Conversion of plasmids into Gateway compatible cloning
|
|
- Elaine Crawford
- 6 years ago
- Views:
Transcription
1 Conversion of plasmids into Gateway compatible cloning Rafael Martinez Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from a pdest. 3. Open your plasmid with the enzyme of choice. 4. Create blunt ends in your plasmid by T4 DNA polymerase treatment. 5. To avoid self-ligation treat the plasmid with CIP. 6. Amplify by PCR the Gateway cassette of choice. 7. Perform a T4_kinase treatment. 8. Ligate the Gateway cassette with the open plasmid by T4 ligase. 9. Transform with ccdb SurvivalTM 2 T1R competent Cells 10. Analyze the transformants Example: In the following example we are going to convert a plasmid with a C-terminal tag into gateway compatible cloning. 1. Selection of right Gateway Cassette and Enzyme to open the plasmid. Select the right Gateway cassette (A, B or C) according with the position of the tag in your plasmid (at N- or C-terminal). Also verify what enzyme will be the best to open the plasmid. Check the Gateway Convertion Kit manual for more details. In this example the Gateway cassette B is ideal because it will be in frame with a C-terminal tag from the plasmid. For this example the plasmid needs to be open with BamIII. 2. Design primers to amplify the right Gateway cassette from a pdest. Do not add extra bases at the ends. Alternatively you can get the Gateway Conversion kit (Invitrogen ) Primer Sequence Tm Forward primer ATCAACAAGTTTGTACAAAAAAGC 60 Reverse primer ATCAACCACTTTGTACAAGAAAGCTG 65
2 3. Opening the plasmid. In this example we digest the plasmid with BamHI. It is important to start with at least 4 µg of plasmid since the amount will decrease due cleaning steps. Opening plasmid Reaction Amount plasmid (144 ng/µl) 30 4 µg NEB Buffer 3 10x BamHI U H20 (BSA 100µg/ml) 14 Clean the reaction with spin-column purification (Qiagen). 4. Create blunt ends in your plasmid by T4 DNA polymerase treatment. If the enzyme digestion does not generate blunt ends, then is necessary to create them with a treatment with T4 DNA Polymerase (NEB M023S). In this example the reaction is: Blunt ends with T4 DNA polymerase Reaction Concentration Digested plasmid (86ng/ml) T4 DNA polymerase 1 1U/µg dntps [10mM] 1 Buffer 2 10x 5 H20 (BSA 100µg/ml) 13 Incubate 12 C for 15 min Inactivate 75 C for 20 min. 5. To avoid self-ligation treat the plasmid with CIP. We used Alkaline Phosphatase, Calf Intestinal (CIP) (Finnzymes F-201S). CIP catalyses the removal of 5' phosphate residues from DNA to prevent self ligation. The manual of CIP recommends to calculate 1 pmol (1µM) of plasmid, in this example the plasmid has a size of 4026pb and according with the following formula: pmoles (µm) x length x 650 /10 6 = ng 1 pmol x 4026 x 650/ 10 6 = ng 1 pmol = 2616 ng
3 The CIP treatment is as the following: CIP treatment Plasmid (open+t4 treated) (86ng/ml) µg = 1pmol CIP 0.5 Buffer 10X 5 Water X Incubate 37 C for 1 hr Inactivate 65 C for 15 min Although the CIP manual does not comment about heat inactivation, this step is added in order to avoid another spin-column cleaning (and reduce the amount of plasmid). 6. Amplify by PCR the Gateway cassette of choice. Amplify by PCR the gateway cassette from a pdest with primers designed in step 2. Use a High Fidelity DNA Polymerase that generates blunt ends i.e Phusion (Finnzymes F-530S). PCR Master mix 1x 4X PCR conditions Buffer HF 5x Temperature Time Cycles Forward primer (10µM) C 30s 1 Reverse primer (10µM) C 10s dntps [10mM] C 30s 30 pdest (200 ng/µl) C 30s Phusion enzyme 2 U/µl C 7 min 1 H2O C 1 min PCR from Cassette B using pcdna6.2 N-eGFP as a template. The PCR product is 1713 pb Run the PCR product in an agarose gel, cut the right band and clean it with a spin column purification (i.e. Qiagen). 7. Perform a T4_kinase treatment with the PCR product To clone blunt-end fragments is necessary that the insert has a 5' phosphate residues, normal PCR primers are provided without them, if that is the case a step with a T4_kinase is needed to add them. At this stage the plasmid does not have 5' phosphates since they were eliminated with the CIP treatment in step 5. An example of the T4_kinase (NEB M0201S) is as the following: T4_kinase treatment Reaction Gateway cassette 17ng/µl 44 T4_kinase Buffer 10x 5 T4_kinase 10U/µl 1 Incubate 30 min at 37 C Inactivate enzyme 65 C 20 min
