restricted PCR product was ligated with BamHI-NotI-restricted pgex-6p-1 to generate FIΔN1 and FIΔN2, each with an N-terminal GST epitope. 1
2 Protein expression and purification FANCI, FANCI K523R and FANCL were produced in High-Five insect cells (Invitrogen) by infection, or co-infection, with the appropriate baculovirus(es) for hours at 27 C, whereupon cells were harvested by centrifugation. UBE2T, FIΔN1 and FIΔN2 were produced in E. coli (Rosetta DE3 plyss), inducing with 0.1 mm IPTG for 6 hours at 16 C for UBE2T, and for hours for the GST-FANCI fragments. Cell pellets were stored at 80 C. Purification of FANCI and FANCI K523R All the purification steps were carried out at 4 o C. Insect cells (300 ml culture) infected with the FANCI or FANCI K523R baculovirus were lysed in 50 ml CBB buffer (50 mm Tris-HCl, ph 7.5, 10% sucrose, 2 mm EDTA) supplemented with 200 mm KCl, 0.01% Igepal (Sigma), 1mM β-mercaptoethanol, and protease inhibitors (5 µg/ml each of leupeptin, chymotrypsinogen, aprotinin, and pepstatin, 0.1 mm PMSF, and 1mM benzamidine), and sonicated for 30 seconds twice on a Bransen 250 sonifier set to power 4.5, 50% output. The lysate was subjected to ultracentrifugation for 90 min at 100,000 Xg. The supernatant was diluted with two volumes of T buffer (25 mm Tris-HCl, 10% glycerol, 0.5 mm EDTA, 0.01% Igepal, 1mM β-mercaptoethanol, and protease inhibitors named above), and then loaded onto a Q Sepharose Fast Flow (Amersham Biosciences) column (40 ml) equilibrated with T buffer containing 100 mm KCl. The column was washed with 100 ml of T buffer containing 100 mm KCl, then eluted with a 400-ml gradient from 150 mm to 550 mm KCl in T buffer. Fractions containing His-FANCI of FANCI K523R eluting between ~ mm KCl were pooled and mixed with 2 ml of Nickel-NTA beads (Qiagen) for 2 hours. The beads were washed with 25 ml each of T buffer containing 1M KCl and 15 mm imidazole, and T buffer containing 100 mm KCl and 30 mm imidazole, before being treated with ml of T buffer with 100 mm KCl containing 300 mm imidazole to elute the bound proteins. The eluate fractions were pooled and fractionated with a 1 ml Mono Q column with a 30 ml, mm KCl gradient in T buffer. Fractions containing (His) 6 -FANCI, or (His) 6 -FANCI K523R, eluting between ~ mm KCl were pooled and concentrated to ~10 mg/ml using an 2
3 Ultracel-30K concentrator (Amicon) before being frozen in liquid nitrogen in small aliquots and stored at 80 C. Purification of FIΔN1 and FIΔN2 All the steps were performed at 4 C. GST-FIΔN1 and GST-FIΔN2 were purified from ~20 g of E. coli paste lysed in 100 ml of T buffer containing 250 mm KCl, 0.01 % Igepal, 1 mm DTT and protease inhibitors as above. Lysates were sonicated for 4 minutes with a Bransen 250 sonifier set to power 7, 50% output, and then subjected to ultracentrifugation for 90 min at 100,000 Xg. The supernatant was diluted with two volumes of T buffer and then loaded onto a Q Sepharose Fast Flow (Amersham Biosciences) column (35 ml) equilibrated with T buffer containing 100 mm KCl. The column was washed with 100 ml of T buffer with 100 mm KCl, then eluted with a 350- ml gradient from 100 mm to 550 mm KCl in T buffer. Fractions containing GST-FIΔN1 or GST-FIΔN2, eluting between ~ mm KCl, were pooled, supplemented with Igepal to 0.05%, and mixed with 1 ml of Glutathione-Sepharose beads (Amersham Biosciences) overnight. The beads were washed with 40 ml of T buffer containing 1 M KCl, and 5 ml of T buffer containing 100 mm KCl, before being treated with 5 ml of T+100 containing 25 mm reduced glutathione to elute the bound proteins. The eluate fractions were pooled and fractionated in a 1 ml Mono Q column with a 20-ml, mm KCl gradient