4 8. Ligate the Gateway cassette with the open plasmid using T4 ligase. Now is time to join the Gateway cassette and the plasmid. Try molar ratios of 1:1 and 1:3 (insert/vector). Here is a Promega tool that helps with that calculations. The following is an example of a typical T4 ligase (NEB M0202S) reaction: T4 DNA ligase reaction 1 2 Tube1 Tube2 Gateway cassette B_kinase treated 17ng/µl Ratio 1:1 Ratio 1:3 Plasmid (open/t4/cip/treated) 40ng/µl ng 56.3ng Buffer 10x ng 50ng T4 DNA ligase 1 1 H2O total Incubate overnight 20 C Inactivate 65 C for 10 minutes To be in the safe side leave the incubation overnight and inactivate with heat. 9. Transformation Now the plasmid contains the Gateway cassette and therefore it needs to be cloned in competent cells that are resistant to ccdb gene. Take 2µl of the ligation and transform in ccdb SurvivalTM 2 T1R competent Cells (Invitrogen A10460) follow the protocol. Be sure to plate the cells on a LB-agar dish with a proper antibiotic (resistance from the original plasmid) plus 30µg/ml of Cloramphenicol. 10. Analyze the transformants Since a blunt-end ligation was done then 50% percent of the colonies will have the insert in the right orientation and in the other 50% the insert will be inverted. Select several colonies and analyze them by enzyme digestion. Digestion analysis with SphI and BamHI of a plasmid converted to gateway compatible cloning. According with the expected digestion pattern samples on wells 7-10 and 13 have the right construct. Samples in wells 1,2,4,6,11,12,14-16 have the gateway cassette inverted.
5 Sequence the positive clones to verify that the Gateway cassette is in frame with the C-terminal tag. Design primers at about 50 bp from the join insert/plasmid: For plasmids with a C-terminal tag the triplet AAA located at the att2 sequence (gateway cassette) must be in frame with the start codon of the C-terminal tag. References
Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationTrueORF TM cdna Clones and PrecisionShuttle TM Vector System
TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available
More informationPrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual
PrecisionX Multiplex grna Cloning Kit Store at -20 C upon receipt A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationCloning Multiple Gateway Reaction
Cloning Multiple Gateway Reaction by A. Untergasser (contact address and download at www.untergasser.de/lab) Version: 1.0 - Print Version (.PDF) ATTENTION: This is not something what is done with low quality
More informationTable of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3
Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationKOD -Plus- Mutagenesis Kit
Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.
More informationBasic Protocol (v. 2.0, May, 2003)
Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC
More informationThe RNAi Core Version 2 (12/04/08)
Protocol for shrna construction-i: PCR method Preparation of cloning vector: 1. Incubate 3 μg of shrna cloning vector with 10 units restriction enzymes (RE; NEB) of EcoRI and AgeI, (double digestion),
More informationVector Linearization. igem TU/e 2015 Biomedical Engineering
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationCloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)
Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with
More informationTA-Blunt Ligation Kit Manual (3 rd edition)
TA-Blunt Ligation Kit Manual (3 rd edition) Code No. 315-6541 Code No. 311-6543 For 5 reactions For 5 reactions - Description - Nippon Gene has been offering the Ligation-Convenience Kit which can be used
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationQ5 Site-Directed Mutagenesis Kit
DNA MODIFYING ENZYMES Q5 Site-Directed Mutagenesis Kit Instruction Manual NEB #E0554S 10 reactions Version 1.0 1/13 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes
More informationCELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationRapid DNA Ligation & Transformation Kit
1 Rapid DNA Ligation & Transformation Kit (#K1432 for 30 reactions) INTRODUCTION The Rapid DNA Ligation & Transformation Kit enables ligation of any type of DNA in 5 minutes at ambient temperature followed
More informationMade 1,2 % agarose gel with ETBR. Ran 5 ul samples of each PCR reaction with 1 ul LD on gel: 20 min, 120V. Used Gene O'Ruler 1 kb ladder.