in T buffer; fractions containing GST-FIΔN1, eluting between ~ mm KCl, or GST-FIΔN2, eluting between mm KCl, were pooled and concentrated to ~2 mg/ml using an Ultracel-30K concentrator before being frozen in liquid nitrogen in small aliquots and stored at 80 C. Purification of FANCL and FANCL C307A All the purification steps were carried out at 4 C. Insect cells (380 ml culture) infected with the GST-FANCL or GST-FANCL C307A baculovirus were lysed in 50 ml CBB buffer containing 300 mm KCl, sonicated and clarified as above. The clarified lysate was diluted with T buffer to 60mM KCl, then loaded onto a 40 ml Q Sepharose Fast Flow (Amersham Biosciences) column equilibrated with T buffer containing 100 mm KCl. The column was washed with 100 ml of T buffer containing 100 mm KCl, and then 3
4 eluted with a 400 ml gradient of mm KCl. Fractions containing GST-FANCL or GST-FANCL C307A eluting between 250 and 430 mm KCl were pooled, supplemented with Igepal to 0.1% and KCl to 500 mm, and then mixed with 4 ml Glutathione-Sepharose beads for 2 hours at 4 C. The affinity beads were washed with 30 ml each of T buffer with 500 mm KCl and T buffer with 1 M KCl before being treated with 24 ml T buffer with 100 mm KCl and 25 mm glutathione. The eluate was applied onto a 1 ml Mono Q column equilibrated with T buffer containing 100 mm KCl and eluted with a 40 ml gradient of 150 to 550 mm KCl. Fractions containing GST-FANCL or GST-FANCL C307A eluting between 250 and 440 mm KCl were pooled and concentrated in a Ultracel-30K concentrator to ~1 mg/ml, frozen in liquid nitrogen in small aliquots, and stored at 80 C. Purification of UBE2T and UBE2T C86A All the purification steps were carried out at 4 C. E. coli cells expressing UBE2T or UBE2T C86A (25 g paste) were lysed in 125 ml CBB buffer containing 500 mm KCl with 0.1% Igepal, sonicated and clarified as for FIΔN1 and FIΔN2 above. The cleared lysate was diluted with an equal volume of T buffer containing 500 mm KCl and then mixed with Glutathione-Sepharose beads for 2 hours. The affinity beads were washed with 50 ml each of T buffer with 500 mm KCl and T buffer with 1 M KCl, before being treated with 18 ml T buffer with 100 mm KCl and 25 mm reduced glutathione. The eluate was passed through a 6 ml source Q column equilibrated with T buffer with 100 mm KCl. GST-UBE2T or GST-UBE2T C86A from the Source Q flow through fraction was treated with Precission protease for 12 hours to remove the GST epitope. The protein mixture was filter-dialyzed in an Ultracel-5K concentrator into T buffer with 150 mm KCl, and the cleaved GST epitope and the GST-tagged Precission protease were removed by mixing with 4 ml of Glutathione Sepharose for 12 hours. The supernatant containing UBE2T or UBE2T C86A was concentrated to ~ 1 mg/ml using an Ultracel-5K concentrator, frozen in liquid nitrogen in small aliquots and stored at 80 C. 4
5 Supplemental Figure legends: Supplemental Figure 1. FANCI binds plasmid length ssdna and dsdna. Increasing amounts of FANCI ( µm) were mixed with 150 ng of viral + strand DNA (ss), 100 ng of supercoiled, double-stranded RFI (sc), and/or 100 ng of StuIlinearized double-stranded DNA (ds). Note that treatment of nucleoprotein complexes with SDS and proteinase K (SDS+PK) released the DNA substrates. Supplemental Figure 2. Binding of duplex and partial duplexes by FANCI. FANCI ( µm) was incubated with a mixture of radiolabeled double-stranded linear (H3/H4) and either 5 overhang or 3 overhang DNA (0.3 pmol each). The reaction mixtures were analyzed as in Figure 1. Supplemental Figure 3. FANCI is ubiquitinated by FANCL and UBE2T All reactions contained UBE1, in addition to the components indicated. The C86A mutation in UBE2T disrupts its E2 Ub conjugating activity. Addition of wild type fulllength human FANCI (WT) to the ubiquitination reaction containing FANCL, UBE2T and ATP results in FANCL auto-ubiquitination (Ub-FANCL) as well as a higher molecular weight product - an apparent doublet - visualized with anti-ha (Ub-FANCI). The FANCI K523R substrate (KR) produces only the lower band, with a weaker signal than the wild type protein. 5