10.8.2015 MONDAY, 8/10 Petra, Tamannae Did a new PCR reaction for amphiphilic protein with linker, because purification of the reaction done last week was unsuccesful (A260/A280: 1,12). Chose Tm according
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More information#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C
PRODUCT INFORMATION Thermo Scientific FastDigest SalI #FD0644 Lot: 5'...G T C G A C...3' 3'...C A G C T G...5' Supplied with: Store at -20 C 200 µl (for 200 rxns) Expiry Date: BSA included www.thermoscientific.com/onebio
More informationMultiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)
Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 1.1 July 2014 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More informationMutating Asn-666 to Glu in the O-helix region of the taq DNA polymerase gene
Research in Pharmaceutical Sciences, April 2010; 5(1): 15-19 Received: Oct 2009 Accepted: Jan 2010 School of Pharmacy & Pharmaceutical Sciences 15 Isfahan University of Medical Sciences Original Article
More informationPreparing Samples for Sequencing Genomic DNA Using the Genomic DNA Sample Prep Oligo Only Kit
Preparing Samples for Sequencing Genomic DNA Using the Genomic DNA Sample Prep Oligo Only Kit Topics 3 Introduction 5 Kit Contents, User-Supplied Reagents, and Equipment 7 Fragment the Genomic DNA 10 Perform
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationMultiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)
Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 2.0 May 2015 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationThe Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo
The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)
More informationLibrary Preparation for Illumina Sequencing
Materials Library Preparation for Illumina Sequencing Cleanup Kits: Ampure Store in +4 o C: Fermentas 1kb Ladder, Low Mass Ladder Phusion DNA polymerase, NEB Cat# F-531 (-20 o C for long term storage)
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationNEBNext Ultra Ligation Module
LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic
More informationPlatinum Gate TALEN construction protocol (Yamamoto lab)
Platinum Gate TALEN construction protocol (Yamamoto lab) Ver. 1.0 Jan. 2014 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and Life Sciences
More informationGeneArt Seamless Cloning and Assembly Kit
USER GUIDE GeneArt Seamless Cloning and Assembly Kit For highly-efficient, simultaneous and seamless in vitro assembly of up to 4 DNA fragments plus a vector in a pre-determined order Catalog Number A13288
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationMOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING
BME MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING SKKU BME 3 RD GRADE, 2 ND SEMESTER FOR FUN PCR & SEEDING PCR: polymerase chain reaction Electrophoresis Seeding These are for amplifying DNA and cell PCR
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationMightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
More informationCompetent cells IGEM 2015 TU DELFT 1
1 Competent cells 1. Plate Top10 cells and incubate at 37ºC overnight 2. Pick one colony, inoculate in LB media and incubate overnight while shaking at 37ºC 3. Dilute the culture in fresh medium, and continue
More informationDNA Ligation Kit Ver.1
Cat. # 6021 For Research Use DNA Ligation Kit Ver.1 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Protocols and Examples 1.Ligation of a DNA fragment with
More informationDiagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support
Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationDNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.
Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationminipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk!
minipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk! An E. coli outbreak affects astronaut food aboard the International Space Station. DNA samples from two food racks are analyzed to determine
More informationIn-Fusion Advantage PCR Cloning Kit
User Manual In-Fusion Advantage PCR Cloning Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More informationHaloTag Complete Pull-Down System
TECHNICAL MANUAL HaloTag Complete Pull-Down System Instructions for Use of Product G6509 Revised 8/17 TM360 HaloTag Complete Pull-Down System All technical literature is available at: /protocols/ Visit
More informationEXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO)
EXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO) Purposes: 1. (Long term) To determine the activity of the promoter of the gene of interest at the cellular and tissue levels
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- Neo 1109 F1066K KOD -Plus- Neo Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction
More informationMgCl 2 (25 mm) 1.6 ml 1.6 ml 1.6 ml 1.6 ml
Technical Data Sheet KAPA2G Fast PCR Kit Kit components KK 5008 Product codes KK 5010 KK 5009 KK 5011 KAPA2G Fast DNA polymerase (5 U/μl) 100 U 100 U 250 U 250 U 1. Production Description The KAPA2G Fast
More information2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11
Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationAmplicon Library Preparation Method Manual. GS FLX Titanium Series October 2009
GS FLX Titanium Series 1. Workflow 3. Procedure The procedure to prepare Amplicon libraries is shown in Figure 1. It consists of a PCR amplification, performed using special Fusion Primers for the Genome
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationProtocol for tissue-specific gene disruption in zebrafish
Protocol for tissue-specific gene disruption in zebrafish Overview This protocol describes a method to inactivate genes in zebrafish in a tissue-specific manner. It can be used to analyze mosaic loss-of-function
More informationConstruction of pcxz14w, a Novel puc19-derived Plasmid Encoding the rop Gene
Construction of pcxz14w, a Novel puc19-derived Plasmid Encoding the rop Gene Shary Chen, Ziyan Xu, Wenchen Zhao Department of Microbiology and Immunology, University of British Columbia When the ColE1-derived
More informationCloning DNA Amplification DNA Preparation
Cloning DNA Amplification DNA Preparation 01 Cloning AccuRapid Cloning Kit 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Ligase 8 AccuRapid
More informationGolden Gate TALEN assembly
Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to
More informationPlasmid Subcloning using low melt ligation
Design Considerations Plasmid Subcloning using low melt ligation General 1) We much prefer directional cloning (since it usually works better and takes less time) and we have found that with the help of
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.