6 SUPPLEMENTAL TABLE 1 Oligonucleotides used for subcloning Oligonucleotide name DNA sequence (5 to 3 ) FIN-BamHI F FIN-SalI R FI 985F FI 965F FANCI NotI R FANCI K523R F FANCI K523R R FANCL TopoF FANCL TopoR FANCL C307A F FANCL C307A R UBE2T BamHI F UBE2T NotI R UBE2T C86A F UBE2T C86A R CATGGGATCC GACCAGAAGA TTTTATCTCT AGCAGCAG CTCTGGTCGA CTTTCTTGTC TGATCATCTC ATGGATC CACCGGATCC CTAGTCACGG TTCTTACCAG TTTGTCC CACCGGATCC TCCTTGAATT TACTTAGCAG TCAAGAG GAAAGCGGCCGCAATCTAGAGTCGAG CCTTCGGAGA GCTATGTTTG CCAACC ACATAGCTCT CCGAAGGACA AGTATCAAG CACCATGGCG GTGACGGAAG CGAGC TCAGTGTTTC CTTCCAGACA TTTTTAAG ACTATGGATG CTGGAATTTG TTATGCTTATC CAAATTCCAG CATCCATAGT AAAATCAGAT T CACCGGATCC ATGCAGAGAG CTTCACGTCT GAAG CGAGCGGCCG CAGGACAAGT CCCCTAAACA TCAGGATG GGAAGGATTG CTCTGGATGT TCTCAAATTG CC GAACATCCAG AGCAATCCTT CCAGCAG 6
7 SUPPLEMENTAL TABLE 2A Oligonucleotides used for DNA binding substrates Oligonucleotide name DNA sequence (5 to 3 ) H1 H2 H3 H4 H5 H6 H7 H8 ATTAAGCTCT AAGCCATGAA TTCAAATGAC CTCTTATCAA CATATTTAAA ACATGTTGGA TCCCAGCACC AGATTCAGCA TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAAT TGCTGAATCT GGTGCTGGGA TCCAACATGT TTTAAATATG CATATTTAAA ACATGTTGGA TCCCAGCACC AGATTCAGCA ATTAAGCTCT AAGCCATGAA TTCAAATGAC CTCTTATCAA CATATTTAAA ACATGTTGGA TCCCAGCACC AGATTCAGCA TACGTTACCG ATCGTACGTT CGATGCTGGC TACTGCTAGC GCTAGCAGTA GCCAGCATCG AACGTACGAT CGGTAACGTA GCTAGCAGTA GCCAGCATCG AACGTACGAT CGGTAACGTA GTCGATTATC GAGATCAAGC TAGCATAGCC ATAGCGCGAC GTCGCGCTAT GGCTATGCTA GCTTGATCTC GATAATCGAC ATTAAGCTCT AAGCCATGAA TTCAAATGAC CTCTTATCAA dt (T) 83 P1 TTATATCCTT TACTTTGAAT TCTATGTTTA ACCTTTTACT TATTTTGTAT TAGCCGGATC CTTATTTCAA TTATGTTCAT 7
8 SUPPLEMENTAL TABLE 2B DNA binding substrates Substrate name Oligonucleotides used Structure Oligo-dT (dt) dt Single-strand P1 P1 Single-strand H3 H3 Single-strand H3/H4 H3, H4 Double-strand 3 OH H3, H1 3 overhang 5 OH H3, H2 5 overhang Y-fork H3, H5 fork Holliday junction (HJ) H3, H5, H7, H8 HJ 8
9 9 Longerich_Supp. Fig. 1, 2
10 10 Longerich_Supp. Fig. 3
Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)
Ni-NTA Agarose User Manual 320 Harbor Way South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 871-8796 www. Contents Introduction -----------------------------------------------------------------------
More informationPROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationStabilization of a virus-like particle and its application as a nanoreactor at physiological conditions
Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationINSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE Nickel NTA Agarose Beads DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous
More informationNickel-NTA Agarose Suspension
Nickel-NTA Agarose Suspension Agarose beads for purification of His-tagged proteins Product No. A9735 Description Nickel-NTA Agarose Suspension is an agarose-based affinity chromatography resin allowing
More informationINSECT CELL/BACULOVIRUS PRODUCTION
INSECT CELL/BACULOVIRUS PRODUCTION PEF # GENE NAME TRANSFER VECTOR BEVS MOLECULAR WEIGHT 2015-XXXX XXXX pbac1 flashbacultra TM 36.0 kda EXPRESSION METHOD OVERVIEW: Insect cells Spodoptera frugiperda (Sf9)
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationDNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.
Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Nickel NTA Agarose Cartridges 5ml are used for purification of histidine-tagged proteins in native or denaturing conditions. This cartridge can be used with an automated chromatography system,
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted
More information1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.
1 AFFINITY GST PURIFICATION Procedure for Use Glutathione Agarose 4 Resin DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding
More informationChIP-chip protocol adapted for the mod-encode project
ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human
More informationA General Protocol for GST Pull-down Lili Jing *
A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down
More informationGGNB Method Course. PCR: self- made enzymes, helpful additives and insights into the reactions PRACTICAL PART
GGNB Method Course PCR: self- made enzymes, helpful additives and insights into the reactions PRACTICAL PART 16.10.2012 Koray Kirli and Steffen Frey Cellular Logistics Prof. Dirk Görlich MPI for Biophysical
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationGlutathione Sepharose High Performance
instructions Glutathione Sepharose High Performance Glutathione Sepharose High Performance is an affinity chromatography medium designed for easy, one-step purification of glutathione S-transferase (GST)
More informationSupplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
More informationLecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
More informationSupplemental Information. OprG Harnesses the Dynamics of its Extracellular. Loops to Transport Small Amino Acids across
Structure, Volume 23 Supplemental Information OprG Harnesses the Dynamics of its Extracellular Loops to Transport Small Amino Acids across the Outer Membrane of Pseudomonas aeruginosa Iga Kucharska, Patrick
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationPurification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki
Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric
More informationN-terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry -terminal dual protein functionalization by strainpromoted alkyne nitrone cycloaddition Rinske P. Temming, a Loek Eggermont,
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationApplications involving the ViroCyt Virus Counter in the production of various recombinant proteins
Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Chris Kemp Kempbio, Inc. Frederick, MD USA chris.kemp@kempbioinc.com Presentation Summary Kempbio, Inc.
More informationE.Z.N.A. Tissue RNA Kit. R preps R preps
E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationFigure 1. Schematic of Ats1p expression plasmid.
Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationNi-NTA Spin Kit Handbook
Second Edition Editon December January 2005 2008 Ni-NTA Spin Kit Handbook Ni-NTA Spin Kit Ni-NTA Spin Columns For manual or automated purification of His-tagged proteins Sample & Assay Technologies QIAGEN
More informationE.Z.N.A. Blood DNA Mini Kit. D preps D preps D preps
E.Z.N.A. Blood DNA Mini Kit D3392-00 5 preps D3392-01 50 preps D3392-02 200 preps January 2017 E.Z.N.A. Blood DNA Mini Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationRotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein
Rotation Report Sample Version 2 Due Date: August 9, 1998 Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Anita H. Corbett Advisor: Amy Jones Rotation 1 Abstract:
More informationE.Z.N.A. Blood DNA Maxi Kit. D preps D preps
E.Z.N.A. Blood DNA Maxi Kit D2492-00 2 preps D2492-03 50 preps April 2014 E.Z.N.A. Blood DNA Maxi Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More information2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11
Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationGlutathione Sepharose 4 Fast Flow GSTPrep FF 16/10 GSTrap FF
GE Healthcare Data file 8-74-85 AC Affinity chromatography Glutathione Sepharose 4 Fast Flow GSTPrep FF 6/ GSTrap FF Glutathione Sepharose 4 Fast Flow is an affinity chromatography medium for the isolation
More informationE.Z.N.A. Stool DNA Kit. D preps D preps D preps
E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps April 2013 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationStrep-Tactin Spin Column Purification Protocol
Strep-Tactin Spin Column Purification Protocol Last date of revision February 2008 Version PR10-0005 IBA Headquarters IBA GmbH Rudolf-Wissell-Str. 28 D-37079 Göttingen Germany Tel: +49 (0) 551-50672-0
More informationWhy adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase
Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known
More informationDNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli
Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain
More informationShort Technical Reports
Large-Scale Purification of a Stable Form of Recombinant Tobacco Etch Virus Protease BioTechniques 30:544-554 (March 2001) ABSTRACT Tobacco etch virus NIa proteinase (NIa- Pro) has become the enzyme of
More informationE.Z.N.A. Blood DNA Midi Kit. D preps D preps
E.Z.N.A. Blood DNA Midi Kit D3494-00 2 preps D3494-04 100 preps August 2013 E.Z.N.A. Blood DNA Midi Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing
More informationSupplementary Figure 1. HiChIP provides confident 1D factor binding information.
Supplementary Figure 1 HiChIP provides confident 1D factor binding information. a, Reads supporting contacts called using the Mango pipeline 19 for GM12878 Smc1a HiChIP and GM12878 CTCF Advanced ChIA-PET
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationO-GlcNAcase Activity Assay
O-GlcNAcase Activity Assay Prepared by Jen Groves and Junfeng Ma, The Johns Hopkins Unviersity School of Medicine Based on: Macauley MS et al., 2005. O-GlcNAcase uses substrate-assisted catalysis: kinetic
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More informationEngineering AKAP-selective regulatory subunits of PKA through structure-based phage. selection (Gold et al.): Supplementary Information
Engineering AKAP-selective regulatory subunits of PKA through structure-based phage selection (Gold et al.): Supplementary Information Supplementary Methods Protein purification- 16 DNA sequences coding
More informationCloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)
Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with
More informationE.Z.N.A. Yeast Plasmid Mini Kit. D preps D preps
E.Z.N.A. Yeast Plasmid Mini Kit D3376-00 5 preps D3376-01 50 preps November 2015 E.Z.N.A. Yeast Plasmid Mini Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing
More informationSupporting Information. SI Material and Methods
Supporting Information SI Material and Methods RNA extraction and qrt-pcr RNA extractions were done using the classical phenol-chloroform method. Total RNA samples were treated with Turbo DNA-free (Ambion)
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION A human XRCC4-XLF complex bridges DNA ends. Sara N. Andres 1, Alexandra Vergnes 2, Dejan Ristic 3, Claire Wyman 3, Mauro Modesti 2,4, and Murray Junop 2,4 1 Department of Biochemistry
More informationStrep-Tactin XT Spin Column
Strep-Tactin XT Spin Column Purification Protocol Last date of revision Last June date 2017 of revision June 2017 Version PR90-0001 Version PR90-0001 For research use only Important licensing information
More informationCellular Fractionation
Cellular Fractionation Lamond Lab Protocol 2007 More detailed protocol can be found here: http://www.lamondlab.com/f7nucleolarprotocol.htm This protocol has been adapted to fractionate a variety of different
More informationFigure 1: E. Coli lysate transfer using liquid handling automation
Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1 - E. coli lysate transfer using liquid handling automation. Following the manufacturer s procedures, a 96-well plate miniprep
More informationE.Z.N.A. Stool DNA Kit. D preps D preps D preps
E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps July 2017 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage
More informationDynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors
Contact Us: www.pall.com/contact Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors Dynamic High Capacity Mustang Q Membrane Units
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationMechanism of Transcription Termination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element
Molecular Cell Supplemental Information Mechanism of ranscription ermination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element Aneeshkumar G. Arimbasseri and Richard
More informationRapid DNA Ligation & Transformation Kit
1 Rapid DNA Ligation & Transformation Kit (#K1432 for 30 reactions) INTRODUCTION The Rapid DNA Ligation & Transformation Kit enables ligation of any type of DNA in 5 minutes at ambient temperature followed
More informationEluted DNA is high quality and inhibitor-free making it ideal for PCR and genotyping.
INSTRUCTION MANUAL ZR DNA-Card Extraction Kit Catalog No. D6040 Highlights Get the DNA out! Simple and efficient procedure for the purification of DNA from samples collected onto Guthrie, FTA, and other
More informationab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression
ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table
More informationNote: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationE.Z.N.A. Water DNA Kit. D preps D preps D preps
E.Z.N.A. Water DNA Kit D5525-00 5 preps D5525-01 50 preps D5525-02 200 preps April 2017 E.Z.N.A. Water DNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing
More informationSupporting Information
Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a
More informationReconstitution of Enzymatic Activity by the Association of the Cap and Catalytic Domains of Human Topoisomerase I*
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 34, Issue of August 23, pp. 30815 30823, 2002 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Reconstitution
More informationSUMOstar Insect Cell Expression and Purification Systems
SUMOstar Insect Cell Expression and Purification Systems Catalogue #3100 (Intracellular Kit) 3101 (Intracellular Vector) 3105 (Secretory Kit) 3106 (Secretory Vector) PRODUCT MANUAL LifeSensors Inc. 271
More informationViraPower BacMam Expression System and BacMam pcmv-dest Vector Kit
user guide ViraPower BacMam Expression System and BacMam pcmv-dest Vector Kit BacMam and Gateway adapted system which enables transfection and transduction of large genes Catalog Numbers A24223, A24227
More informationPowerSoil DNA Isolation Kit
PowerSoil DNA Isolation Kit Catalog No. Quantity 12888-50 50 Preps 12888-100 100 Preps Instruction Manual Introduction The PowerSoil DNA Isolation Kit* is comprised of a novel and proprietary method for
More informationPresto Mini gdna Bacteria Kit
Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:
More informationE.Z.N.A. Bacterial RNA Kit. R preps R preps
E.Z.N.A. Bacterial RNA Kit R6950-00 5 preps R6950-01 50 preps July 2017 E.Z.N.A. Bacterial RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Before Beginning...4
More informationStrep-Tactin Spin Column
Strep-Tactin Spin Column Purification Protocol Last date of revision November 2012 Version PR10-0006 www.strep-tag.com For research use only Important licensing information Products featuring Strep-Tactin
More informationPurification of mfp. from an Overnight Culture. Laboratory 17
Purification of mfp from an Overnight Culture When scientists at a therapeutics company, like Amgen, have successfully identified a promising therapeutic protein, two objectives would be to locate and
More informationDirecte d Mutagenesis
Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis
More informationSupplemental Protocols Gagnon et al., 2014
Last updated April 15th 2014 There may be a more up-to-date version of this protocol on our website http://labs.mcb.harvard.edu/schier/index.html Protocol Page Flowchart for Cas9-mediated mutagenesis 1
More informationProductInformation. Genomic DNA Isolation Kit. Product No. GDI-3 Technical Bulletin No. MB-275 May 2000 TECHNICAL BULLETIN
Genomic DNA Isolation Kit Product No. GDI-3 Technical Bulletin No. MB-275 May 2000 TECHNICAL BULLETIN ProductInformation Product Description Sigma s Genomic DNA Isolation Kit isolates genomic DNA from
More informationQIAGEN Supplementary Protocol: Isolation of genomic DNA from tissue using the QIAGEN-tip Storage of tissue samples.
QIAGEN Supplementary Protocol: Isolation of genomic DNA from tissue using the QIAGEN-tip 2500 This protocol is designed for the rapid, easy, and non-toxic preparation of up to 2 mg genomic DNA from not
More informationE.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps
E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3
More informationPowerMax Soil DNA Isolation Kit
PowerMax Soil DNA Isolation Kit Catalog No. Quantity 12988-10 10 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the
More informationMEK1/2 (MAPK Kinase) Activity Assay Kit
MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)
More information4 There are both multiple genes for eif4g (10, 49) and multiple protein isoforms
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 3, pp. 1695 1708, January 19, 2007 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Functional Analysis
More information