More information1. DNA Cloning. Blunt-end DNA Cloning Kits TA DNA Cloning Kits Universal DNA Cloning Kits Chemically competent cells Mutagenesis Other compounds
1. DNA Cloning Blunt-end DNA Cloning Kits TA DNA Cloning Kits Universal DNA Cloning Kits Chemically competent cells Mutagenesis Other compounds Photo: Embryo of lily ovary 10 Accelerating your Molecular
More informationTHE EXPERIMENTAL PRACTICE OF GAPDH GENE CLONING AND SEQUENCING IN SPECIES OF BASIL AND CILANTRO
THE EXPERIMENTAL PRACTICE OF GAPDH GENE CLONING AND SEQUENCING IN SPECIES OF BASIL AND CILANTRO Experiment Completed: November 29, 2011 Experiment Submitted: December 9, 2011 Genetics Lab Tuesday 11AM
More informationCloning of shrna Templates into shrna Expression Vector User Manual
Cloning of shrna Templates into shrna Expression Vector User Manual Table of Contents Page A. Background 1 B. Required Materials 1 C. Cloning of shrna Template Oligonucleotides into shrna Expression Vector
More informationFosmidMAX DNA Purification Kit
Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A
More informationProtocol INTRODUCTION MATERIALS. Directional Cloning of PCR Products
1 of 9 4/29/2009 3:49 PM Cite as: Cold Spring Harb. Protoc.; 2006; doi:10.1101/pdb.prot4140 Protocol Directional Cloning of PCR Products Gina L. Costa and Michael P. Weiner This protocol was adapted from
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationpbluescript II RI Predigested Vector
pbluescript II RI Predigested Vector INSTRUCTION MANUAL Catalog #212250 Revision A For In Vitro Use Only 212250-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product.
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationCat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da
Cat. # 6046 For Research Use BcaBEST Labeling Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Principles... 4 V. Protocol... 5 VI. Effect of Template
More information3'-Full RACE Core Set
Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)
More informationpfb and pfb-neo Retroviral Vectors
pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationGateway Vectors for BiFC
Gateway Vectors for BiFC 1. The enhanced YFP (EYFP) are used (Split EYFP). 2. The Fusion fusion gene is expressed by CaMV35S promoter. 3. The N- or C-terminal fragments of EYFP are fused subsequent to
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationConstruction of an enlarged puc19 vector with a rop gene designed to study plasmid maintenance in Escherichia coli
Construction of an enlarged puc19 vector with a rop gene designed to study plasmid maintenance in Escherichia coli Benson Chang, Arnab Ray, Thomas Tsuei, Rachel Wan Department of Microbiology and Immunology,
More informationLaboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
More informationE.Z.N.A. Cycle Pure Kit
E.Z.N.A. Cycle Pure Kit D6492-00 5 preps V-spin D6492-01 50 preps V-spin D6492-02 200 preps V-spin D6493-00 5 preps Q-spin D6493-01 50 preps Q-spin D6493-02 200 preps Q-spin March 2017 E.Z.N.A. Cycle Pure
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION A human XRCC4-XLF complex bridges DNA ends. Sara N. Andres 1, Alexandra Vergnes 2, Dejan Ristic 3, Claire Wyman 3, Mauro Modesti 2,4, and Murray Junop 2,4 1 Department of Biochemistry
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationEfficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationScore winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
More informationBacterial 16S rdna PCR Kit Fast (800)
Cat. # RR182A For Research Use Bacterial 16S rdna PCR Kit Fast (800) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...
More informationCat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da
Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More information